The Promising Anodic Electrochemiluminescence ... - ACS Publications

Subscriber access provided by MT ROYAL COLLEGE

Article

The Promising Anodic Electrochemiluminescence of Non-Toxic and Core/ shell CuInS/ZnS NCs in Aqueous Medium and Its Bio-sensing Potential 2

Xiaoyan Long, Fang Zhang, Yupeng He, Shifeng Hou, Bin Zhang, and Guizheng Zou Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b00006 • Publication Date (Web): 08 Feb 2018 Downloaded from http://pubs.acs.org on February 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

The Promising Anodic Electrochemiluminescence of Nontoxic and Core/shell CuInS2/ZnS NCs in Aqueous Medium and Its Bio-sensing Potential Xiaoyan Long,†,§ Fang Zhang,†,§ Yupeng He,† Shifeng Hou,†, ‡ Bin Zhang,† Guizheng Zou†,* † ‡

School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100, China National Engineering and Technology Research Center for Colloidal Materials, Shandong University, Jinan 250100, China

* Corresponding author. Email: [email protected], Tel: +86-531-88361326

ABSTRACT: Copper indium sulfide (CIS) nanocrystals (NCs) are a promising solution to the toxic issue of Cd- and Pb-based NCs. Herein, electrochemiluminescence (ECL) of CIS NCs in aqueous medium is investigated for the first time with L-glutathione and sodium citrate stabilized water-soluble CIS/ZnS NCs as model. The CIS/ZnS NCs can be oxidized to hole-injected-states via electrochemically injecting holes into valence band at 0.55 V and 0.94 V (vs Ag/AgCl), respectively. The hole-injected-state around 0.94 V can bring out efficient oxidative-reduction ECL in a similar color to Ru(bpy)32+ with presence of tri-n-propylamine (TPrA), and enable CIS/ZnS NCs promising ECL tags with L-glutathione as linker for labeling. The ECL of CIS/ZnS NCs/TPrA can be utilized to determine vascular endothelial growth factor (VEGF) from 0.10 to 1000 pM with the limit of detection at 0.050 pM (S/N=3). Although hole-injected-state around 0.55 V is generated ahead of oxidation of TPrA and fails to bring out co-reactant ECL, annihilation ECL proves that both of the two hole-injected-states generated at 0.55 V and 0.94 V can be involved in electrochemical redox induced radiative charge transfer by directly stepping CIS/ZnS NCs from electron injecting potential to hole injecting potential. CIS/ZnS NCs are promising non-toxic electrochemiluminophores with lowered ECL triggering potential around 0.55 V for less electrochemical interference upon the developing of co-reactant.

Electrochemiluminescence (ECL) is the radiative charge transfer from the excited states, which are formed at electrode surface via electrochemical redox.1 ECL is superior to fluorescence in terms of sensitivity and signal-to-noise ratio due to absence of background from unselective photoexcitation.2 Since the initial researches on ECL in 1964,3,4 the design and screen of electrochemiluminophores always play an important role on the evolution of ECL.5-8 One breakthrough is the discovery of molecule electrochemiluminophore Ru(bpy)32+ in 1972, which eventually bring out a series of Ru(bpy)32+/tri-npropylamine (TPrA) reagent kits for various biomedical and diagnostic ECL assays.9 The other important breakthrough is the discovery of nanocrystals (NCs) based non-molecule electrochemiluminophores in 2002, in which Ding and Bard firstly demonstrated ECL from Si NCs in non-aqueous medium.10 With the followed progress on ECL of CdSe NCs in aqueous medium achieved by Zou and Ju in 2004,11 ECL of III-V and II-VI NCs is extensively conducted for developing electrochemiluminophores with desired performance.12-15 Unfortunately, III-V and II-VI NCs contain either class A element (Cd, Pb, and Hg) or class B element (Se and As), their potential toxicity is a subject of serious concerns.16 For example, Cd-based NCs would degrade and release cytotoxic Cd2+ ions in a biological environment.17,18 Tremendous efforts are being carried out on ECL of toxic-element-free NCs and nanoclusters, such as gold nanocluster,19-21 silver nanocluster,22,23 carbon quantum dots,24,25 C3N4 NCs,26 MoS2 NCs,27 etc.

