TGF-Î²1-Loaded Silk Fibroin-Porous

Subscriber access provided by OCCIDENTAL COLL

Biological and Medical Applications of Materials and Interfaces

Sustained release SDF-1#/TGF-#1-loaded silk fibroinporous gelatin scaffold promotes cartilage repair Yuanfeng Chen, Tingting Wu, Shusen Huang, Chun-Wai Wade Suen, Xin Cheng, Jieruo Li, Huige Hou, Guorong She, Huantian Zhang, Huajun Wang, Xiaofei Zheng, and Zhengang Zha ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b01532 • Publication Date (Web): 02 Apr 2019 Downloaded from http://pubs.acs.org on April 3, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Sustained release SDF-1α/TGF-β1-loaded silk fibroin-porous gelatin scaffold promotes cartilage repair Yuanfeng Chen1#*, Tingting Wu1#, Shusen Huang1, Chun-Wai Wade Suen3, Xin Cheng2, Jieruo Li1, Huige Hou1, Guorong She1, Huantian Zhang1, Huajun Wang1, Xiaofei Zheng1*, Zhengang Zha1*

1. Institute of Orthopedic Diseases and Center for Joint Surgery and Sports Medicine, the First Affiliated Hospital, Jinan University, Guangzhou, PR China. 2. Department of Histology and Embryology, Joint Laboratory for Embryonic Development & Prenatal Medicine, Medical College, Jinan University, Guangzhou, Guangdong, China. 3.

Department of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom.

* Correspondence: [email protected]; [email protected] or [email protected].

# These authors contributed equally to this manuscript.

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Graphic abstract One of the main challenges in the field of biomedical engineering is to provide a suitable microenvironment which not only maintains the chondrogenic potential of endogenic stem cells, but also let them acquire sufficient homing capacity to the injury site. In the present study, we fabricated a sustained release SDF-1α/TGF-β1 loaded silk fibroinporous gelatin scaffold. Our results demonstrated that this scaffold facilitates MSCs homing, migration, chondrogenic differentiation and SDF-1α/TGF-β1 have a synergistic effect on enhancing in vitro and in vivo cartilage forming capacity


Page 2 of 35

Page 3 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Continuous delivery of growth factors to the injury site is crucial to creating a favorable microenvironment for cartilage injury repair. In the present study, we fabricated a novel sustained-release scaffold, SDF-1α / TGF-β loaded silk fibroinporous gelatin scaffold (GSTS). GSTS persistently releases SDF-1α and TGF-β1 which enhance cartilage repair by facilitating cell homing and chondrogenic differentiation. Scanning electron microscopy showed that GSTS is a porous micro-structure and protein release assay demonstrated the sustainable release of SDF-1α and TGF-β1 from GSTS. Bone marrow-derived mesenchymal stem cells (MSCs) maintain a high in vitro cell activity, excellent cell distribution and phenotype after seeding into GSTS. Furthermore, MSCs acquired enhanced chondrogenic differentiation capability in the TGF-β1-loaded scaffolds (GSTS or GST: loading TGF-β1 only) and the conditioned medium from SDF-1α-loaded scaffolds (GSTS or GSS: loading SDF-1α only) effectively promoted MSCs migration. GSTS was transplanted into the osteochondral defects in the knee joint of rats and it could promote cartilage regeneration and repair the cartilage defects at 12 weeks after transplantation. Our study shows that GSTS can facilitate in vitro MSCs homing, migration, chondrogenic differentiation and SDF-1α and TGF-β1 have a synergistic effect on the promotion of in vivo cartilage forming. This SDF-1α and TGF-β1 releasing GSTS have promising therapeutic potential in cartilage repair.

Keywords: SDF-1α, TGF-β1, silk fibroin, gelatin, cartilage



Page 4 of 35

1. Introduction Articular cartilage is a tissue specialized for the transmission of high loads, however, when it is damaged, it is lack of enough self-healing capacity because of its avascular, aneural and alymphatic nature

1-2.

Articular cartilage injury, from wear to tear,

predisposes to the development of traumatic osteoarthritis (OA). Patients with OA suffer from swelling, stiffness and pain at the diseased joints on the daily lives which reduce their work capacity and lower their quality of life. It is reported that over 20 million people suffer from OA in the US 3. World Health Organization (WHO) also predicted that the fourth leading cause of disability in 2020 will be OA 4. Current treatments in cartilage injury are only available in symptoms relieving but cannot slow down the cartilage deterioration. Although conventional surgical procedures such as microfracture

5-6,

autograft and allograft mosaicplasty 7 are available, however, there

are limitations which microfracture seldom generates articular cartilage

8

and

mosaicplasty is often restricted by the shortage of donor tissues. Moreover, the current surgical techniques are also limited by the possible complications and the second operation. Biomedical engineering on cartilage research provides a promising strategy which has extraordinary potential to develop therapeutics for cartilage defects repair with the minimally invasive operation. Developing a one-step in situ cartilage repair therapeutics by integrating biomaterials and endogenic cells is a recent trend in the field of biomaterial engineering9-10. Endogenic cells, like bone marrow-derived mesenchymal stem cells (BMSCs), play a key role in the successful cartilage repairing, however, the poor migration and short


Page 5 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


local retention of endogenic MSCs restrict their uses in cartilage repairing 10-11. An ideal scaffold for cartilage repair should be capable to recruit sufficient MSCs from subchondral bone and retain them at the defected cartilage12. Stromal-derived factor-1α (SDF-1α), is a well-known chemokine and the ligand of C-X-C chemokine receptor type 4 (CXCR-4). Studies have reported that SDF-1α induces stem-cell recruitment and migration13-15. Our previous study also demonstrated that SDF-1 is an important factor for MSCs homing to the subchondral bone during the progression of OA 16. Since SDF1α could effectively attract and retain an adequate number of endogenic MSCs to the damaged area in cartilage, there is a great therapeutic potential to load SDF-1α into the scaffolds for cartilage injury repair. Maintenance of chondrogenic microenvironment for MSCs without affecting the yield of chondrogenic cells is one of the major challenges in cartilage tissue engineering17. The transforming growth factor-beta 1 (TGF-β1) is a critical regulator of chondrogenic differentiation of MSCs

18.

TGF-β1 can be added as a cell culture supplement to

facilitate MSCs chondrogenesis and it is well acknowledged as a key to maintaining in vitro chondrogenic differentiation19. Previous studies also found that preconditioning of MSCs with TGF-β1 showed encouraging results in the surgically-induced OA model or osteochondral defect model

17, 20.

Although applying SDF-1α and TGF-β1 can

promote cell migration and chondrogenic differentiation of MSCs, these growth factors tend to rapidly diffuse to the tissue around the damaged site after injection. It is important to develop a scaffold to carry chemokines for the maintenance of the constant therapeutic levels of chemokines at the site of action.



