The thioesterase domain in glycopeptide antibiotic biosynthesis is

Subscriber access provided by Universitaetsbibliothek | Johann Christian Senckenberg

Article

The thioesterase domain in glycopeptide antibiotic biosynthesis is selective for crosslinked aglycones Madeleine Peschke, Clara Brieke, Michael Heimes, and Max J. Cryle ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.7b00943 • Publication Date (Web): 01 Dec 2017 Downloaded from http://pubs.acs.org on December 2, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

The thioesterase domain in glycopeptide antibiotic biosynthesis is selective for crosslinked aglycones Madeleine Peschke,† Clara Brieke,† Michael Heimes,† and Max J. Cryle* †,#,$. †

Department of Biomolecular Mechanisms, Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg, Germany.

#

The Monash Biomedicine Discovery Institute, Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3800, Australia. EMBL Australia, Monash University, Clayton, Victoria 3800, Australia.

$

ARC Centre of Excellence in Advanced Molecular Imaging, Monash University, Clayton, Victoria 3800, Australia.

Abstract The biosynthesis of the glycopeptide antibiotics (GPAs) – which include teicoplanin and vancomycin – is a complex enzymatic process relying on the interplay of non-ribosomal peptide synthesis and a Cytochrome P450-mediated cyclization cascade. This unique cyclization cascade generates the highly crosslinked state of these non-ribosomal peptides, which is crucial for their antimicrobial activity. Given that these essential oxidative transformations occur whilst the peptide remains bound to the terminal module of the non-ribosomal peptide synthetase (NRPS) machinery, it is important to assess the selectivity of the terminal thioesterase (TE) domain and how this domain contributes to the maintenance of an efficient biosynthetic pathway whilst at the same time ensuring GPA maturation is completed. In this study, we report the in vitro characterization of the thioesterase domain from teicoplanin biosynthesis, the first GPA thioesterase to be characterized. Our results show that the activity of this TE-domain relies on the presence of an unusual extended N-terminal linker region that appears to be unique to the NRPS machineries found in GPA biosynthesis. In addition, we show that the activity of this domain against carrier protein bound substrates is dramatically enhanced for mature GPA aglycones as opposed to linear peptides and partially cyclized intermediates. These results demonstrate how the interplay between NRPS and P450s during late stage GPA biosynthesis is not only maintained but also leads to the efficient production of mature GPA aglycones. Thus, GPA TE-domains represent another impressive example of the ability of TE-domains to act as logic gates during NRPS biosynthesis, ensuring that essential late-stage peptide modifications are completed before catalyzing the release of the mature, bioactive peptide product.

Introduction Non-ribosomal peptide synthesis is an important natural pathway to produce peptides with bioactive properties. The synthesis of non-ribosomal peptides (NRPs) is performed by non-ribosomal peptide synthetases (NRPSs), whose ability to synthesize peptides without the ribosome greatly reduces the ACS Paragon Plus Environment

ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

structural limitations of ribosomal peptides. Contributing to the ability of NRPS to generate a vast array of peptide diversity is the modular architecture of these megaenzyme synthetases: the majority of NRPS machineries rely on collections of catalytic domains organized into modules, which are responsible for incorporation of a single, specific amino acid into the growing NRP.1, 2 There are two essential catalytic domains for NRP biosynthesis: firstly, the domains responsible for amino acid selection and activation (adenylation/A-domains) – which have been reported to activate over 500 different monomers to date3 – and the domains responsible for peptide bond formation (condensation/C-domains).1 Many other domain types also aid in generating the diversity of NRP structures identified in nature, with one of the most important during peptide elongation being epimerization (E)-domains, which alter the stereochemistry of C-terminal amino acid residues from their (L) to (D) form.1, 2 Central to all steps in NRP biosynthesis are peptidyl carrier protein domains (PCPs), which serve to tether the intermediates during peptide elongation as a thioester via a phosphopantetheine (PPE) arm derived from coenzyme A. PCP-domains are responsible for shuttling intermediates between the catalytic domains of the NRPS and thus play a vital role during peptide biosynthesis.4 As the final step of peptide biosynthesis, cleavage of the mature NRP from the NRPS is required to prevent the machinery from stalling.5 This requirement has also been co-opted as a source of further diversity in NRPS biosynthesis, with specific catalytic domains responsible for this process. The majority of NRPs are cleaved from the NRPS assembly lines by type-I thioesterase (TE) domains,5 with other less common cleavage options also identified (for example the reductive cleavage of the carrier protein bound intermediate by reductase domains).1, 6 Typical type-I TE-domains share a conserved structure7-9 and appear from recent structural characterization of complete NRPS modules to also display a degree of flexibility in their conformation relative to the rest of the catalytic machinery.8 TEdomains rely upon a two-step mechanism to free peptides from the NRPS assembly line: in the first step the carrier protein-bound intermediate is loaded onto a conserved serine (or less frequently, a cysteine) residue within the TE-domain active site.5 At this point, the fate of the TE-bound intermediate can vary substantially depending on the nature of the intercepting nucleophile: attack by water leads to hydrolysis of a linear peptide, whilst intramolecular attack of an amine (from the peptide N-terminus or the side chain of amino acid residues, such as lysine) or alcohol (from amino acid side chains such as serine and threonine) results in the generation of a cyclic peptide10 or depsipeptide product.11 Further examples of diversity within TE-domain activity have been identified, including TE-domains that can dimerize/trimerize peptide monomers into cyclic products10, 12-14 and perform cyclization together with macrothiolactonization;15 other TE-domains have shown to perform intramolecular transesterification,16 and to play a role in epimerizing C-terminal peptide residues (such as in nocardicin biosynthesis).17 TE-domains therefore play very important roles in NRPS-biosynthesis, as they can serve to generate further structural diversity within the NRP. Due to their two-step mechanism, TE-domain selectivity can depend upon both the loading and release steps. In the majority of cases, NRPS TE-domains display low apparent selectivity for the loading step. During the release step the TE-domains generally appear tolerant to alterations in peptide structure whilst retaining their preferred mode of peptide cleavage (macrocyclization, for example).1, 5 Thus, NRPS TE-domains typically appear to play little role as a logic gate in peptide synthesis: exceptions to this rule appear however whenever essential modification of the PCP-bound peptide is required prior to peptide cleavage, with well characterized examples including nocardicin ACS Paragon Plus Environment

Page 2 of 20

Page 3 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biosynthesis,17 pyochelin biosynthesis18, 19 and ACV synthetase in penicillin biosynthesis.20, 21 In these cases, essential peptide modification is performed prior to TE-domain mediated hydrolysis (β-lactam formation, thiazoline formation and epimerization respectively), which explains the requirements for selectivity that are placed on the TE-domains present in these systems.