Copper indium sulfide (CIS) NCs are a promising solution to the toxic issue of II-VI and II-VI NCs,16 however, investigations on radiative charge transfer of CIS NCs are normally conducted for solar energy conversion28 and photoluminescence (PL) based sensing.29-32 Recently, our group achieved the electrochemical redox induced radiative charge transfer of core-only CIS NCs in non-aqueous medium by ECL strategy.33 Core-only CIS NCs can be injected with holes into valence band (VB) via electrochemical oxidation and be injected electrons into conduction band (CB) via electrochemical reduction, the charge transfer and/or recombination between electrochemically injected CB electrons and VB holes is capable of ECL. Unfortunately, the core-only CIS NCs is insoluble in aqueous medium and cannot be developed as ECL tag for bioassay. Herein, ECL of CIS NCs in aqueous medium and its biosensing are achieved for the first time with L-glutathione and sodium citrate stabilized core/shell CIS/ZnS NCs as model, because the dual stabilizers L-glutathione and sodium citrate can enable CIS/ZnS NCs water-soluble with desired PL quantum yields (PLQY),34 especially the L-glutathione can label biomolecule and enable CIS/ZnS NCs promising tags for bioassay. The CIS/ZnS NCs can be oxidized to hole-injectedstates via electrochemically injecting holes into VB at 0.55 V and 0.94 V, respectively. The hole-injected-state around 0.94 V is capable of co-reactant ECL in a similar color to Ru(bpy)32+ with presence of TPrA, and used to selectively determine vascular endothelial growth factor (VEGF) with high sensitivity, as shown in Scheme 1. The hole-injected-state

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

around 0.55 V is anticipated for ECL at low triggering potential for less electrochemical interference upon the developing of co-reactants. This work would lead to a promising advance for CIS NCs based ECL and its sensing application. Scheme 1. Schematic Representation VEGF165 with CIS/ZnS as ECL Tags.

for

Determining

EXPERIMENTAL SECTION Chemicals and Materials. All chemicals and reagents are of analytical grade or better, all aqueous solutions are prepared with doubly distilled water (DDW) (see Supporting Information). HPLC-purified DNA capture probe S1, VEGF165 aptamer, and VEGF165 are purchased from Shanghai Sangon Biological Engineering Technology and Services Co. Ltd. (Shanghai, China). VEGF165 aptamer is modified with a carboxyl group at 5-terminus and its sequence is as follows: 5′COOH-GGCCCGTCCGTATGGTGGGTGTGCTGGCC-3′.35 DNA capture probe S1 is modified at 5-terminus with an amino group and its sequence is as follows: 5′-NH2TTTTTTTATGGGTTGGGCGGGATGGGCCAGCACACCC ACC-3′.35 All the samples are prepared with 0.10 M phosphate buffer (PB, pH 7.4) and stored at 4 °C before use. CIS/ZnS NCs are prepared by “one-pot” synthesis strategy with L-glutathione and sodium citrate as stabilizing agents.34 Briefly, 20 mL doubly distilled water, 20 µmol glutathione, 10 µmol CuCl2·2H2O, 40 µmol InCl3·4H2O, 160 µmol sodium citrate, 62 µmol Na2S·9H2O are loaded into a three-neck flask with continuous magnetic stirring. The reaction mixture is kept at 95˚C for 40 min to obtain CuInS2 core. Then, 2 mL ZnS-shell stock solution (pH 6.0) containing 0.8 mmol Zn(OAc)2·2H2O, 1.2 mmol glutathione and 0.8 mmol thiourea is introduced into the CuInS2 core solution, the final mixture is kept at 95˚C for another 30 min to form CIS/ZnS NCs. The obtained CIS/ZnS NCs are precipitated with isopropyl alcohol, and purified via centrifugation, then re-dispersed in DDW. Apparatus. The ultraviolet-visible (UV-vis) absorption spectrum is recorded on a TU-1901 UV-vis spectrophotometer (Beijing Purkinje General Instrument Co., Ltd, China). PL spectrum is recorded with an F-320 spectrofluorimeter (Tianjin Gangdong Sci&Tech Development Co., Ltd, China). The fluorescence lifetime and PLQY are recorded on fluorescence spectrometer (Model FLS920, Edinburgh Instruments, U.K.). X-ray photoelectron spectroscopy (XPS) is taken from ESCALAB 250 XPS using monochromatic Al Kα radiation (Thermo Fisher Scientific Co., U.S.A.). X-ray diffraction (XRD) pattern is recorded on an X-ray diffractometer with Cu Kα radiation (λ = 1.5418 Å) (Bruker AXS D8 Advance, Germany). High-resolution transmission electron microscopy (HRTEM) image is taken on a TecnaiG2 F30 transmission electron microscope with an acceleration voltage of 300 kV