Page 6 of 35

Silk fibroin (SF) is a bombyx mori cocoons-derived natural protein, and it is a widelyused biomaterial because of its appropriate porosity, remarkable biocompatibility, distinguish mechanical properties, hypoimmunity and abundant availability 21-26. SF is a biodegradable protein-based biomaterial and it has been used to carry MSCs or chondrocytes for cartilage repair 27-29. Proteins, such as chemokines or growth factors, can also be loaded into SF which allows continuous and slow release of protein with the degradation of SF 30. SF is regarded as an excellent vehicle for the delivery of cells, chemokine and growth factor in tissue engineering. Porosity and three-dimensional (3D) spatial conformation of the scaffold are the influential factors in the regeneration of hyaline cartilage since they influence the proliferation, differentiation, and extracellular matrix (ECM) production of the cells seeded in scaffold 31-33. 3D gelatin scaffold is the ideal structure for cells transplantation due to its low acidic-medium-release ability and high porosity

34-37.

MSCs seeded in

gelatin sponge showed excellent in vitro or in vivo cell distribution, proliferation, differentiation and migration conferring this scaffold as a potential construct for cartilage defect treatment 35, 38. In this study, we have developed an SDF-1α/TGF-β1-loaded silk fibroin coated gelatin sponge scaffold by using lyophilization method. We have characterized the in vitro physicochemical properties and cell biocompatibility of this scaffold and evaluated it’s in vivo therapeutic potential in cartilage regeneration using a rat osteochondral defect model.


Page 7 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2. Materials and methods 2.1 Preparation of scaffolds that contain both SDF-1α and TGF-β1 2.1.1 Preparation of SF solutions Silk fibroin (SF) was chemically extracted from silkworm cocoons using Lithium bromide (LiBr) method. Cocoons were bought from Sericultural Agri-Food Research Institute, Guangdong Academy of Agricultural Sciences (GAAS) (China). 0.5 wt.% sodium carbonate (Aladin) solution was used to degum the cut cocoon pieces in a ratio of 40:1 and boiled at 95°C for 30 minutes for three times. After washing with distilled water, 12 wt.% silk fibers solution was prepared by dissolving the obtained silk fibers in 9.3 M lithium bromide (Aladin) at 50 °C for four hours. The dissolved SF was dialyzed in distilled water with a dialysis membrane (7 kDa) and the concentration of the SF solution was estimated after three days. After filtering the SF solution with a filter membrane (0.22 μm), the concentration of the stock was adjusted to 2 wt.% using PBS and stored at 4°C (Fig. 1a).

2.1.2 Preparation of SF coated porous gelatin composites SF coated porous gelatin scaffolds were constructed as previously reported 24. Briefly, sterile porous gelatin scaffolds were trimmed into a cylindrical shape (Φ2*2 and Φ6*2 mm) by using a sterile steel tube (Fig. 2a) and were completely immersed in SF solution accordingly (Table. 1). Growth factors containing SF solution was prepared by adding either TGF-β1 and/or SDF-1α into 2 wt.% SF/PBS. The specific doses of these growth



factors were referenced as previously reported39-41. The composite scaffolds were deepfrozen at -80°C overnight and vacuum-dried for 24 hours followed by ultraviolet light sterilization for two hours (Fig. 1b).

2.2 Physicochemical characterization of scaffolds 2.2.1 Scanning electron microscopy The morphology of the SF coated gelatin scaffolds was characterized by a digital camera and scanning electron microscope (SEM; Nova SEM 430, FEI, USA) at 10 kV accelerating voltage, following a previously published method 42. The scaffolds were coated with platinum by sputter for SEM.

2.2.2 Fourier transform infrared spectroscopy The structure of the composite scaffolds was characterized using a Fourier transform infrared spectroscopy (FTIR; EQUINOX 55, Thermo Fisher, GER). The structures were recorded with wave number in 4000-500 cm-1.

2.2.3 Swelling ratio The swelling ratio of the composite scaffolds was estimated based on the change of weight across time. The dry weight of scaffolds (M0) was estimated at the beginning the assay and scaffolds were immersed in PBS and incubated at 37°C. Wet weight of the scaffolds was measured after 1 hour, 12 hours and 24 hours of incubation. Swelling ratio was calculated using the equation below (n=3):


Page 8 of 35

Page 9 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Swelling ratio=((M1-M0)/M0).

2.2.4 Scaffolds Degradation and protein release behaviors Degradation of the composite scaffolds and release behaviors of SDF-1α and TGF-β1 of these scaffolds were tested. The cylindrical GSTS (Φ6*2 mm) and the non SF-coated scaffolds (GTS) were incubated in 2 mL of PBS in a centrifuge tube at 37°C throughout the assay. Dry scaffolds weights (W0) were measured at the beginning of the assay and the wet scaffolds weights (W1) were measured at day 1, 3, 7, 14 and 28. Degradation of the composite scaffolds was examined according to the equation below: The degradation ratio=(100*(W0-W1)/W0). PBS was changed at day 1, 3, 7 and 14 and the PBS collected at these time points have been taken to ELISA assays (Meibiao, China) to estimate the concentration of SDF-1α and TGF-β1. The cumulative release ratio of scaffolds was calculated and displayed with the time course (n=3).

2.3 Cell biocompatibility and migration 2.3.1 Cell culture Rat bone marrow mesenchymal stem cells (rBMSCs) were isolated from 3-week-old male rat using the published protocol38. Dulbecco's modified eagle's medium (DMEM) (Gibico) added with 10 vol.% fetal bovine serum (FBS) (Gibco) and 1 vol % penicillinstreptomycin (Gibco) was used in cells culture. BMSCs were trypsinized with 0.25 wt.% trypsin/EDTA solution for passaging when it reaches 80–90% confluence. rBMSCs



were expanded only up to four to six passages with medium changed every two days.

2.3.2 Cell migration To assess the migration of rBMSCs in GSTS, cells were seeded in a 24-well plate (1×105 cells/ well) and cultured at 37°C temperature, 95% relative humidity and 5% CO2. Conditioned media from different scaffolds groups were obtained by immersing cylindrical scaffolds in DMEM with 1% FBS for 24 hours at 37°C. When rBMSCs is confluent, a straight scratch line was slowly made at the center of the well with a 200 μL tip. After washing with PBS to remove detached cells, the cells were incubated with the above-mentioned scaffolds-conditioned media. Pictures of the scratch lines were taken after culturing in scaffolds-conditioned media before and after 24 hours. The width of the scratch line was quantitatively measured using Image J software (n=3).

2.3.3 Cell viability The viability of rBMSCs in the scaffolds was evaluated by using live/dead assay and SEM. Fluorescence staining of cells has been done by using Calcein-AM (Dojindo, USA) for live cells and propidium iodide (Byeotime, China) for dead cells. Cylindrical scaffolds (Φ6*2 mm) were pre-soaked in the culture medium in a 96-well plate for 30 minutes and rBMSCs were seeded into scaffolds (1 × 105 cells/scaffold). After 24 hours, scaffolds were washed with PBS and stained with Calcein-AM and propidium iodide for 30 minutes at room temperature. Scaffolds were washed again with PBS and fluorescent images were acquired using the inverted fluorescence microscope (Leica,


Page 10 of 35

Page 11 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


USA). The cell morphology and cell adhesion to the scaffold were examined under SEM (SEM; Nova SEM 430, FEI, USA).