Figure 1. Structures of glycopeptide antibiotics (GPAs) and a schematic representation of GPA biosynthesis. Structures of representative GPAs teicoplanin and vancomycin, indicating the naming convention for the aromatic rings within the peptide backbone in red (A); Schematic representation of the teicoplanin biosynthesis (B): initial peptide biosynthesis performed by a seven module linear non-ribosomal peptide synthetase (the NRPS is split into four polypeptide chains, Tcp9 – Tcp12) is followed by the Cytochrome P450-mediated oxidative cyclization cascade to generate the NRPSbound aglycone that is finally cleaved from the NRPS by the action of the terminal TE-domain. Abbreviations: A – adenylation domain, C – condensation domain, PCP – peptidyl carrier protein, E – epimerization domain, X – Cytochrome P450 recruitment domain, TE – thioesterase domain, Oxys – Cytochrome P450 enzymes, Dpg – 3,5-dihydroxyphenylglycine, Hpg – 4-hydroxyphenylglycine. One further example of highly complex, late stage modification of NRPs prior to their cleavage from the NRPS machinery is found in the biosynthesis of the glycopeptide antibiotics (GPAs, Figure 1).22, 23 The structure of the GPAs – of which vancomycin and teicoplanin are representative members – displays a highly unusual and complex series of crosslinks between aromatic residues within the GPA heptapeptide (Figure 1A).22, 24 These crosslinks are essential for the antimicrobial activity of GPAs as they generate the requisite three dimensional structure to bind to the D-Ala-D-Ala motif of lipid II, thus inhibiting peptidoglycan biosynthesis. The crosslinking cascade within GPA biosynthesis has been extensively investigated both via in vitro25-39 and in vivo approaches,40-45 the results of which ACS Paragon Plus Environment


have revealed that Cytochrome P450 enzymes (known as Oxy enzymes) are responsible for the installation of these aromatic crosslinks. Furthermore, it has been demonstrated that each individual crosslink within the GPA (3 for type-I/II GPAs and 4 for type-III/IV GPAs) is installed by a specific Oxy enzyme whilst the peptide remains attached to the NRPS machinery.26, 32, 42 These enzymes act in a specific order commencing with installation of the C-O-D ring by OxyB,25-28, 32, 34-36, 38 subsequent activity of the optional OxyE enzyme (installing the type-III/IV specific F-O-G ring)31 and essential OxyA enzyme (installing the D-O-E ring),29, 32, 33, 36, 37, 39 before terminating with insertion of the AB crosslink that is catalyzed by OxyC (Figure 1B). Recruitment of these Oxy enzymes to the NRPS-bound peptide has recently been demonstrated to rely on the X-domain, a conserved C/E-like domain found between the PCP46 and TE-domains within the final modules of GPA NRPS machineries.29, 32, 33 The multiple oxidative transformations that need to occur on a single peptide substrate is supported by a “shuffling” mechanism of continual Oxy enzyme binding and release from the X-domain to ensure that complete crosslinking occurs.29 Given the complex, multi-step nature of the GPA cyclization cascade, the role and selectivity of the TE-domain within this peptide maturation is an important one to address. In this work, we report the first in vitro characterization of a TE-domain from GPA biosynthesis. Our results demonstrate that the TE-domain from the teicoplanin NRPS displays a clear preference for the correct crosslinking state of the PCP-bound peptide and that TE-domain activity relies upon the retention of the extended N-terminal linker found within the final NRPS module. These results serve to once more highlight the impressive ability of TE-domains to act as crucial logic gates that maintain tight control over NRPS biosynthesis when late-stage peptide modifications are required prior to release of the final, bioactive NRP.

Experimental Cloning of protein constructs TE-domain proteins were obtained from a PCP-X-TE construct previously cloned into a modified pET vector containing IgG-binding B1 domain of Streptococcus (GB1).32, 47 Briefly, the PCP-X-TE construct was derived from a synthetic gene encoding for the Tcp12 protein (synthesized by Eurofins Genomics, Uniprot protein ID: Q70AZ6) optimized for expression in E. coli. The published tcp12 sequence48 and consequently the PCP-X-TE contain an alteration in the TE-domain active site (D1728A) which likely renders the TE-domain in the protein inactive. Therefore, an active variant of the PCP-X-TE-domain construct was generated with the inFusion HD Cloning kit (Takara Clontech): a set of overlapping internal primers containing the mutation A1728D fwd GCTTGCTGGCATTACTGGATGCGTATCCGGTATATATGGG, rev CCCATATATACCGGATACGCATCCAGTAAT GCCAGCAAGC was used together with vector specific primers (fwd: TTCTGAGAATCTTTATTTTCAGG (binds to the TEV cleavage site of the vector), rev: TGTGGATGACTCCAAGCACTCTCG (binds to Cterminal Strep-tag)). Based on this construct, the TE-domain was cloned in different lengths to include or exclude the linker region using specific primer sets containing unique restriction sites (NcoI and XhoI) (fwd TE: ATACCATGGGCGAGCGCCGTGGTGCAAGC; fwd L-TE: TATCCATGGGCCCGGGCCGCCGGATCTCTG; rev: ATTACTCGAGCGCATCCGGACGACTACG). After amplification and restriction digestion, the TE-domain constructs were cloned into a modified pET vector additionally encoding for a maltose binding protein (MBP) as an N-terminal fusion partner to improve expression and solubility.47 In addition to the fusion tag, the TE proteins were expressed with an N-terminal hexahistidine tag and C-terminal Strep-II tag. The PCP-X protein from the teicoplanin system was used as a peptide carrier protein and contained GB1 as an N-terminal fusion ACS Paragon Plus Environment