(Thermo Fisher Scientific Co., U.S.A). Cyclic voltammetry (CV) and ECL-potential profiles are recorded on MPI-A ECL analyzer (Xi’an Remex Analytical Instrument Co., Ltd., China) with a three-electrode system, including a glassy carbon working electrode (GCE, diameter of 5 mm), a Pt counter electrode, and a Ag/AgCl (saturated KCl) reference electrode. Differential pulse voltammetry (DPV) is recorded on CHI 822 electrochemical analyzer (Shanghai, China). ECL spectrum is obtained on a homemade ECL spectrum analyzer consisting of an Acton SP2300i monochromator equipped with a liquid N2 cooled PyLoN 400BR-eXcelon digital CCD detector (Princeton Instruments, U.S.A) and a VersaSTAT 3 electrochemical analyzer (Princeton Applied Research, U.S.A.).36-38 Preparation of CIS/ZnS NCs Based ECL Biosensor. As demonstrated in Scheme 1, the signal-off ECL biosensor is fabricated by immobilizing CIS/ZnS NCs onto GCE via labeling them to the 5-terminus carboxyl group of VEGF165 aptamer in the hybrids of VEGF165 aptamer and capture probe S1, then removing CIS/ZnS NCs from GCE via the competitive reaction between VEGF165 and VEGF165 aptamer for ECL assay. GCE is polished with 0.3 µm alumina slurry, washed with copious amounts of DDW, and then electrodeposited with a layer of p-aminobenzoic acid (ABA), via scanning potential between 0.40 and 1.20 V (vs Ag/AgCl) in 10 mM pH 7.4 PB containing 1.0 mM ABA and 10 mM KCl at 10 mV/s for two cycles.39 The carboxyl groups of GCE-ABA are activated in 0.10 M pH 6.0 PB containing 100 mg/mL 1-ethyl-3(3-dimethylaminopropyl) carbodiimide hydrochloride (EDAC) and 100 mg/mL N-hydroxysuccinimide (NHS) for 30 min, and then covalently bind 10 µL DNA capture probe S1 (5 µM) at room temperature for 20 h. The obtained GCE-ABA-S1 is incubated with a drop of 10 µL VEGF165 aptamer (5 µM) to form GCE-ABA-S1-aptamer. CIS/ZnS NCs are labeled onto GCE-ABA-S1-aptamer via the terminus carboxyl groups of aptamers with NHS and EDAC assisted labeling protocol. GCE-ABA-S1-aptamer-CIS/ZnS are incubated with a drop of 10 µL VEGF165 of various concentration for 2 h to form GCEABA-S1-aptamer-CIS/ZnS-VEGF165, and then used for ECL bioassay in 0.10 M pH 7.4 PB containing 10 mM TPrA.

Figure 1. (A) UV-vis absorption (a, black line) and PL spectra (b, red line) of CIS/ZnS NCs. (B) PL decay curve of CIS/ZnS NCs. (C) XRD pattern of CIS/ZnS NCs. (D) HRTEM image of CIS/ZnS NCs.

RESULTS AND DISCUSSION


Page 2 of 7

Page 3 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry Optical, Structural and Morphological Characterization of CIS/ZnS NCs. Absorption of CIS/ZnS NCs displays a broad shoulder with a tail in the long-wavelength direction (curve a of Figure 1A),29 and no obvious peak related to the first excitonic absorption is observed. PL spectrum of CIS/ZnS NCs displays a broad peak with maximum emission wavelength around 577 nm and the full-width at halfmaximum around 120 nm (curve b of Figure 1A), simialr to the previous reported CIS/ZnS NCs with L-glutathione and sodium citrate as stabilizers.34 PLQY of CIS/ZnS NCs is determined to be ~26 %. PL decay of CIS/ZnS NCs is well-fitted with a triexponential model with PL life-time of 1029.6 ns (Figure 1B and Table S1). The broad PL, large Stokes shift, and long PL life-time indicate that as-prepared CIS/ZnS NCs are typical I−III−VI NCs (Figure 1A & 1B).40 It is well known that photoexciting CIS NCs can promote electron from VB into CB to produce both CB-like electrons (e–CB) and VB holes,41 and then give off PL via charge transfer and recombination.42 PL dynamics contains information about both radiative and nonradiative relaxation processes, long time scale decay components in PL of CIS NCs are often related to intrinsic defects and surface defects.43 The triexponential PL decay indicates that some traps (or defects) at the surface of CIS/ZnS NCs are invovled in the radiative charge transfer.44 XPS patterns proved that CIS/ZnS NCs are composed of Cu, In, S, and Zn elements (Figure S1). XRD pattern shows three major peaks at 2θ values of 28.6, 46.8, and 55.3° (Figure 1C), respectively, which are intermediate between CuInS2 and ZnS phases, and consist with previous reported CIS/ZnS NCs.34 HRTEM pattern demonstrated that the CIS/ZnS NCs are nearly monodispersed an average size of ~ 3 nm (Figure 1D).34

Figure 2. (A) CV and (B) potential-ECL profiles of 15 mg/mL CIS/ZnS NCs in 0.10 M pH 7.4 PB containing 0.10 M KCl and (a, black line) 0.0, (b, red line) 10 mM TPrA at 100 mV/s. Insets: anodic (A) CV and (B) DPV profiles of bare GCE in 0.10 M pH 7.4 PB containing 0.10 M KCl and (a, black line) 0.0, (b, red line) 15 mg/mL CIS/ZnS NCs.