2.3.4 Cells Proliferation Cell counting kit-8 reagent (CCK-8; Dojindo, Japan) was used to measure the proliferation of the stem cells seeded on the scaffolds (1 × 105 cells/scaffold). After incubation for 1 and 5 days, the cells-seeded scaffolds were relocated to a new 96-well plate (1 scaffold in 1 well) with 10 vol% CCK-8 solution added. After incubated with CCK-8 at 37 °C for an hour, the absorbance value of the scaffolds was detected at 450 nm by using a multimode microplate reader (Thermo Scientific, USA). The experiments were independently repeated in triplicate.

2.4 In vitro chondrogenic differentiation study 2.4.1 Expression of chondrogenesis related genes by RT-qPCR To assess the chondrogenic potential of rBMSCs, cells were seeded on the scaffolds (Φ6*2 mm) (3 × 105 cells/scaffold) in DMEM with 1% FBS. After 12 hours, scaffolds were transferred to a new 96-well tissue culture plate in DMEM with 1% FBS and cultured for 14 days. The mRNA levels of sex determining region Y-box 9 (Sox9), aggrecan, collagen type II (Col 2), collagen type I (Col 1), alkaline phosphatase (ALP) and Runt-related transcription factor 2 (Runx2) were estimated by quantitative reverse transcription polymerase chain reaction (RT-qPCR). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene. The primer sequences for



these genes (Sangon Biotech) are listed in Table 2. Briefly, RNA of cells was isolated by trizol reagent (Invitrogen, USA) and the RNA concentration was measured by using NanoDrop™ 2000c Spectrophotometers (Thermo Scientific, USA). RNA was transcribed to cDNA by using High-Capacity cDNA Reverse Transcription Kit (Invitrogen, USA) and RT-qPCR was performed by using FastStart Universal SYBR Green Master (Roche, USA) with a lightcycler apparatus (CFX96™, Thermo Scientific, USA). The relative mRNA levels were calculated using 2-∆∆Ct method. The experiments were independently repeated in triplicate.

2.4.2 Expression of chondrogenesis related protein Western blot analysis was used to detect the levels of Sox9 protein expressed by rBMSCs on the scaffolds. After 14 days of incubation, total protein from rBMSCs was extracted by using lysis buffer (Beyotime, China) and the concentration of total protein was measured using BCA protein assay kit (Thermo Scientific, USA). Equal amounts of protein from each group were separated on a piece of SDS-PAGE gel and transferred to a PVDF membrane. The proteins in this membrane were blocked by 5 wt.% dried nonfat milk for an hour. The PVDF membrane was respectively incubated with rabbit polyclonal anti-Sox9 antibody (Abcam, USA) and rabbit polyclonal anti-β-actin antibody (Abcam, USA) for three hours at room temperature. The membranes were further stained with HRP-conjugated secondary antibodies (Abcam, USA) for an hour. Band images for targeted proteins were captured by a chemiluminescence analyzer


Page 12 of 35

Page 13 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Tanon-5200, USA) by developing the membranes with chemiluminescent reagents (ECL-plus, Beyotime).

2.5 In vivo cartilage repair study 2.5.1 Animal Surgery All experiments were approved by the Animal Research Ethics Committee at the Jinan University. This study used a panel of male Sprague-Dawley rats ( age 16 weeks old, weigh 450-500 g). The method of establishing the osteochondral defect model is described in our previous study17. In brief, rats were first anesthetized with 1% pentobarbital sodium (40 mg/kg), shaved and disinfected. The medial parapatellar approach was applied to expose the knee joints. The patella was laterally dislocated, and the knee was placed in full flexion17. A cylindrical osteochondral defect (1.6 mm diameter and depth) was created with a dental drill on both limbs at the center of the groove 17. All debris was removed from the defect with curettage and irrigation. A series of scaffold was implanted into the defect in a press-fit way, (1) gelatin sponge coated with silk fibroin (GS), (2) GS loaded with SDF-1(GSS), (3) GS loaded with TGF-β1 (GST) and (4) GS loaded with TGF-β1 and SDF-1(GSTS); n=8, each group. Rats received no treatment is regarded as a negative control (NC). At 12 weeks post-surgery, rats were euthanized by pentobarbital overdose and the femurs of the rats were sampled.

2.5.2 Histology and immunohistochemistry Femurs samples were photographed, examined and evaluated using the International



Page 14 of 35

Cartilage Repair Society (ICRS) macroscopic and histological assessment scoring system43-44. After gross examination of the samples, they were fixed in 4% paraformaldehyde

for

48

hours

and

decalcified

in

10%

buffered

ethylenediaminetetraacetic acid (EDTA; pH 7.4, Sigma) for 21 days before embedding into paraffin, as previously reported44. A series of 5μm thick sections of each whole defected site were cut and stained with Toluidine Blue. The histology of the defect sections was evaluated and scored by three blinded observers with the ICRS histological scoring system 45-46. Immunostaining was performed as previously reported47. The sections were first incubated with rabbit primary antibodies to collagen II (Abcam, 1:30, ab34712) and MMP13 (Abcam, 1:30, ab39012) overnight at 4°C and then with HRP-conjugated goat anti-rabbit secondary antibody (Cell signal technology, 1:100, 7047). Then the sections were counterstained with horseradish peroxidase–streptavidin detection system (Dako, USA) and hematoxylin. Sections were examined and selected areas were photographed with the light microscope (Leica DMRB, Leica Cambridge Ltd., U.K.). Images of the Col II- or MMP13-positive area was analyzed by using ImageJ (NIH), as reported in the published study 39.

2.6 Statistical analysis All data were analyzed by one-way analysis of variance (ANOVA) and reported as means ± standard deviations. Only differences at p < 0.001, p < 0.01 and p < 0.05 were regarded as statistically significant.


Page 15 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. Results 3.1 Characterization of composite scaffolds The SDF-1α/TGF-β1-loaded SF-coated gelatin scaffolds were constructed according to the protocol (Fig. 1). G0 and GS scaffolds exhibited similar porous structures (Fig. 2a & b) which were spherical and interconnected to form a trabecular-like network. SF coating helped the scaffold more compactly constructed as GS consists of smaller pores (50–200 µm diameter) than G0 (100–300 µm diameter). FTIR spectra in Fig. 2c. showed that all scaffolds (G0, GS, GST, GSS, and GSTS) have peaks at 1620~1640 cm−1, 1520~1540 cm−1 and 1230~1240 cm-1, which correspond to amide I, amide II and amide III region. These regions were the main groups in proteinbased substances which define the composition of the scaffolds. The ELISA assay demonstrated that the SF coating enhances the slow-release of TGFβ1 and SDF-1α from scaffolds. GSTS released significantly less TGF-β1 and SDF-1α than GTS over 14 days (Fig. 2d & e). At the last day, the cumulative release of TGFβ1 and SDF-1α was almost 100% which suggests that most of the GTS degraded at that time (Fig. 2d & e). The SF coating also affects the degradation and swelling of the scaffolds in aqueous solution. As shown in Table.3, the degradation of GS is significantly slower than that of G0 in PBS. The swelling ratio of the scaffolds suggested their water absorption ability and SF-coated scaffolds (GS, GST, GSS, and GSTS) showed lower swelling ratio than non-SF-coated scaffolds (G0) at all-time points (Fig. 2f). The SF coating lowers the water binding affinity of the scaffolds which consequently lower the water



absorption ratio of the scaffolds. With fewer water molecules absorbed, the scaffolds are capable to maintain a relatively stable level of chemokines (SDF-1α /TGF-β1).