Page 4 of 20

Page 5 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


partner; cloning of this protein as well as the P450 enzymes OxyB and OxyA has been described previously.32, 35 Protein expression and purification The TE domain proteins were expressed in fusion with a solubility tag (MBP) under control of a T7 promoter in the E. coli BL21 Gold (DE3) strain (Agilent). Cells were grown at 37°C until an OD600 of 0.6 was reached. Protein expression was induced by addition of 0.1 mM IPTG and the temperature was reduced to 18°C. After overnight expression, the cells were harvested by centrifugation (5,500 x g, 4°C, 10 min) and the cell pellet was suspended in lysis buffer (50 mM Tris-HCl pH 7.4, 50 mM NaCl, 10 mM imidazole) containing 1 tablet proteinase inhibitor (Sigma-Aldrich) per 100 mL buffer. Cell lysis was performed using a fluidizer (Microfluidics) and the cell debris was removed from the soluble proteins by centrifugation (20,000 x g, 4°C, 60 min). The proteins were purified via metal affinity chromatography: lysate was incubated with Ni-NTA resin (Macherey & Nagel) equilibrated with NiNTA buffer A (50 mM Tris-HCl pH 7.4, 300 mM NaCl, 10 mM imidazole) for 1 hour at 4°C with gentle mixing. After centrifugation (1,000 x g, 4°C, 2 min), the Ni-NTA resin was washed with 10 column volumes (CV) Ni-NTA buffer A and the proteins were eluted with 1 CV Ni-NTA buffer B (50 mM TrisHCl pH 7.4, 300 mM NaCl, 300 mM imidazole). To remove the N-terminal solubility tag the proteins were mixed with Tobacco Etch Virus (TEV) protease in a ratio of 1:100 (w/w) and dialyzed over night at 4°C in dialysis buffer (20 mM Tris-HCl pH 7.4, 50 mM NaCl, 0.5 mM EDTA, 5 mM sodium citrate, 5 mM β-Mercaptoethanol). Proteins thus cleaved were loaded onto a pre-packed 5 mL streptactin column (GE Healthcare) equilibrated with ST buffer A (100 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA). The column was washed with 1 CV ST buffer A and the proteins eluted with 2 CV ST buffer A supplemented with 2 mM desthiobiotin. Protein fractions were pooled, concentrated and further purified via size exclusion chromatography using a Superose 12 column (GE Healthcare) equilibrated with SEC buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl). After the final purification, ~270 nmol of TE and ~150 nmol of L-TE per litre of expression culture were afforded. Expression and purification of PCP-X,32 OxyA32 and OxyB35 was performed as described earlier. The vectors encoding redox partners to support in vitro P450 activity (PuxB A105V variant and PuR)49 were obtained from Dr Stephen Bell (University of Adelaide, Australia), with these proteins prepared as previously reported.49 Peptidyl-CoA synthesis Linear teicoplanin-like heptapeptide peptidyl-CoAs D/L-1-CoA, L-1-CoA and D-1-CoA were synthesized as described previously.33, 34, 50 Briefly, synthesis was performed on Dawson-resin using Fmoc-based solid phase peptide synthesis. Following resin activation, peptides were displaced from the column with MPAA to afford activated thioesters. After side chain deprotection, thioesters were used to generate peptidyl-CoAs via thioester exchange. Diastereomers of the peptidyl-CoAs were separated using preparative HPLC (L-1-CoA: tR = 22.6 min, D-1-CoA: tR = 23.8 min; gradient: 0 - 3 min 95% A, 3 – 33 min up to 30% B, flow rate 20 mL/min) and lyophilized. The purified peptides (L-1-CoA ≥ 95% de; D-1-CoA ≥ 85% de) were finally dissolved in MilliQ water at a concentration of 10 mM, aliquoted and stored at –80°C.

Aglycone-CoA synthesis (see SI Scheme 1) 6. Boc-protected teicoplanin aglycone 6 was obtained as previously described.51 Briefly, teicoplanin (50 mg, 26.6 µmol, Santa Cruz) was sonicated in a mixture of concentrated HCl (1.12 mL) and acetic acid (10.2 mL) until a clear solution was obtained. This mixture was heated to 80°C with vigorous ACS Paragon Plus Environment


stirring and after 2h ice-cold diethyl ether (35 mL) was added and a white solid precipitated from solution. After keeping the mixture at -24°C overnight, the solid was separated by filtration and dried. A solution of crude teicoplanin aglycone 5 in DMF (2 mL) was treated sequentially with NaHCO3 (8.3 mg, 60 µmol, 2.25 eq.) and Boc2O (8.9 mg, 40 µmol, 1.5 eq.) at 0°C The reaction was allowed to proceed overnight with stirring and then neutralized by adding acetic acid, before being concentrated to dryness and purified via preparative HPLC (Waters XBridge BEH300 Prep C18 column, 5µm, 19 x 150mm; gradient: 0 – 5 min 10% ACN + 0.1% FA, 5 – 7 min up to 25% ACN + 0.1% FA, 7 – 37.5 min up to 60% ACN + 0.1% FA; flow rate: 20 mL/min) affording compound 6 as a white foam (20 mg, 15.4 mmol). HPLC-MS (ESI): m/z: [M+H]+ calculated for [C63H54Cl2N7O20]+: 1298.28; found: 1298.20 (tR = 19.8 min [0 - 4 min 5% ACN + 0.1% FA, 4 – 25 min up to 75% ACN + 0.1% FA, flow rate 1 mL/min]). 7. Boc-protected teicoplanin aglycone MPAA thioester 7: 6 (8 mg, 6.2 µmol) was dissolved in dry DMF (800 µL) and K2CO3 (3 mg, 3.5 eq.) and PyBOP ((Benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate, 6.5 mg, 12.4 µmol, 2 eq.) were added sequentially. After stirring for 10 min, MPAA (4-mercaptophenyl acetic acid, 5.2 mg, 31 µmol, 5 eq.) was added and the reaction allowed to proceed for 30 min. Following the removal of DMF, the crude product was then purified using preparative HPLC (gradient: 0 – 5 min 10% ACN + 0.1% FA, 5 –37.5 min up to 50% ACN + 0.1% FA; flow rate: 20 mL/min). After freeze-drying, 7 was obtained as colorless solid (5 mg, 3.5 µmol, 56%). HPLC-MS (ESI): m/z: [M+H]+ calculated for [C71H60Cl2N7O21S]+: 1448.29; found: 1448.30; [M+Na]+ calculated for [C71H59Cl2N7NaO21S]+: 1470.28; found: 1470.15; (tR = 21.0 min [0 - 4 min 5% ACN + 0.1% FA, 4 – 25 min up to 75% ACN + 0.1% FA, flow rate 1 mL/min]). 4-CoA. 7 (2 mg, 1.4 µmol) was suspended in 2 mL of freshly prepared trifluoroacetic acid (TFA) cleavage mixture (95% TFA/ 2.5% triisopropylsilane/2.5% H2O) and incubated for 30 min. The solution was concentrated under a stream of nitrogen, dissolved in 50% ACN (1 mL) and lyophilized. The residue was dissolved in 2 mL 50 mM potassium phosphate buffer (pH 8.3)/ ACN (2:1) containing 20 mM TCEP. CoA (1.0 mg, 1.5 µmol, 1.1 eq) was added and the reaction gently agitated until the MPAA thioester was consumed (1.5 h). The reaction mixture was diluted with 15 mL 50 mM KPi buffer (pH 7.0) and loaded onto an equilibrated Strata-X SPE column (Phenomenex, 200 mg resin/ 3 mL tube) that was subsequently washed with 50 mM KPi buffer (pH 7.0, 3 mL) and water (3 mL). The teicoplanin aglycone CoA conjugate 4-CoA was eluted with 5% MeOH and freeze-dried, affording 4-CoA as white solid (1.2 mg, 0.6 µmol, 44%). HPLC-MS (ESI): m/z: [M+H]+ calculated for [C79H80Cl2N14O33P3S]+: 1947.33; found: 1449.90; [M-ADP-H]+ calculated for [C69H64Cl2N9O24PS]+: 1535.29; found: 1535.50; [M-ADP-2H+Na]+ calculated for [C69H63Cl2N9NaO24PS]+: 1557.27; found: 1557.50; [M-ADP-2H+K]+ calculated for [C69H63Cl2KN9O24PS]+: 1573.25; found: 1573.50; [CoA]+ calculated for [C21H37N7O16P3S]+: 768.12; found: 768.35; (tR = 3.8 min [0 - 4 min 5% ACN + 0.1% FA, 4 – 25 min up to 75% ACN + 0.1% FA, flow rate 1 mL/min]). PCP-loading reaction PCP-X was loaded with peptidyl-CoA (linear teicoplanin-like heptapeptides: D/L-1-CoA, L-1-CoA, D-1CoA or teicoplanin aglycone (4-CoA)) to generate substrates for the TE-domain activity assay: 60 µM PCP-X was mixed with peptidyl-CoA (120 µM of D/L-1-CoA, L-1-CoA, D-1-CoA; 180 µM of 4-CoA) and 6 µM Sfp R4-4 mutant52 in PCP-loading buffer (50 mM Hepes pH 7.0, 50 mM NaCl, 10 mM MgCl2). After incubation with gentle shaking for 1 h at 30°C unbound peptidyl-CoA was removed from the peptidylPCP-X using centrifugal filter units (10 kDa MWCO) via repeated concentration and dilution (4 x, total