Electrochemistry and TPrA Co-reactant ECL of CIS/ZnS NCs in Aqueous Medium. To avoid the possible interference of dissolved oxygen, ECL of monodispersed CIS/ZnS NCs in aqueous medium is carried out at anode with TPrA as co-reactant (Figure 2), as TPrA can be electrochemically oxidized to produce strong reducing radical species TPrA• (E° = ∼-1.7 V vs. SCE),9 and then bring out oxidativereduction ECL of NCs.10 No obvious electrochemical oxidizing process is detected with CIS/ZnS NCs in PB containing 15

mg/mL CIS/ZnS NCs and 0.10 M KCl (Figure 2A, curve a), indicating the electrochemical redox induced hole-injectingprocesses of CIS/ZnS NCs are weak. Introducing TPrA into the aforementioned PB not only brings out a strong oxidative process with onset around 0.66 V and maximum intensity around 0.90 V (Figure 2A, curve b), but also enable efficient ECL with onset around 0.66 V and maximum emission around 0.94 V (Figure 2B, curve b). The anodic ECL is initiated with onset of oxidizing TPrA, which is similar to the previously reported TPrA co-reactant ECL.45 It is clear that TPrA can be electrochemically oxidized to tremendous TPrA• radicals for injecting electrons into CB of CIS/ZnS NCs at large scale. The electrochemical oxidation induced hole-injecting-process is the rate-determining step for ECL of CIS/ZnS NCs/TPrA. DPV is adopted to verify the exact hole-injecting-processes of CIS/ZnS NCs. DPV profile of CIS/ZnS NCs displays two hole-injecting-processes around 0.55 V and 0.94 V (inset B of Figure 2), indicating CIS/ZnS NCs can be electrochemically oxidized to two hole-charged-states at 0.55 V (Ox1) and 0.94 V (Ox2), respectively. Compared with the four hole-injectingprocesses of core-only CIS NCs occurred at anode,33 the limited two hole-injecting-processes of CIS/ZnS NCs indicate that forming a wide band-gap ZnS shell around CIS core would make CIS core less sensitive to external environment. Scheme 2. Schematic Illustration for Co-reactant ECL of CIS/ZnS NCs.

As displayed in Scheme 2, both the hole-injecting-processes of CIS/ZnS NCs and the electrochemical oxidation of coreactant play important roles on the generation of oxidativereduction ECL. The oxidative potential of TPrA (0.66 V) is obviously higher than the hole-injecting-potential for Ox1 (0.55 V), hole-injected-state Ox1 fails to take part in TPrA coreactant ECL, no ECL is detected around +0.55 V (Figure 2B, curve b). TPrA co-reactant ECL of CIS/ZnS NCs is mainly achieved via the charge transfer between the hole-injectedstate Ox2 and TPrA• radicals with maximum emission around +0.94 V. The mechanism for ECL of CIS/ZnS NCs/TPrA is proposed in eqs 1-5: CIS/ZnS NCs→ n R(CIS/ZnS)+• + n e (+0.94 V)

(1)

TPrA → TPrA•+ + e

(2)

•+

•

TPrA → TPrA + H

(+0.66 V) +

n TPrA• + CIS/ZnS NCs → n R(CIS/ZnS)-•


(3) (4)


R(CIS/ZnS)+• + R(CIS/ZnS)-• → R(CIS/ZnS)* R(CIS/ZnS)* → CIS/ZnS + hv

(5) (~642 nm)

(6)

Figure 3. (a) PL spectrum of CIS/ZnS NCs; ECL spectra of (b) 15 mg/mL CIS/ZnS NCs and (c) GCE-ABA-S1-aptamerCIS/ZnS-VEGF165 in 0.10 M pH 7.4 PB containing 0.10 M KCl and 10 mM TPrA. GCE-ABA-S1-aptamer-CIS/ZnS-VEGF165 was formed with 10 µL sample containing 10 pM VEGF165. ECL spectra were resulted from the total photons generated by scanning the potential from 0 to 1.6 V for one cycle at 100 mV/s.