3.2 In vitro characterization of scaffolds seeded with rBMSCs The rBMSCs cultured with media conditioned in GST, GSS, and GSTS group showed significantly faster migration than those cultured with conditioned media collected from GS and G0 group, while no significant difference was observed among GST, GSS, and GSTS groups (Fig. 3a & b). The fluorescent images from live/dead assay showed that there were more rBMSCs on GSS and GSTS than GS, indicating that SDF-1α promotes the cell adhesion and retention on scaffolds (Fig. 4). The fluorescent images also evidenced that rBMSCs on all scaffolds were highly viable and well adhered to the surface and the pores of scaffolds (Fig. 4). SEM images showed that the cells were all fusiform shaped and attached on the surface of scaffold on the 1 day after cells seeding, indicating the cells were satisfactorily viable (Fig. 4). The cell proliferation assay has shown that both SDF-1α and TGF-β1 are important to mediate the proliferation of rBMSCs on the scaffolds. After one day of culture, rBMSCs seeded on SDF-1α-loaded scaffolds (GSS & GSTS) scaffolds seemed to proliferate faster than those seeded on scaffolds without SDF-1α loaded (GS & GST), though no statistically significant difference was found (Fig. 5a). After five days, the number of cells on GST, GSS and GSTR scaffolds seems to be higher than that on GS, while only the number of cells on GST and GS have the significant difference (Fig. 5a). TGF-β1-loaded scaffold could promote the chondrogenic differentiation of rBMSCs.


Page 16 of 35

Page 17 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The rBMSCs seeded on GST and GSTS scaffolds showed considerably higher expression of chondrogenic genes (Sox9, Col 2 and aggrecan) (Fig. 5b) and lower expression of the ossification marker gene (Col 1, ALP and Runx 2) (Fig. 5c) than that of GS scaffolds. Particularly, the mRNA levels of Sox9, Col 2 and aggrecan of rBMSCs on GSTS were 2.2-fold, 2.9-fold and 4.2-fold higher than those on GS (Fig. 5b) while Col 1, ALP and Runx 2 level of GSTS was only approximately 20%, 25% and 35% of GS (Fig. 5c). The expression of the Sox9 protein in rBMSCs on GST, GSS and GSTS were also higher than those on GS (Fig. 5d).

3.3 In vivo histological analysis of cartilage defect repair The therapeutic value of the scaffolds has been evaluated using the osteochondral defect rat model. At the 12th week after scaffolds implantation, the gross view of the knee defects in GSTS group was firm and smooth, while only soft and friable tissues were found in the defects in the other groups (NC, GS, GST, GSS) (Fig. 6a). Based on ICRS scoring system, the macroscopic score for GSTS is superior to other groups, suggesting that the defects implanted with GSTS were substantially better repaired than other groups (NC, GS, GST, and GSS) (p < 0.05) (Fig. 6c). In the histological assessment, the surface of the defected joint in GSTS group was smooth and the defect was repaired with a mixture of cartilage-like tissue, shown by Toluidine Blue (Fig. 6b). However, only a thin layer of fibrous tissue was observed on the surface of the defected joint in the NC, GS, GST and GSS group (Fig. 6b). The ICRS histological score for GSTS group was markedly higher than the other group (NC,



GS, GST, and GSS) (p < 0.05) (Fig. 6d). The immunohistochemical and quantitative analysis have been carried out to show the expression of hyaline cartilage marker Col 2 and cartilage degradation marker MMP13 at the defected joints (Fig. 7). GSTS group produced more type II collagen-enriched hyaline-like cartilage on the surface of the defected joint while other groups (NC, GS, GST, and GSS) tended to generate fibrocartilage (Fig. 7a & b, p < 0.05). The defected joints in GSTS group also had lower expression of cartilage degeneration marker MMP13 than other scaffold groups (Fig. 7a, c, p < 0.05). These results suggested that the porous TGF-β1/SDF-1α-loaded silk fibroin-gelatin scaffold could effectively improve the cartilage repair in vivo.

4. Discussion In the field of biomedical engineering, so much effort has been put into developing a 3D biocompatible scaffold for cartilage repair which not only allows the attachment and proliferation of cartilage progenitor cells, but also maintains a chondrogenic microenvironment to facilitate cartilage repair. In this study, we designed and developed a novel silk fibroinporous gelatin scaffold with two growth factors loaded, SDF-1α and TGF-β1, which are the key growth factors for stem cell homing and chondrogenic induction. We further investigated if this scaffold could facilitate in vitro cell homing and chondrogenic differentiation and promote in vivo cartilage regeneration in rat osteochondral defect model. Silk fibroin scaffold is an ideal carrier of MSCs for cartilage repair because it is a


Page 18 of 35

Page 19 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biodegradable protein-based biomaterial

27-28

and it has appropriate porosity, robust

mechanical properties and excellent biocompatibility for therapeutic purposes

22-23.

Gelatin sponge is a biomaterial that widely applied in clinics and it has a well-defined physicochemical profile, from biocompatibility, biodegradability to toxicity

48-49.

Although gelatin has a fast swelling and degradation profile, it is a partial derivative of collagen and has relatively lower antigenicity than collagen 32. Cells seeded on gelatin shows better cell adhesion and chondrogenesis than those on collagen, indicating that gelatin can be a good candidate for cartilage scaffolds

32.

In this project, we have

developed a new scaffold which is pure fibroin-coated gelatin sponge and it is loaded with SDF-1α and TGF-β1 to facilitate the cartilage repair. Several studies have shown that the pore size and the 3D spatial conformation of the scaffolds are important to cell proliferation, differentiation, and ECM production during hyaline cartilage regeneration9, 31-32. Scaffolds with a pore size between 100-500 µm are optimal for cell proliferation and differentiation, and production of ECM

32, 50-51.