ACS Paragon Plus Environment

Page 6 of 20

Page 7 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


volume of 500 µL). After the washing procedure, the peptidyl-PCP-X produced was immediately used for TE-domain activity assays. P450-mediated crosslinking of PCP-X bound heptapeptides Generation of crosslinked heptapeptide loaded onto PCP-X (L-2, L-3) was performed using the established P450 crosslinking reaction:29, 32, 33 25 µM L-1 bound to PCP-X was mixed with 0.5 µM palustrisredoxin reductase (PuR),49 2.5 µM palustrisredoxin B variant A105V (PuxB),49 0.17% glucose (w/v), 9 U/mL glucose oxidase and 2 mM NADH in a total volume of 1 mL. The reaction was initiated by addition of 0.25 µM OxyB or a combination of 0.25 µM OxyB with 1 µM OxyA. After an incubation for 1 h at 30°C, the reaction mixture was then immediately used for TE-domain activity assays. In vitro TE-domain activity assay TE-domain activity was investigated for linear (D/L-1, L-1, D-1) and crosslinked (monocyclic L-2, bicyclic L-3, aglycone 4) peptides coupled to PCP-X. For the TE-domain activity assay 10 µM of substrate were mixed with 1 µM of the respective TE-domain in TE-domain reaction buffer (50 mM Hepes pH 7.0, 50 mM NaCl); the reactions were incubated at 30°C with gentle shaking. To follow the progression of the peptide cleavage, reactions were quenched through the addition of methylamine (23,000-fold molar excess over peptidyl-PCP-X) at different time points (D/L-1, L-1, D-1, L-2 and L-3: 0, 15, 30, 45, 60, 75 and 90 min; 4: 0, 0.5, 1, 2, 3, 4 and 5 min). After an incubation of the cleavage reaction for 10 min the pH was adjusted with formic acid (diluted in water) and the peptides purified using Strata-X-33 polymeric reversed phase columns (30 mg/mL) (Phenomenex). The peptides were analyzed via HPLC-MS (single ion monitoring, negative mode) based on their specific masses. To determine the level of non-specific peptide hydrolysis a second time trace in the absence of TEdomain was performed. After correction for background hydrolysis, TE-domain activity was calculated based on the relationship of the enzymatically cleaved peptide (D/L-1a, L-1a, D-1a: 1088 Da, L-2a: 1086 Da, L-3a: 1084 Da, 4a: 1198.2 Da) and the methylamine cleaved ones (D/L-1b, L-1b, D1: 1101 Da, L-2b: 1099 Da, L-3b: 1097 Da, 4b: 1211.2 Da). The masses are given for negative ionization mode; the introduction of crosslinks into the peptide results in a decrease of the peptide mass of 2 Da per crosslink. Analytical size exclusion chromatography L-TE and PCP-X proteins were incubated in a ratio of 1:3 (66 µM L-TE and 200 µM apo-PCP-X; 33 µM L-TE and 100 µM D/L-1-PCP-X or apo-PCP-X) in SEC buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl) in a total volume of 120 µL. After an incubation for 30 min at RT the samples were centrifuged (12,000 x g, 4°C, 15 min) and 100 µL of the sample was loaded onto a Superose 12 10/300 GL column (GE Healthcare) equilibrated with SEC buffer. In addition to the protein mixture, control samples containing the single interaction partners were analyzed. SEC was performed using a flow rate of 0.8 mL/min and the elution profile of L-TE and PCP-X was recorded using 280 nm absorption.

Results and discussion Construct design and reconstitution of thioesterase activity The TE-domain of the teicoplanin producing NRPS machinery is found in the protein Tcp12, which forms the terminal module of the teicoplanin NRPS. In order to analyze the activity of the TE domain, constructs encoding for the isolated TE-domain were generated. This was undertaken as it would allow the process of peptide hydrolysis to be investigated without potential activity of the TE-domain ACS Paragon Plus Environment


during the loading of various substrates onto the upstream PCP-domain. Whilst the C-terminus of the TE-domain is naturally defined by the end of the Tcp12 protein, the N-terminal domain boundary had not been experimentally defined. Thus, our initial TE-domain construct was generated upon the basis of domain predictions using Interpro,53 which also revealed an unusually large 121 amino acid linker between the TE-domain and the previously characterized upstream X-domain (Figure 2).32 Typical NRPS-domain linker regions have been reported to be in the range of 9 to 32 residues,8, 9 whilst the long linker between the X- and TE-domain identified in the teicoplanin NRPS appears to be a common feature in the terminal module of GPA producing NRPS machineries. The probable origin of the X-TE linker have been revealed thanks to investigation of the terminal module of complestatin,54 a related GPA-like compound with a simplified crosslinking pattern, where the X-TE linker is even longer and shows sequence similarity to a partial A-domain.55 Given the similarity of the X-domain to C-domains it has been suggested that the X-domain and the X-TE linker region originally represented an additional module in an ancestor GPA producing NRPS.55 Whilst the remnant C-domain was recycled as a P450 recruitment platform, the reason for the preservation of the linker region – presumably derived from an A-domain – was unknown.