Figure 4. ECL transients of bare GCE in N2-saturated 0.10 M pH 7.4 PB containing 0.10 M KCl and (a, black line) 0.0, (b, red line) 15 mg/mL CIS/ZnS NCs by stepping potential between (A) -1.50 and 0.94 V, (B) -1.50 and 0.55 V at 1 Hz. Blue dotted lines indicate the applied potential steps.

ECL spectrum of CIS/ZnS NCs/TPrA displays a broad peak with maximum wavelength at 642 nm (curve b of Figure 3), indicating ECL of CIS/ZnS NCs/TPrA is red-shifted for ~65 nm to CIS/ZnS NCs’ PL (curve a of Figure 3), and is in a similar color to the ECL of Ru(bpy)32+/TPrA.9,46 Previous research has demonstrated that maximum emission for ECL and PL of core-only CIS NCs is located ~775 nm and ~670 nm, respectitively.33 The red-shift of ECL to PL for core-only CIS NCs is more than 100 nm. The less red-shifted ECL to PL

for CIS/ZnS NCs than that for core-only CIS NCs not only proves that CIS/ZnS NCs are partially passivated by forming ZnS shell around CIS core,47 but also indicates surface defects still play an important role on the electrochemical redox induced radiative charge transfer of CIS/ZnS NCs. These results are consistent with aforementioned PL decay of CIS/ZnS NCs (Figure 1B), which confirms the existence of surface defects on CIS/ZnS NCs. Importantly, ECL spectrum of surface-confined CIS/ZnS NCs on GCE-ABA-S1-aptamerCIS/ZnS-VEGF165 is almost the same to monodispersed CIS/ZnS NCs with maximum emission around 642 nm (curve b & c of Figure 3), indicating the L-glutathione and sodium citrate stabilized CIS/ZnS NCs can preserve their surface states very well via complicated labeling and bio-reaction processes. CIS/ZnS NCs are promising ECL tags for bioassay. Annihilation ECL of CIS/ZnS NCs in Aqueous Medium. As co-reactant ECL of CIS/ZnS NCs/TPrA mainly derives from charge transfer between Ox2 and TPrA• (curve b of Figure 2B), annihilation ECL is conducted to verify the ECL activity of Ox1 (Figure 4). The annihilation ECL is conducted in N2-saturated PBS to aviod the possible interference of dissovled oxygen. CIS/ZnS NCs demonstrate obvious annihilation ECL by stepping potential from -1.50 V to +0.55 V and from -1.50 V to +0.94 V, respectively. The annihilation ECL by stepping potential from -1.50 V to +0.94 V indicates that CIS/ZnS NCs can be electrochemically reduced to electroninjected-state via injecting electrons into CB at -1.50 V, and then bring out radiative charge transfer between the electroninjected-state and the hole-injected-state Ox2. The annihilation ECL by stepping potential from -1.50 V to +0.55 V confirms that radiative charge transfer in CIS/ZnS NCs can also be achieved between the electron-injected-state and Ox1 via electrochemical redox. Importantly, stepping potential from positive hole-injecting-potentials (both +0.55 V and +0.94 V) to negative electron-injecting-potential (-1.50 V) can also bring out efficient annihilation ECL for CIS/ZnS NCs in the followed potential stepping procedures, which further confirms the ECL activity of hole-injected-states Ox1. Possibility for Improved Co-reactant ECL Performance of CIS/ZnS NCs. Figure S2 displays the oxidative-reduction ECL of CIS/ZnS NCs with presence of several common coreactants in the same concentration to TPrA in Figure 2. 2(dibutylamino)ethanol (DBAE) brings out efficient ECL around +0.8 V for CIS/ZnS NCs with the maximum intensity much lower than that for ECL of CIS/ZnS NCs/TPrA, while both potassium oxalate monohydrate (K2C2O4·H2O) and H2O2 merely bring out weak ECL for CIS/ZnS NCs around +0.90 V. The potentials for maximum emission of DBAE, K2C2O4 and H2O2 co-reactant ECL are different from that of CIS/ZnS NCs/TPrA system, which is due to the different oxidative potentials for these co-reactants to take part in the oxidativereduction ECL. Similar to the TPrA co-reactant ECL (Figure 2B, curve b), no obvious oxidative-reduction ECL related to Ox1 is observed around 0.55 V with DBAE, K2C2O4, and H2O2, because these co-reactants are oxidized at potentials higher than that required for forming hole-injected-state Ox1. Anyhow, the hole-injecting-potential of Ox1 is obvious lower than the oxidizing potential of Ru(bpy)32+ and some reported NCs with promising low ECL triggering potential.48-51 Coreactant ECL from Ox1 can be anticipated to efficiently avoid undesired electrochemical interferences upon the evolution of desired co-reactants (Scheme 2).