The scaffold we developed is composed of a porous network containing sponge-like, spherical interconnected pores in approximately 50~200 µm diameter (Fig.2b), which is within the range of optimized pore size. We proved that the biocompatibility of the scaffold was not compromised during the production and MSCs remained spindleshaped morphology after seeding into the scaffolds (Fig. 4). In addition, the result of CCK8 assay (Fig. 5a), live/dead assay and SEM (Fig. 4) showed that neither the scaffold nor the growth factors (SDF-1α/TGF-β1) affect the cell survival. Rapid and uncontrolled drug release from a transplanted scaffold at the lesion site is



Page 20 of 35

one of the main problems in biomedical engineering and drug delivery. SF is considered as a good carrier for chemokines or growth factors for sustained release 24, 30. We have loaded SDF-1α and TGF-β1 into the gelatin scaffold with or without silk fibroin coating and we found that this coating can significantly slow down the release of either SDF1α or TGF-β1 from the scaffold (Fig. 2d & e). Since ELISA assay was terminated at day 14 because the cumulative release of TGF-β1 and SDF-1α by GST reached almost 100%, only part of release profiles of GSTS was studied and this is worth to be completed in the future study for full characterization of the release behavior of GSTS. When compared with non-silk fibroin-coated gelatin scaffold, silk fibroin-coated gelatin scaffold has a lower degradation rate (Table. 3) and swelling ratio (Fig. 2f) which stabilize the level of SDF-1α and TGF-β1. Silk fibroin-gelatin scaffold has sustained release capability because silk fibroin is a natural structure which can be used as a protein carrier for continuous protein delivery 24, 30. Loading SDF-1α and TGF-β1 in the scaffold helps stimulate stem cell homing and migration and maintain chondrogenic microenvironment. SDF-1 induces stem cells homing in bone marrow, and enriches retention, engraftment, and migration of stem cells to the blood circulation52.The collagen scaffold with SDF-1α added have facilitated cell homing which promotes cartilage repair

39, 44.

TGF-β1 is a crucial

regulator in the chondrogenic differentiation and studies have shown that loading TGFβ1 in the materials such as hyaluronic acid/Poly Hydrogels 53 or magnetic nanocapsule 40

can benefit the chondrogenic differentiation of MSCs. However, no studies have

studied integrating SDF-1α and TGF-β1 in silk fibroin-coated gelatin scaffolds. In this


Page 21 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


study, we developed an SDF-1α/ TGF-β1 silk-loaded fibroin-gelatin scaffold which not only can recruit stem cells to the injured area by SDF-1α, but also facilitating these MSCs chondrogenic differentiation by TGF-β1 resulting in better cartilage regeneration. We confirmed that SDF-1α-loaded scaffold can facilitate cell migration and this is in line with previous studies (Fig. 3). We also found that MSCs seeded in the TGF-β1loaded scaffold (GSTS and GST) showed better chondrogenic differentiation ability, compared to the control scaffold without TGF-β1 (GS and GSS) (Fig. 5b - d). RTqPCR results showed that cells seeded in GSTS and GST have upregulated cartilage matrix genes expression and downregulated ossification marker genes expression (Fig. 5b & c). The western blot results further support the findings by showing the protein the level of Sox9 in cells seeded in GSTS and GST was significantly upregulated (Fig. 5d). Although our studies indicated that MSCs seeded on GSTS have high chondrogenic differentiation potential and less ossification, they can be further characterized by testing more makers of chondrogenic differentiation in different stages by western blot. The in vivo animal study demonstrated that scaffold loaded with SDF-1α and TGF-β1 (GSTS) have the most significant cartilage regeneration and among all scaffold groups (Fig. 6-7). This outstanding result suggested that only scaffolds loaded with both SDF1α and TGF-β1 could arise enough stem cell homing capability for the cells to migrate to the transplanted area and maintain chondrogenic differentiation potential for the in vivo cartilage repair. Our results indicated that TGF-β1 and SDF-1α from scaffold may



have a synergistic effect in promoting cartilage damage repair. Although we have shown that GSTS can significantly enhance in vitro chondrogenic differentiation and in vivo cartilage repair, the mechanical test has not been included to this study because the defected area in cartilage model is too small to be assessed. In the future study, we may use a larger animal model such rabbit to investigate the mechanical performance of the regenerated cartilage. We may also extend the ELISA assay and include a panel of chondrogenic markers in the western blot test hoping to further clarify the underlying mechanism of this scaffold in cartilage defect repair. In summary, our study proved that SDF-1α/TGF-β1-loaded silk fibroin-coated gelatin scaffold (GSTS) could induce stem cell migration ((Fig. 3), in vitro chondrogenic differentiation (Fig. 5b-d) and in vivo cartilage regeneration (Fig. 6-7). This study brings novelty by multi-disciplinarily integrating the use of growth factors (SDF-1α and TGF-β1) into the tissue engineering (silk fibroin coated gelatin sponge scaffold) which hope to shed light on the future development of therapeutic for cartilage injury repair.

Conclusion We have successfully designed and fabricated an SDF-1α/TGF-β1-loaded silk fibroin coated gelatin sponge scaffold (GSTS) for the sustained release of SDF-1α and TGFβ1 for cartilage repair. It was demonstrated that this scaffold facilitated MSCs homing, migration, chondrogenic differentiation. SDF-1α and TGF-β1 had a synergistic effect


Page 22 of 35

Page 23 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on enhancing in vitro chondrogenic potential and in vivo cartilage regeneration. Our results demonstrated GSTS is sustained release scaffold of SDF-1α and TGF-β1 which has a promising therapeutic potential for cartilage repair.

Abbreviations OA: osteoarthritis; GAAS: Guangdong Academy of Agricultural Sciences; SDF-1α: Stromal-derived factor-1α; TGF-β: transforming growth factor-beta 1; MSCs: mesenchymal stem cells; NC: negative control; SF: Silk fibroin; G0: gelatin sponge only; GS: silk fibroin gelatin scaffold; GST: silk fibroin gelatin scaffold loading TGFβ1 only; GSS: silk fibroin gelatin scaffold loading SDF-1α only; GSTS: silk fibroin gelatin scaffold loading SDF-1α + TGF-β.

Conflicts of interest No conflicts of interest were stated.

Acknowledgements The work was partially supported by grants from National Natural Science Foundation of China (81741045, 81602360, 81672224 and 81871809); China Postdoctoral Science Foundation (2017M612850) ； Natural Science Foundation of Guangdong Province (2017A030313665, 2017A030313556); Medical Scientific Research Foundation of Guangdong Province (A2018544); Science and Technology of Guangzhou (201707010493); The Fundamental Research Funds for the Central Universities



(21617463); Research Foundation for Advanced Talents of Jinan University and Project of Clinical Medical Research in the First Affiliated Hospital of Jinan University.