Figure 2. Determining of the thioesterase domain boundaries from Tcp12. The minimal construct (TE, shaded in purple) is preceded by a long linker region that links the X-domain (shaded in pink) to the minimal TE-domain; the longer construct (L-TE) was created that included both the linker region and the minimal TE-domain. Residues of the TE-domain catalytic triad (Ser1701, Asp1728 and His1839) are indicated by asterisks and are shown in red; helices predicted by InterPro53 are underlined and βstrands predicted by InterPro are shown in bold, with potential β-strands shown in italics. After expression and purification, both constructs eluted as peaks that correspond to monomeric species in size exclusion chromatography (right hand panel; L-TE construct shown in black, TE construct shown in gray). To investigate a potential role of the linker on the TE-domain catalyzed peptide cleavage two different TE proteins – either with or without the linker region (L-TE and TE) – were generated for this study (Figure 2). After expression and purification both proteins eluted from a size exclusion column as monomeric species, suggesting that these were both correctly folded (Figure 2). Our experimental design made use of the TE-domain in trans to the substrate peptide, which was to be enzymatically loaded onto a PCP-X construct derived from Tcp12; the latter has been shown to be a viable substrate for the Oxy enzymes during in vitro peptide crosslinking reactions (Figure 3).28, 29, 31-33, 36-39 The activity of the TE domain proteins were initially tested using a diastereomeric mixture of the linear teicoplanin-like heptapeptide (D/L-1, Figure 3): due to the requirements to load this peptide onto the PCP-X protein, the peptide was synthesized as a peptidyl-CoA34, 50 and subsequently loaded ACS Paragon Plus Environment

Page 8 of 20

Page 9 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to a conserved serine residue in the PCP-domain of the PCP-X protein (D/L-1, Figure 3) using a promiscuous phosphopanthetheinyl transferase (Sfp, R4-4 mutant).52 The peptidyl-PCP-X substrate was then supplemented with either the TE or L-TE protein and samples were taken at different time points to follow the progression of peptide cleavage from the PCP-domain. At the end of the reaction, any peptide remaining attached to the PCP-X protein was chemically cleaved from the PCPdomain by the addition of methylamine, resulting in the generation of methylamide peptides (Figure 3). Both the peptides cleaved from the PCP-X protein by the TE-domain (D/L-1a) and peptides that had been chemically cleaved via the addition of methylamine (D/L-1b) were purified from the reaction mixture using SPE and quantified by LCMS. The relative amount of D/L-1a and D/L-1b, characterized by a mass difference of 13 Da, was then used to determine the TE-domain activity. To correct for unspecific background hydrolysis of the peptide from the PCP-X protein, additional experiments were performed in parallel under the same conditions but without the addition of a TEdomain.

Figure 3. Assay sequence of the TE-domain catalyzed peptide cleavage reaction showing the different peptide substrates used in this study. Following generation of PCP-X loaded with peptides 1-4 (R = PPE-PCP-X) via either Sfp loading alone (1-CoA, 4-CoA) or Sfp loading combined with subsequent OxyB (2) or OxyB/OxyA catalyzed cyclization (3), TE-domain constructs were added to assess TEmediated hydrolysis (R = OH, 1a-4a) at various reaction time points: cleavage of any remaining PCP-X bound peptides using methylamine then generated the methylamide products (R = NHMe, 1b-4b) and the level of peptide amide as opposed to free peptide could then be assessed. PCP-X was purified with GB1 as an N-terminal fusion partner. GB1 – IgG-binding B1 domain of Streptococcus. In initial experiments with the linear peptide D/L-1 the observed rate of background hydrolysis of the peptide was very low (~ 3% of the total substrate after 90 minutes (SI Figure 1)). When the L-TE protein was incubated with the peptidyl-PCP-X protein the amount of cleaved peptide was significantly higher, whilst the addition of the minimal TE construct resulted only in a slight increase in the yield of hydrolyzed peptide (20% vs. 5% after 90 minutes, SI Figure 1-2, Figure 4). Since the ACS Paragon Plus Environment


domain boundaries of the short TE protein correspond to those of other functional and structural characterized TE-domains (SI Figure 3),9, 17, 56-58 the significantly lower activity of this construct compared to the longer L-TE construct suggests an important role for the linker region in the peptide hydrolysis activity of the TE-domain. One explanation for the role of the linker was that it served to mediate an interaction between the substrate carrying PCP-X and the L-TE-protein. However, gel filtration experiments using both PCP-X (in either the apo or peptidyl-PCP form) and L-TE did not reveal a tight interaction between the domains when expressed as isolated proteins, which indicates this effect is not due to increased affinity of the constructs involved (SI Figure 4). The difference in activity noted between the TE and L-TE proteins in these assays also suggests that the linker is not acting merely as a spacer unit to accommodate the presence of the X-domain between the PCP- and TE-domain in Tcp12 (the typical arrangement found in terminal NRPS modules). In such a case, no difference in activity of the TE and L-TE constructs would be expected as the proteins are present in trans. Furthermore, ACV synthase from penicillin biosynthesis – one of the rare examples of a terminal NRPS module in which an E-domain (that shows high structural homologies to the Xdomain) is found between the PCP- and TE-domain – does not possess such a long linker and remains active.21 The exact reasons for the requirement of the linker region for TE-domain activity await further investigation via structural methods, but given the enhanced hydrolytic activity of L-TE over the shorter TE protein all subsequent experiments were performed with the L-TE protein. The TE-domain displays a stereochemical preference for the 7th amino acid The separation of the D/L-1 cleavage reaction via LCMS demonstrated the appearance of two peaks for the TE-domain cleavage product (D/L-1a): these peaks were assigned to peptides bearing L-Hpg7 and D-Hpg7 residues based on LC retention times (L-Hpg7 containing peptides elute before D-Hpg7 containing peptides).34, 50 The relationship between the two diastereomers upon incubation with L-TE indicated that the TE-domain displays a preference for the L-diastereomer. To further explore this potential selectivity, we tested the activity of the L-TE protein towards enantiomerically enriched peptides differing in the stereochemistry of the 7th amino acid (L-1 and D-1) in an in vitro cleavage reaction with L-TE. As anticipated, the highest L-TE activity was obtained for the natural Ldiastereomer (L-1), whereas the cleavage of the D-1 peptide was noticeably slower (27% vs. 15% after 90 minutes, SI Figure 5-6, Figure 4). This stereospecificity matches the selectivity observed for OxyA – the P450 enzyme involved in the insertion of the D-O-E in the GPA cyclization cascade – which shows a stereochemical preference for peptide substrates in which the 7th amino acid within the peptide is in the natural (L)-configuration.29, 36, 39 Given that unwanted epimerization of the 7th residue would prove deleterious to the synthesis machinery as well as render the final compound inactive, this could well explain why the original active site of the neighboring X-domain bears extensive mutations to the standard C/E-domain active site, as such mutations would prevent this unwanted epimerization from occurring.32 The observed TE-domain stereospecificity is also consistent with the results from ACV synthase, but are in contrast to those of the nocardicin TEdomain that appears able to load either diastereomer onto the TE-domain.17, 21 However, given that the nocardicin TE-domain also acts to epimerize the C-terminal residue of its peptide substrate, tolerance for the D-configured peptide would appear to be expected in this case.17