Page 4 of 7

Page 5 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry Bioassay Performance of ECL from CIS/ZnS NCs/TPrA. It is well known that TPrA is a traditional coreactant and has been extensively used in various ECL bioassay procedures.9 TPrA co-reactant ECL from Ox2 of CIS/ZnS NCs is eventually adopted for determining VEGF165 in this case, because TPrA can bring out obviously stronger oxidative-reduction ECL for the Ox2 than other co-reactants, such as DBAE, K2C2O4, and H2O2 (Figure S2). The fabricating procedure of ECL sensor for VEGF165, i.e. GCE-ABA-S1-aptamerCIS/ZnS, has been examined by Fe(CN)63−/Fe(CN)64− redox couple in 0.10 M pH 7.4 PB (Figure S3), which confirms that CIS/ZnS NCs could be immobilized onto GCE surface via designed hybridization processes, and then removed from GCE surface by VEGF165 for signal-off ECL sensing.

CONCLUSIONS ECL of non-toxic CIS/ZnS NCs in aqueous medium is investigated for the first time with L-glutathione and sodium citrate stabilized and water-soluble CIS/ZnS NCs as model. The CIS/ZnS NCs are efficient electrochemiluminophores for ECL labeling and bioassay with capping agent L-glutathione as linker. Importantly, CIS/ZnS NCs could be electrochemically oxidized to hole-injected-states at 0.55 V for Ox1 and 0.94 V for Ox2, respectively, both of the two hole-chargedstates can bring out annihilation ECL along with the generation of electron-injected state via electrochemically reducing the CIS/ZnS NCs. Hole-charged-state Ox2 is capable of efficient oxidative-reduction ECL in a similar color to the Ru(bpy)32+ with presence of TPrA, and can be utilized for ECL bioassay with high sensitivity. The hole-injected-state Ox1 is promising for novel ECL sensing strategy at low ECL triggering potential to avoid undesired electrochemical interference upon the developing of co-reactants.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: Chemicals and materials, PL life time parameters, XPS spectra, oxidative-reduction ECL of CIS/ZnS NCs with different co-reactants, electrochemical characterization for the fabricating procedures of CIS/ZnS NCs based ECL sensor, sensing performance of other strategies for determining VEGF165, specificity of the proposed sensor.

AUTHOR INFORMATION Corresponding Author Figure 5. Potential-ECL profiles of GCE-ABA-S1-aptamerCIS/ZnS-VEGF165 formed with a drop of 10 µL sample containing (a) 0.10, (b) 0.50, (c) 1.0, (d) 5.0, (e) 10.0, (f) 50.0, (g) 100.0, (h) 500.0 and (i) 1000.0 pM VEGF165, respectively. The ECL measurements were conducted in 0.10 M pH 7.4 PB containing 0.10 M KCl and 10 mM TPrA at 100 mV/s. Inset: the calibration curve for determining VEGF165.

Figure 5 displays the potential-resolved ECL profiles of GCE-ABA-S1-aptamer-CIS/ZnS-VEGF165, which is formed with 10 µL VEGF165 samples of various concentrations. The onset potential for ECL of GCE-ABA-S1-aptamer-CIS/ZnSVEGF165 is around +0.66 V, indicating co-reactant ECL is mainly related to Ox2. The maximum intensity for ECL of GCE-ABA-S1-aptamer-CIS/ZnS-VEGF165 decreased obviously along with the increasing concentration of VEGF165. ECL decrement (∆I = I0 – I, where I0 is the maximum ECL intensity of GCE-ABA-S1-aptamer-CIS/ZnS, I is the maximum ECL intensity of GCE-ABA-S1-aptamer-CIS/ZnS-VEGF165) increased linearly with the logarithmical increased concentration of VEGF165 in a range from 0.10 to 1000 pM (inset of Figure 5, R = 0.99) with a limit of detection of 0.050 pM (S/N=3). GCE-ABA-S1-aptamer-CIS/ZnS-VEGF165 not only displayed comparable or even better sensitivity than previous reported VEGF165 determining strategies (Tables S2),35,52-54 but also demonstrated acceptable selectivity to common interfering substances, such as BSA, ascorbic acid, and thrombin (Figure S4). The desired selectivity of the proposed ECL sensor for VEGF165 is derived from the bio-selective reaction between DNA capture probe S1, VEGF165 aptamer, and VEGF165.35

*E-mail: [email protected].