References 1. Huey, D. J.; Hu, J. C.; Athanasiou, K. A., Unlike bone, cartilage regeneration remains elusive. Science 2012, 338 (6109), 917-21. 2. Grassel, S.; Lorenz, J., Tissue-engineering strategies to repair chondral and osteochondral tissue in osteoarthritis: use of mesenchymal stem cells. Current rheumatology reports 2014, 16 (10), 452. 3. Lawrence, R. C.; Felson, D. T.; Helmick, C. G.; Arnold, L. M.; Choi, H.; Deyo, R. A.; Gabriel, S.; Hirsch, R.; Hochberg, M. C.; Hunder, G. G.; Jordan, J. M.; Katz, J. N.; Kremers, H. M.; Wolfe, F.; National Arthritis Data, W., Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part II. Arthritis and rheumatism 2008, 58 (1), 26-35. 4. Woolf, A. D.; Pfleger, B., Burden of major musculoskeletal conditions. Bulletin of the World Health Organization 2003, 81 (9), 646-56. 5. Steadman, J. R.; Briggs, K. K.; Rodrigo, J. J.; Kocher, M. S.; Gill, T. J.; Rodkey, W. G., Outcomes of microfracture for traumatic chondral defects of the knee: average 11-year follow-up. Arthroscopy : the journal of arthroscopic & related surgery : official publication of the Arthroscopy Association of North America and the International Arthroscopy Association 2003, 19 (5), 477-84. 6. Chuckpaiwong, B.; Berkson, E. M.; Theodore, G. H., Microfracture for osteochondral lesions of the ankle: outcome analysis and outcome predictors of 105 cases. Arthroscopy : the journal of arthroscopic & related surgery : official publication of the Arthroscopy Association of North America and the International Arthroscopy Association 2008, 24 (1), 106-12. 7. Hangody, L.; Fules, P., Autologous osteochondral mosaicplasty for the treatment of fullthickness defects of weight-bearing joints: ten years of experimental and clinical experience. The Journal of bone and joint surgery. American volume 2003, 85-A Suppl 2, 25-32. 8. Simon, T. M.; Jackson, D. W., Articular Cartilage: Injury Pathways and Treatment Options. Sports medicine and arthroscopy review 2018, 26 (1), 31-39. 9. Shi, W.; Sun, M.; Hu, X.; Ren, B.; Cheng, J.; Li, C.; Duan, X.; Fu, X.; Zhang, J.; Chen, H.; Ao, Y., Structurally and Functionally Optimized Silk-Fibroin-Gelatin Scaffold Using 3D Printing to Repair Cartilage Injury In Vitro and In Vivo. Advanced materials 2017, 29 (29). 10. Barry, F.; Murphy, M., Mesenchymal stem cells in joint disease and repair. Nature reviews. Rheumatology 2013, 9 (10), 584-94. 11. Huang, H.; Zhang, X.; Hu, X.; Shao, Z.; Zhu, J.; Dai, L.; Man, Z.; Yuan, L.; Chen, H.; Zhou, C.; Ao, Y., A functional biphasic biomaterial homing mesenchymal stem cells for in vivo cartilage regeneration. Biomaterials 2014, 35 (36), 9608-19. 12. Reichert, J. C.; Cipitria, A.; Epari, D. R.; Saifzadeh, S.; Krishnakanth, P.; Berner, A.; Woodruff, M. A.; Schell, H.; Mehta, M.; Schuetz, M. A.; Duda, G. N.; Hutmacher, D. W., A tissue engineering solution for segmental defect regeneration in load-bearing long bones. Science translational medicine 2012, 4 (141), 141ra93.


Page 24 of 35

Page 25 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13. Bajetto, A.; Barbieri, F.; Dorcaratto, A.; Barbero, S.; Daga, A.; Porcile, C.; Ravetti, J. L.; Zona, G.; Spaziante, R.; Corte, G.; Schettini, G.; Florio, T., Expression of CXC chemokine receptors 1-5 and their ligands in human glioma tissues: role of CXCR4 and SDF1 in glioma cell proliferation and migration. Neurochemistry international 2006, 49 (5), 423-32. 14. Theiss, H. D.; Vallaster, M.; Rischpler, C.; Krieg, L.; Zaruba, M. M.; Brunner, S.; Vanchev, Y.; Fischer, R.; Grobner, M.; Huber, B.; Wollenweber, T.; Assmann, G.; Mueller-Hoecker, J.; Hacker, M.; Franz, W. M., Dual stem cell therapy after myocardial infarction acts specifically by enhanced homing via the SDF-1/CXCR4 axis. Stem cell research 2011, 7 (3), 244-55. 15. Goncalves, R. M.; Antunes, J. C.; Barbosa, M. A., Mesenchymal stem cell recruitment by stromal derived factor-1-delivery systems based on chitosan/poly(gamma-glutamic acid) polyelectrolyte complexes. European cells & materials 2012, 23, 249-60; discussion 260-1. 16. Chen, Y.; Lin, S.; Sun, Y.; Guo, J.; Lu, Y.; Suen, C. W.; Zhang, J.; Zha, Z.; Ho, K. W.; Pan, X.; Li, G., Attenuation of subchondral bone abnormal changes in osteoarthritis by inhibition of SDF1 signaling. Osteoarthritis and cartilage 2017, 25 (6), 986-994. 17. Lin, S.; Lee, W. Y. W.; Feng, Q.; Xu, L.; Wang, B.; Man, G. C. W.; Chen, Y.; Jiang, X.; Bian, L.; Cui, L.; Wei, B.; Li, G., Synergistic effects on mesenchymal stem cell-based cartilage regeneration by chondrogenic preconditioning and mechanical stimulation. Stem cell research & therapy 2017, 8 (1), 221. 18. Ganan, Y.; Macias, D.; Duterque-Coquillaud, M.; Ros, M. A.; Hurle, J. M., Role of TGF beta s and BMPs as signals controlling the position of the digits and the areas of interdigital cell death in the developing chick limb autopod. Development 1996, 122 (8), 2349-57. 19. Johnstone, B.; Hering, T. M.; Caplan, A. I.; Goldberg, V. M.; Yoo, J. U., In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Experimental cell research 1998, 238 (1), 265-72. 20. Lin, S.; Lee, W. Y. W.; Xu, L.; Wang, Y.; Chen, Y.; Ho, K. K. W.; Qin, L.; Jiang, X.; Cui, L.; Li, G., Stepwise preconditioning enhances mesenchymal stem cell-based cartilage regeneration through epigenetic modification. Osteoarthritis and cartilage 2017, 25 (9), 1541-1550. 21. Jao, D.; Mou, X.; Hu, X., Tissue Regeneration: A Silk Road. Journal of functional biomaterials 2016, 7 (3). 22. Guziewicz, N.; Best, A.; Perez-Ramirez, B.; Kaplan, D. L., Lyophilized silk fibroin hydrogels for the sustained local delivery of therapeutic monoclonal antibodies. Biomaterials 2011, 32 (10), 2642-50. 23. Wang, Y.; Rudym, D. D.; Walsh, A.; Abrahamsen, L.; Kim, H. J.; Kim, H. S.; Kirker-Head, C.; Kaplan, D. L., In vivo degradation of three-dimensional silk fibroin scaffolds. Biomaterials 2008, 29 (24-25), 3415-28. 24. Li, G.; Che, M. T.; Zhang, K.; Qin, L. N.; Zhang, Y. T.; Chen, R. Q.; Rong, L. M.; Liu, S.; Ding, Y.; Shen, H. Y.; Long, S. M.; Wu, J. L.; Ling, E. A.; Zeng, Y. S., Graft of the NT-3 persistent delivery gelatin sponge scaffold promotes axon regeneration, attenuates inflammation, and induces cell migration in rat and canine with spinal cord injury. Biomaterials 2016, 83, 233-48. 25. Ribeiro, V.; Pina, S.; Costa, J. B.; Cengiz, I. F.; Garcia-Fernandez, L.; Fernandez-Gutierrez, M. D. M.; Paiva, O. C.; Oliveira, A. L.; San Roman, J.; Oliveira, J. M.; Reis, R. L., Enzymatically crosslinked silk fibroin-based hierarchical scaffolds for osteochondral regeneration. ACS applied materials & interfaces 2019. 26. Song, J. E.; Tripathy, N.; Lee, D. H.; Park, J. H.; Khang, G., Quercetin Inlaid Silk