Page 10 of 20

Page 11 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Peptide cleavage activity of L-TE- and TE-domain constructs towards linear substrate peptides (L-1, D-1 and D/L-1) coupled to PCP-X. Reaction progress shown as the percentage of hydrolyzed peptide 1a relative to the total amount of respective peptide detected (sum of hydrolyzed 1a and methylamine cleaved 1b peptide) after background subtraction.

Specificity of the TE-domain for crosslinked peptides The results of the peptide cleavage experiments so far had shown that even under the best conditions – the use of the L-TE protein in combination with the L-1 substrate – only around a quarter of the PCP-loaded substrate were cleaved by the L-TE-domain after 90 minutes. Based on the characterization of other TE-domains (2-200 min-1)13, 14, 17, 18 and reductase domains (0.3 min-1)6 the Tcp12 TE domain appeared to be significantly slower, although the divergence in experimental design naturally makes the direct comparison of such rates difficult. However, the low cleavage rates observed here for Tcp12 do appear to resemble the observations made for the pyochelin TE-domain when using intermediate peptide states prior to the final, mature peptide – given that pyochelin is one of the rare examples of a gatekeeper NRPS domain, this is an important result.18, 19 GPA biosynthesis is also an unusual example of NRPS-mediated biosynthesis, as it requires the multiple step P450-catalyzed crosslinking of the peptide immediately before peptide release from the NRPS: given this, the tetracyclic heptapeptide aglycone would be expected to be the natural TE-domain substrate. To test whether L-TE is more active towards crosslinked peptide substrates, L-1 was subjected to a P450-mediated crosslinking reaction using OxyB and OxyA enzymes prior to the peptide cleavage reaction (Figure 3).29, 32, 36 In the first reaction performed L-1 was converted by the initial enzyme of the oxygenation cascade, OxyB, into the monocyclic C-O-D-ring containing heptapeptide L-2. This reaction yielded a mixture of unreacted linear and crosslinked monocyclic peptide coupled to PCP-X (~3:2, Figure 5, SI Figure 7). The products of the crosslinking reaction were then immediately used as a substrate for the thioesterase assay. Whilst the background hydrolysis recorded in the absence of L-TE was similar for both L-1 and L-2, L-TE displayed a clear preference for cleavage of the monocrosslinked peptide L-2, which was 3.5-fold higher than that for L-1 (2% L-1 vs. 7% L-2 after 90 minutes; reduced rates compared to the L-1 cleavage without a preceding crosslinking reaction likely arise from a combination of a reduced substrate concentration of the respective peptide species due to the incomplete peptide crosslinking reaction and competition for peptide substrate with the Oxy enzymes present in these assays). Given these results, we then further investigated the activity of LTE towards a bicyclic peptide L-3: this was achieved through the use of the established coupled OxyB/OxyA in vitro crosslinking reaction employing the first two P450 enzymes of the crosslinking ACS Paragon Plus Environment


cascade.29, 32, 36 The reaction resulted in the mixture of linear (L-1), monocyclic (L-2) and bicyclic peptide (L-3) (~9:3:4, Figure 5, SI Figure 7). Analysis of the background hydrolysis showed that the majority of the peptides remained coupled to the PCP-X protein and hence were suitable substrates for L-TE: upon addition of L-TE, a clear increase in activity towards the crosslinked peptides L-2 and L3 was observed, with the hydrolysis of L-3 being 1.6-fold faster than that for L-2. Despite the increase in cleavage rate for the crosslinked peptide species, the rates observed were still below those anticipated for a TE-domain based upon previous studies, although the trend suggested that the TEdomain displays a preference for substrates more like that of the GPA aglycone – the anticipated natural substrate for this TE-domain.

Figure 5. L-TE-domain cleavage activity towards differently crosslinked peptide intermediates (L-1, L2 and L-3) coupled to PCP-X. L-TE catalyzed cleavage using substrate generated through loading of L-1 to PCP-X followed by an OxyB catalyzed (mixture of 57% L-1 and 43% L-2 (left panel)) (A) or coupled OxyB/OxyA catalyzed cyclization reaction (mixture of 59% L-1, 17% L-2 and 24% L-3 (left panel)) (B). Progression of the peptide cleavage by L-TE shown as the percentage of hydrolyzed peptide 1a-3a relative to the total amount of respective peptide crosslinking species detected (sum of hydrolyzed 1a-3a and methylamine 1b-3b cleaved peptide) after background subtraction.

Given the trend towards increasing hydrolysis with an increase in peptide crosslinking, we then tested L-TE activity towards completely crosslinked peptide aglycone. To this end, we established a synthetic route using teicoplanin as starting point to generate aglycone-CoA (4-CoA, SI Scheme 1). Commencing with teicoplanin, the aglycone 5 was generated using reported acidic cleavage conditions.51 Subsequently, the amino group of the aglycone was protected with a Boc group to afford 6, before the activated thioester 7 was generated using 4-mercaptophenylacetic acid (MPAA). Cleavage of the Boc group preceded the generation of the desired aglycone-CoA 4-CoA via thioester exchange.