Author Contributions §

The first two authors contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This project was supported by the National Natural Science Foundation of China (Grant Nos. 21427808, 21375077, and 21475076), and the Fundamental Research Foundation of Shandong University (Grant No. 2015JC037)

REFERENCES (1) Richter, M. M. Chem. Rev. 2004, 104, 3003-3036. (2) Liu, Z.; Qi, W.; Xu, G. Chem. Soc. Rev. 2015, 44, 3117-3142. (3) Visco, R. E.; Chandross, E. A. J. Am. Chem. Soc. 1964, 86, 5350-5351. (4) Hercules, D. M. Science 1964, 145, 808-809. (5) Hu, L.; Xu, G. Chem. Soc. Rev. 2010, 39, 3275-3304. (6) Swanick, K. N.; Ladouceur, S.; Zysman-Colman, E.; Ding, Z. Angew. Chem. Int. Ed. 2012, 51, 11079-11082. (7) Nepomnyashchii, A. B.; Bard, A. J. Acc. Chem. Res. 2012, 45, 1844-1853. (8) Carrara, S.; Aliprandi, A.; Hogan, C. F.; De Cola, L. J. Am. Chem. Soc. 2017, 139, 14605-14610. (9) Miao, W. Chem. Rev. 2008, 108, 2506-2553. (10) Ding, Z.; Quinn, B. M.; Haram, S. K.; Pell, L. E.; Korgel, B. A.; Bard, A. J. Science 2002, 296, 1293-1297. (11) Zou, G.; Ju, H. Anal. Chem. 2004, 76, 6871-6876. (12) Sun, J.; Sun, H.; Liang, Z. ChemElectroChem 2017, 4, 16511662.



(13) Bard, A. J.; Ding, Z.; Myung, N. In Semiconductor Nanocrystals and Silicate Nanoparticles, Peng, X.; Mingos, D. M. P., Eds.; Springer Berlin Heidelberg: Berlin, Heidelberg, 2005, pp 1-57. (14) Sun, L.; Bao, L.; Hyun, B. R.; Bartnik, A. C.; Zhong, Y. W.; Reed, J. C.; Pang, D. W.; Abruna, H. D.; Malliaras, G. G.; Wise, F. W. Nano Lett. 2009, 9, 789-793. (15) Wu, P.; Hou, X.; Xu, J. J.; Chen, H. Y. Chem. Rev. 2014, 114, 11027-11059. (16) Xu, G.; Zeng, S.; Zhang, B.; Swihart, M. T.; Yong, K.-T.; Prasad, P. N. Chem. Rev. 2016, 116, 12234-12327. (17) Corazzari, I.; Gilardino, A.; Dalmazzo, S.; Fubini, B.; Lovisolo, D. Toxicol. In Vitro 2013, 27, 752-759. (18) Li, K. G.; Chen, J. T.; Bai, S. S.; Wen, X.; Song, S. Y.; Yu, Q.; Li, J.; Wang, Y. Q. Toxicol. In Vitro 2009, 23, 1007-1013. (19) Hesari, M.; Ding, Z. Acc. Chem. Res. 2017, 50, 218-230. (20) Jiang, H.; Liu, L.; Wang, X. Nanoscale 2017, 9, 9792-9796. (21) Wang, T.; Wang, D.; Padelford, J. W.; Jiang, J.; Wang, G. J. Am. Chem. Soc. 2016, 138, 6380-6383. (22) Jie, G.; Tan, L.; Zhao, Y.; Wang, X. Biosens. Bioelectron. 2017, 94, 243-249. (23) Feng, L.; Wu, L.; Xing, F.; Hu, L.; Ren, J.; Qu, X. Biosens. Bioelectron. 2017, 98, 378-385. (24) Li, N. L.; Jia, L. P.; Ma, R. N.; Jia, W. L.; Lu, Y. Y.; Shi, S. S.; Wang, H. S. Biosens. Bioelectron. 2017, 89, 453-460. (25) Zheng, L.; Chi, Y.; Dong, Y.; Lin, J.; Wang, B. J. Am. Chem. Soc. 2009, 131, 4564-4565. (26) Cheng, C.; Huang, Y.; Wang, J.; Zheng, B.; Yuan, H.; Xiao, D. Anal. Chem. 2013, 85, 2601-2605. (27) Zhao, M.; Chen, A. Y.; Huang, D.; Chai, Y. Q.; Zhuo, Y.; Yuan, R. Anal. Chem. 2017, 89, 8335-8342. (28) Carey, G. H.; Abdelhady, A. L.; Ning, Z.; Thon, S. M.; Bakr, O. M.; Sargent, E. H. Chem. Rev. 2015, 115, 12732-12763. (29) Li, L.; Daou, T. J.; Texier, I.; Kim Chi, T. T.; Liem, N. Q.; Reiss, P. Chem. Mater. 2009, 21, 2422-2429. (30) Cheng, C. Y.; Ou, K. L.; Huang, W. T.; Chen, J. K.; Chang, J. Y.; Yang, C. H. ACS Appl. Mater. Interfaces 2013, 5, 4389-4400. (31) Xiong, W. W.; Yang, G. H.; Wu, X. C.; Zhu, J. J. ACS Appl. Mater. Interfaces 2013, 5, 8210-8216. (32) Lv, G.; Guo, W.; Zhang, W.; Zhang, T.; Li, S.; Chen, S.; Eltahan, A. S.; Wang, D.; Wang, Y.; Zhang, J.; Wang, P. C.; Chang, J.; Liang, X. J. ACS Nano 2016, 10, 9637-9645. (33) Long, X.; Tan, X.; He, Y.; Zou, G. J. Mater. Chem. C 2017, 5, 12393-12399.