Fibroin/Hydroxyapatite Scaffold Promotes Enhanced Osteogenesis. ACS applied materials & interfaces 2018, 10 (39), 32955-32964. 27. Wang, Y.; Kim, U. J.; Blasioli, D. J.; Kim, H. J.; Kaplan, D. L., In vitro cartilage tissue engineering with 3D porous aqueous-derived silk scaffolds and mesenchymal stem cells. Biomaterials 2005, 26 (34), 7082-94. 28. Luo, Z.; Jiang, L.; Xu, Y.; Li, H.; Xu, W.; Wu, S.; Wang, Y.; Tang, Z.; Lv, Y.; Yang, L., Mechano growth factor (MGF) and transforming growth factor (TGF)-beta3 functionalized silk scaffolds enhance articular hyaline cartilage regeneration in rabbit model. Biomaterials 2015, 52, 463-75. 29. Singh, Y. P.; Bhardwaj, N.; Mandal, B. B., Potential of Agarose/Silk Fibroin Blended Hydrogel for in Vitro Cartilage Tissue Engineering. ACS applied materials & interfaces 2016, 8 (33), 2123649. 30. Wenk, E.; Merkle, H. P.; Meinel, L., Silk fibroin as a vehicle for drug delivery applications. Journal of controlled release : official journal of the Controlled Release Society 2011, 150 (2), 12841. 31. Sun, K.; Li, R.; Jiang, W.; Sun, Y.; Li, H., Comparison of three-dimensional printing and vacuum freeze-dried techniques for fabricating composite scaffolds. Biochemical and biophysical research communications 2016, 477 (4), 1085-1091. 32. Lien, S. M.; Ko, L. Y.; Huang, T. J., Effect of pore size on ECM secretion and cell growth in gelatin scaffold for articular cartilage tissue engineering. Acta biomaterialia 2009, 5 (2), 670-9. 33. Xia, H.; Zhao, D.; Zhu, H.; Hua, Y.; Xiao, K.; Xu, Y.; Liu, Y.; Chen, W.; Liu, Y.; Zhang, W.; Liu, W.; Tang, S.; Cao, Y.; Wang, X.; Chen, H. H.; Zhou, G., Lyophilized Scaffolds Fabricated from 3D-Printed Photocurable Natural Hydrogel for Cartilage Regeneration. ACS applied materials & interfaces 2018, 10 (37), 31704-31715. 34. Du, B. L.; Zeng, C. G.; Zhang, W.; Quan, D. P.; Ling, E. A.; Zeng, Y. S., A comparative study of gelatin sponge scaffolds and PLGA scaffolds transplanted to completely transected spinal cord of rat. Journal of biomedical materials research. Part A 2014, 102 (6), 1715-25. 35. Zeng, X.; Qiu, X. C.; Ma, Y. H.; Duan, J. J.; Chen, Y. F.; Gu, H. Y.; Wang, J. M.; Ling, E. A.; Wu, J. L.; Wu, W.; Zeng, Y. S., Integration of donor mesenchymal stem cell-derived neuron-like cells into host neural network after rat spinal cord transection. Biomaterials 2015, 53, 184-201. 36. Lai, B. Q.; Wang, J. M.; Duan, J. J.; Chen, Y. F.; Gu, H. Y.; Ling, E. A.; Wu, J. L.; Zeng, Y. S., The integration of NSC-derived and host neural networks after rat spinal cord transection. Biomaterials 2013, 34 (12), 2888-901. 37. Cui, Y.; Zhu, T.; Li, A.; Liu, B.; Cui, Z.; Qiao, Y.; Tian, Y.; Qiu, D., Porous Particle-Reinforced Bioactive Gelatin Scaffold for Large Segmental Bone Defect Repairing. ACS applied materials & interfaces 2018, 10 (8), 6956-6964. 38. Chen, Y. F.; Zeng, X.; Zhang, K.; Lai, B. Q.; Ling, E. A.; Zeng, Y. S., Neurotrophin-3 stimulates migration of mesenchymal stem cells overexpressing TrkC. Current medicinal chemistry 2013, 20 (24), 3022-33. 39. Chen, P.; Tao, J.; Zhu, S.; Cai, Y.; Mao, Q.; Yu, D.; Dai, J.; Ouyang, H., Radially oriented collagen scaffold with SDF-1 promotes osteochondral repair by facilitating cell homing. Biomaterials 2015, 39, 114-23. 40. Chiang, C. S.; Chen, J. Y.; Chiang, M. Y.; Hou, K. T.; Li, W. M.; Chang, S. J.; Chen, S. Y., Using the interplay of magnetic guidance and controlled TGF-beta release from protein-based