Page 12 of 20

Page 13 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. L-TE-domain cleavage activity towards the full cyclized aglycone 4 coupled to PCP-X. Reaction progress shown as the percentage of hydrolyzed peptide 4a relative to the total amount of aglycone detected (sum of hydrolyzed 4a and methylamine cleaved 4b aglycone) (A). Comparison of the peptide cleavage rates catalyzed by TE and L-TE using different substrate peptides (D/L-1, L-1, D1, L-2, L-3, 4) loaded onto the PCP-X construct (A, B). With the desired compound in hand, 4-CoA was then loaded onto PCP-X to generate the final substrate 4 for investigating the action of the TE-domain. Addition of L-TE to the PCP-bound aglycone 4 achieved much more rapid hydrolysis than had previously been observed, with the rate of reaction exceeding that of the linear intermediates by at least an order of magnitude (≤ 0.3 vs. 4% per minute, Figure 6, SI Figure 8, SI Table 1). This activity is now approaching the levels reported for other TE domains, although this is likely lower than the true rate of the natural NRPS machinery due to the fact that the TE-domain in these assays is added in trans and in sub-stoichiometric amounts compared to the PCP-X bound peptide substrate. The improved activity of the L-TE-domain towards crosslinked peptides – but with particular preference for the completely crosslinked aglycone – is in agreement with the selectivity described for TE-domains from other NRPS systems whose substrates are modified immediately prior to the release from the NRPS machinery, such as in nocardicin and pyochelin biosynthesis pathways.17-19, 59 In addition, the L-TE-domain displays a stereochemical preference for peptides in which the 7th amino acid residue is (L)-configured, which correlates with the selectivity of the Oxy-mediated cascade for this specific peptide diastereomer.29 Thus, the stereospecificity shown by the TE-domain from the GPA NRPS machinery would appear to be a consequence of the need for the TE-domain to act as a stringent logic gate reporting on the state of aglycone crosslinking, which in turn relies upon the (L)-configuration of the final amino acid residue in order to be successfully completed by the Oxy enzyme cascade. The slow hydrolysis of intermediate peptide species suggests that the TE-domain is able to proofread the crosslinking state of the peptide whilst it is being processed on the NRPS by the Oxy-mediated oxidative cascade: upon completion of the Oxy cascade, the rapid hydrolysis of the completed aglycone then occurs (Figure ACS Paragon Plus Environment


7). This result parallels the route by which the Oxy cascade appears to be coordinated, in which a constant scanning of the peptide crosslinking state is made by the various Oxy enzymes that have been recruited by the X-domain.29 In future experiments, it will be important therefore to assess how the rates of amino acid activation peptide bond formation, P450-mediated cyclization and TE-domain activity compare when using the complete, final Tcp12 NRPS module in order to ensure efficient GPA production: to date, only snapshots of these data are available (amino acid activation: 1 - 2 min-1, teicoplanin module 3, Dpg;60 P450-mediated cyclization (9 - 44 min-1, OxyBtei and OxyBvan).29 Taken together, our results presented here show that the TE-domain from the NRPS machinery involved in GPA biosynthesis represents another important example of such a domain acting as a logic gate to ensure the correct late stage processing of the peptide intermediate during NRPS biosynthesis – specifically, the complex and vital aglycone crosslinking cascade that generates the antibiotic core of the glycopeptide antibiotics.

Figure 7. Interplay of Cytochrome P450-mediated oxidative cyclization cascade and TE-domain activity based on the results of this study: the TE-domain exhibits high selectivity for the completely mature GPA aglycone over preceding intermediates, thus ensuring the complete maturation of the peptide prior to cleavage from the NRPS machinery. Abbreviations: A – adenylation domain, C – condensation domain, PCP – peptidyl carrier protein, E – epimerization domain, X – Cytochrome P450 recruitment domain, TE – thioesterase domain, Oxys – Cytochrome P450 enzymes. Domains shown in color indicates their activity at different stages of peptide biosynthesis.

Author Contributions


Page 14 of 20

Page 15 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


M.P. & M.J.C. designed the study and performed the analysis of the results; M.P. performed the biochemical experiments; C.B. performed the peptide and aglycone synthesis; M.H. performed the protein purification. M.J.C. and M.P. wrote the manuscript with contributions from C.B..

Funding Sources This work was supported by the Deutsche Forschungsgemeinschaft (Emmy−Noether Program, CR 392/1-1 (M.J.C)), Monash University & EMBL Australia (M.J.C). This research was supported under Australian Research Council's Discovery Projects funding scheme (project number DP170102220) to M.J.C..

Notes The authors declare no competing financial interest.

Acknowledgements G. Stier (BZH-Heidelberg) for fusion protein vectors; S. Bell (University of Adelaide) for redox proteins; J. Yin (University of Chicago) for the R4-4 Sfp expression plasmid; A. Weinmann for assistance in cloning and protein preparation; M. Schröter for assistance in aglycone-CoA synthesis; M. Müller for mass spectral analysis; and to C. Roome for IT support.