(34) Chen, Y.; Li, S.; Huang, L.; Pan, D. Inorg. Chem. 2013, 52, 7819-7821. (35) Zhang, H.; Li, M.; Li, C.; Guo, Z.; Dong, H.; Wu, P.; Cai, C. Biosens. Bioelectron. 2015, 74, 98-103. (36) Zhang, X.; Tan, X.; Zhang, B.; Miao, W.; Zou, G. Anal. Chem. 2016, 88, 6947-6953. (37) Zhou, J.; He, Y.; Zhang, B.; Sun, Q.; Zou, G. Talanta 2017, 165, 117-121. (38) Tan, X.; Zhang, B.; Zou, G. J. Am. Chem. Soc. 2017, 139 8772-8776. (39) Liu, S.; Zhang, X.; Yu, Y.; Zou, G. Anal. Chem. 2014, 86, 2784-2788. (40) Kolny-Olesiak, J.; Weller, H. ACS Appl. Mater. Interfaces 2013, 5, 12221-12237. (41) Berends, A. C.; Rabouw, F. T.; Spoor, F. C. M.; Bladt, E.; Grozema, F. C.; Houtepen, A. J.; Siebbeles, L. D. A.; de Mello Donegá, C. J. Phys. Chem. Lett. 2016, 7, 3503-3509. (42) Pinchetti, V.; Lorenzon, M.; McDaniel, H.; Lorenzi, R.; Meinardi, F.; Klimov, V. I.; Brovelli, S. Nano Lett. 2017, 17, 45084517. (43) Zhong, H.; Zhou, Y.; Ye, M.; He, Y.; Ye, J.; He, C.; Yang, C.; Li, Y. Chem. Mater. 2008, 20, 6434-6443. (44) Zhong, H.; Lo, S. S.; Mirkovic, T.; Li, Y.; Ding, Y.; Li, Y.; Scholes, G. D. ACS Nano 2010, 4, 5253-5262. (45) Miao, W.; Choi, J.-P.; Bard, A. J. J. Am. Chem. Soc. 2002, 124, 14478-14485. (46) Li, M. Y.; Sun, Y. M.; Chen, L.; Li, L.; Zou, G. Z.; Zhang, X. L.; Jin, W. R. Electroanalysis 2010, 22, 333-337. (47) Myung, N.; Bae, Y.; Bard, A. J. Nano Lett. 2003, 3, 10531055. (48) Li, F.; Zu, Y. Anal. Chem. 2004, 76, 1768-1772. (49) Liu, X.; Ju, H. Anal. Chem. 2008, 80, 5377-5382. (50) Liang, G.; Shen, L.; Zou, G.; Zhang, X. Chem. Eur. J. 2011, 17, 10213-10215. (51) Dong, Y.; Wu, H.; Shang, P.; Zeng, X.; Chi, Y. Nanoscale 2015, 7, 16366-16371. (52) Cho, H.; Yeh, E.-C.; Sinha, R.; Laurence, T. A.; Bearinger, J. P.; Lee, L. P. ACS Nano 2012, 6, 7607-7614. (53) Li, W.; Zhang, Q.; Zhou, H.; Chen, J.; Li, Y.; Zhang, C.; Yu, C. Anal. Chem. 2015, 87, 8336-8341. (54) Lin, X. X.; Leung, K. H.; Lin, L.; Lin, L. Y.; Lin, S.; Leung, C. H.; Ma, D. L.; Lin, J. M. Biosens. Bioelectron. 2016, 79, 41-47.


Page 6 of 7

Page 7 of 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

For TOC only


7

The Promising Anodic Electrochemiluminescence ... - ACS Publications

Recommend Documents