Page 26 of 35

Page 27 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanocapsules to stimulate chondrogenesis. International journal of nanomedicine 2018, 13, 31773188. 41. Holland, T. A.; Tabata, Y.; Mikos, A. G., Dual growth factor delivery from degradable oligo(poly(ethylene glycol) fumarate) hydrogel scaffolds for cartilage tissue engineering. Journal of controlled release : official journal of the Controlled Release Society 2005, 101 (1-3), 111-25. 42. Arabi, N.; Zamanian, A., Effect of cooling rate and gelatin concentration on the microstructural and mechanical properties of ice template gelatin scaffolds. Biotechnology and applied biochemistry 2013, 60 (6), 573-9. 43. van den Borne, M. P.; Raijmakers, N. J.; Vanlauwe, J.; Victor, J.; de Jong, S. N.; Bellemans, J.; Saris, D. B.; International Cartilage Repair, S., International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in Autologous Chondrocyte Implantation (ACI) and microfracture. Osteoarthritis and cartilage 2007, 15 (12), 1397-402. 44. Zhang, W.; Chen, J.; Tao, J.; Jiang, Y.; Hu, C.; Huang, L.; Ji, J.; Ouyang, H. W., The use of type 1 collagen scaffold containing stromal cell-derived factor-1 to create a matrix environment conducive to partial-thickness cartilage defects repair. Biomaterials 2013, 34 (3), 713-23. 45. Orth, P.; Zurakowski, D.; Wincheringer, D.; Madry, H., Reliability, reproducibility, and validation of five major histological scoring systems for experimental articular cartilage repair in the rabbit model. Tissue engineering. Part C, Methods 2012, 18 (5), 329-39. 46. Wakitani, S.; Goto, T.; Pineda, S. J.; Young, R. G.; Mansour, J. M.; Caplan, A. I.; Goldberg, V. M., Mesenchymal cell-based repair of large, full-thickness defects of articular cartilage. The Journal of bone and joint surgery. American volume 1994, 76 (4), 579-92. 47. Chen, Y.; Sun, Y.; Pan, X.; Ho, K.; Li, G., Joint distraction attenuates osteoarthritis by reducing secondary inflammation, cartilage degeneration and subchondral bone aberrant change. Osteoarthritis and cartilage 2015, 23 (10), 1728-35. 48. Rohanizadeh, R.; Swain, M. V.; Mason, R. S., Gelatin sponges (Gelfoam) as a scaffold for osteoblasts. Journal of materials science. Materials in medicine 2008, 19 (3), 1173-82. 49. Miyayama, S.; Yamakado, K.; Anai, H.; Abo, D.; Minami, T.; Takaki, H.; Kodama, T.; Yamanaka, T.; Nishiofuku, H.; Morimoto, K.; Soyama, T.; Hasegawa, Y.; Nakamura, K.; Yamanishi, T.; Sato, M.; Nakajima, Y., Guidelines on the use of gelatin sponge particles in embolotherapy. Japanese journal of radiology 2014, 32 (4), 242-50. 50. Matsiko, A.; Gleeson, J. P.; O'Brien, F. J., Scaffold mean pore size influences mesenchymal stem cell chondrogenic differentiation and matrix deposition. Tissue engineering. Part A 2015, 21 (3-4), 486-97. 51. Agrawal, A.; Rahbar, N.; Calvert, P. D., Strong fiber-reinforced hydrogel. Acta biomaterialia 2013, 9 (2), 5313-8. 52. Vagima, Y.; Lapid, K.; Kollet, O.; Goichberg, P.; Alon, R.; Lapidot, T., Pathways implicated in stem cell migration: the SDF-1/CXCR4 axis. Methods in molecular biology 2011, 750, 277-89. 53. Bock, T.; Schill, V.; Krahnke, M.; Steinert, A. F.; Tessmar, J.; Blunk, T.; Groll, J., TGF-beta1Modified Hyaluronic Acid/Poly(glycidol) Hydrogels for Chondrogenic Differentiation of Human Mesenchymal Stromal Cells. Macromolecular bioscience 2018, 18 (7), e1700390.



Figures and Figure legends

Fig.1 Schematic graphs of (a) preparation of SF solution and (b) construction of composite scaffolds (gelatin sponge, SF, SDF-1 and TGF-β1); SDF-1 and TGF-β1 would be released from the scaffold in vitro and in vivo.

Fig.2 (a)Macroscopic appearance (left: G0, right: GS) and (b) microscopic morphology of G0 and GS ; (c) FTIR spectrum of the scaffolds ; ELISA results on release behaviors of (d) TGF-β1 and (e)


Page 28 of 35

Page 29 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SDF-1 from GSTS and GTS; (f) swelling ratio of the scaffolds .

Fig.3 (a) Migration assay. rBMSCs were cultured with the conditioned media with scaffolds immersed for 24 hours at 37°C (b) the migration area calculated with Image J. *p < 0.05 and **p < 0.01.



Fig.4 Live/dead cell viability (green: live cells, red: dead cells) and scanning electron microscope (SEM) imaging of rBMSCs seeded on scaffolds on day after seeding. White arrow indicates the cells attached to the scaffold.


Page 30 of 35

Page 31 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig.5 Proliferation (a) of rBMSCs on scaffolds; (b) RT-qPCR result of the expression of chondrogenic differentiation genes (Col 2, Aggrecan and Sox 9) and osteogenic differentiation genes (Col 1, ALP and Runx 2) (c) western blot result of Sox 9 protein of rBMSCs on scaffolds after 14 days of culture. *p < 0.05 and **p < 0.01.



Fig. 6 Histological assessment of repaired cartilage in vivo. (a) Representative gross view of distal femoral samples. Red triangle indicates the defect sites. (b) Toluidine blue staining of repaired cartilage (scale bar: upper= 500 µm; under = 200 µm.) (c) Macroscopic evaluation according to ICRS macroscopic scoring system and (d) histological evaluation according to the ICRS histological scoring system. (n = 8, *p < 0.05, **p < 0.01 and ***p < 0.001, compared to NC.).


Page 32 of 35

Page 33 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 7 Immunohistochemical staining for (a) hyaline cartilage marker Col 2 and cartilage degradation marker MMP13. (The red arrows indicate the margins of the intact cartilage and repaired cartilage, red “D” indicated the defect area) Scale bars. 200 µm. Quantitative data of the (b) Col 2 and (c) MMP13 in the defected area. ( n = 8, *p < 0.05, **p < 0.01, compared to NC)



Page 34 of 35

Tables Table 1. Compositions and abbreviations of scaffolds in this study Sample

SF (wt.%)

SDF-1α (ng/mL)

TGF-β1 (ng/mL)

GS

2

0

0

GST

2

0

300

GSS

2

150

0

GSTS

2

150

300

Table 2. Primer sequences used for RT-qPCR Target gene GAPDH

Col 2

Aggregan

Sox9

Col 1

ALP

Runx2

Gene bank

Sequences F: 5’-3’

AGCCCAGAACATCATCCCTG

R: 3’-5’

CACCACCTTCTTGATGTCATC

F: 5’-3’

AGAGCGTTGCTCGGAACTGT

R: 3’-5’

TCCTGGACCGAAACTGGTAAA

F: 5’-3’

TTGTGACTCTGCGGGTCATC

R: 3’-5’

GTCCCTAGGAGGGCCTTCAG

F: 5’-3’

AACCCAAAGGACCCAAATAC

R: 3’-5’

CCGGACTGTGAGGTTAGGAT

F: 5’-3’

GGATCGACCCTAACCAAGGC

R: 3’-5’

GATCGGAACCTTCGCTTCCA

F: 5’-3’

TCCGTGGGTCGGATTCCT

R: 3’-5’

GCCGGCCCAAGAGAGAA

F: 5’-3’

CCGATGGGACCGTGGTT

R: 3’-5’

CAGCAGAGGCATTTCGTAGCT


Page 35 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 3. In vitro degradation rate (wt. %) of G0 and GS scaffolds Soaking time (d)

1

3

7

14

28

G0

23.22±5.18 33.90±5.09

46.92±4.95*

65.34±2.30*

96.70±1.12*

GS

19.20±1.71 28.69±6.18

33.07±4.83

39.36±3.90

44.55±5.81

* means significant difference p

TGF-Î²1-Loaded Silk Fibroin-Porous

Recommend Documents