References 1. Süssmuth, R. D., and Mainz, A. (2017) Nonribosomal Peptide Synthesis—Principles and Prospects, Angew. Chem., Int. Ed. 56, 3770-3821. 2. Payne, J. A. E., Schoppet, M., Hansen, M. H., and Cryle, M. J. (2017) Diversity of nature's assembly lines - recent discoveries in non-ribosomal peptide synthesis, Mol. BioSys. 13, 9-22. 3. Walsh, C. T., O'Brien, R. V., and Khosla, C. (2013) Nonproteinogenic Amino Acid Building Blocks for Nonribosomal Peptide and Hybrid Polyketide Scaffolds, Angew. Chem., Int. Ed. 52, 70987124. 4. Kittilä, T., Mollo, A., Charkoudian, L. K., and Cryle, M. J. (2016) New Structural Data Reveal the Motion of Carrier Proteins in Nonribosomal Peptide Synthesis, Angew. Chem., Int. Ed. 55, 9834-9840. 5. Horsman, M. E., Hari, T. P. A., and Boddy, C. N. (2016) Polyketide synthase and non-ribosomal peptide synthetase thioesterase selectivity: logic gate or a victim of fate?, Nat. Prod. Rep. 33, 183-202. 6. Wilson, D. J., Shi, C., Teitelbaum, A. M., Gulick, A. M., and Aldrich, C. C. (2013) Characterization of AusA: A Dimodular Nonribosomal Peptide Synthetase Responsible for the Production of Aureusimine Pyrazinones, Biochemistry 52, 926-937. 7. Liu, Y., Zheng, T., and Bruner, Steven D. (2011) Structural Basis for Phosphopantetheinyl Carrier Domain Interactions in the Terminal Module of Nonribosomal Peptide Synthetases, Chem. Biol. 18, 1482-1488. 8. Drake, E. J., Miller, B. R., Shi, C., Tarrasch, J. T., Sundlov, J. A., Leigh Allen, C., Skiniotis, G., Aldrich, C. C., and Gulick, A. M. (2016) Structures of two distinct conformations of holo-nonribosomal peptide synthetases, Nature 529, 235-238. 9. Tanovic, A., Samel, S. A., Essen, L.-O., and Marahiel, M. A. (2008) Crystal Structure of the Termination Module of a Nonribosomal Peptide Synthetase, Science 321, 659-663. 10. Trauger, J. W., Kohli, R. M., Mootz, H. D., Marahiel, M. A., and Walsh, C. T. (2000) Peptide cyclization catalysed by the thioesterase domain of tyrocidine synthetase, Nature 407, 215218. 11. Grünewald, J., Sieber, S. A., Mahlert, C., Linne, U., and Marahiel, M. A. (2004) Synthesis and Derivatization of Daptomycin: A Chemoenzymatic Route to Acidic Lipopeptide Antibiotics, J. Am. Chem. Soc. 126, 17025-17031. 12. Hoyer, K. M., Mahlert, C., and Marahiel, M. A. (2007) The Iterative Gramicidin S Thioesterase Catalyzes Peptide Ligation and Cyclization, Chem. Biol. 14, 13-22. 13. Shaw-Reid, C. A., Kelleher, N. L., Losey, H. C., Gehring, A. M., Berg, C., and Walsh, C. T. (1999) Assembly line enzymology by multimodular nonribosomal peptide synthetases: the thioesterase domain of E. coli EntF catalyzes both elongation and cyclolactonization, Chem. Biol. 6, 385-400. 14. Gehring, A. M., Mori, I., and Walsh, C. T. (1998) Reconstitution and Characterization of the Escherichia coli Enterobactin Synthetase from EntB, EntE, and EntF, Biochemistry 37, 26482659. 15. Robbel, L., Hoyer, K. M., and Marahiel, M. A. (2009) TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides, FEBS J. 276, 1641-1653. 16. Ray, L., Yamanaka, K., and Moore, B. S. (2016) A Peptidyl-Transesterifying Type I Thioesterase in Salinamide Biosynthesis, Angew. Chem., Int. Ed. 55, 364-367. 17. Gaudelli, N. M., and Townsend, C. A. (2014) Epimerization and substrate gating by a TE domain in β-lactam antibiotic biosynthesis, Nat. Chem. Biol. 10, 251-258. 18. Patel, H. M., and Walsh, C. T. (2001) In Vitro Reconstitution of the Pseudomonas aeruginosa Nonribosomal Peptide Synthesis of Pyochelin: Characterization of Backbone Tailoring Thiazoline Reductase and N-Methyltransferase Activities, Biochemistry 40, 9023-9031.


Page 16 of 20

Page 17 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


19. Quadri, L. E. N., Keating, T. A., Patel, H. M., and Walsh, C. T. (1999) Assembly of the Pseudomonas aeruginosa Nonribosomal Peptide Siderophore Pyochelin: In Vitro Reconstitution of Aryl-4,2bisthiazoline Synthetase Activity from PchD, PchE, and PchF, Biochemistry 38, 14941-14954. 20. Wu, X., García-Estrada, C., Vaca, I., and Martín, J.-F. (2012) Motifs in the C-terminal region of the Penicillium chrysogenum ACV synthetase are essential for valine epimerization and processivity of tripeptide formation, Biochimie 94, 354-364. 21. Kallow, W., Kennedy, J., Arezi, B., Turner, G., and von Döhren, H. (2000) Thioesterase domain of δ-(l-α-aminoadipyl)-l-cysteinyl-d-valine synthetase: alteration of stereospecificity by sitedirected mutagenesis, J. Mol. Biol. 297, 395-408. 22. Yim, G., Thaker, M. N., Koteva, K., and Wright, G. (2014) Glycopeptide antibiotic biosynthesis, J. Antibiot. 67, 31-41. 23. Stegmann, E., Frasch, H.-J., and Wohlleben, W. (2010) Glycopeptide biosynthesis in the context of basic cellular functions, Curr. Opin. Microbiol. 13, 595-602. 24. Al Toma, R. S., Brieke, C., Cryle, M. J., and Suessmuth, R. D. (2015) Structural aspects of phenylglycines, their biosynthesis and occurrence in peptide natural products, Nat. Prod. Rep. 32, 1207-1235. 25. Woithe, K., Geib, N., Zerbe, K., Li, D. B., Heck, M., Fournier-Rousset, S., Meyer, O., Vitali, F., Matoba, N., Abou-Hadeed, K., and Robinson, J. A. (2007) Oxidative Phenol Coupling Reactions Catalyzed by OxyB: A Cytochrome P450 from the Vancomycin Producing Organism. Implications for Vancomycin Biosynthesis, J. Am. Chem. Soc. 129, 6887-6895. 26. Zerbe, K., Woithe, K., Li, D. B., Vitali, F., Bigler, L., and Robinson, J. A. (2004) An oxidative phenol coupling reaction catalyzed by OxyB, a cytochrome P450 from the vancomycin-producing microorganism, Angew. Chem., Int. Ed. 43, 6709-6713. 27. Schmartz, P. C., Wolfel, K., Zerbe, K., Gad, E., El Tamany, E., Ibrahim, H. K., Abou-Hadeed, K., and Robinson, J. A. (2012) Substituent Effects on the Phenol Coupling Reaction Catalyzed by the Vancomycin Biosynthetic P450 Enzyme OxyB, Angew. Chem., Int. Ed. 51, 11468-11472. 28. Ulrich, V., Peschke, M., Brieke, C., and Cryle, M. (2016) More than just recruitment: the X-domain influences catalysis of the first phenolic coupling reaction in A47934 biosynthesis by Cytochrome P450 StaH, Mol. BioSys. 12, 2992-3004. 29. Peschke, M., Haslinger, K., Brieke, C., Reinstein, J., and Cryle, M. (2016) Regulation of the P450 oxygenation cascade involved in glycopeptide antibiotic biosynthesis, J. Am. Chem. Soc. 138, 6746-6753. 30. Peschke, M., Gonsior, M., Süssmuth, R. D., and Cryle, M. J. (2016) Understanding the crucial interactions between Cytochrome P450s and non-ribosomal peptide synthetases during glycopeptide antibiotic biosynthesis, Curr. Opin. Struct. Biol. 41, 46-53. 31. Peschke, M., Brieke, C., and Cryle, M. J. (2016) F-O-G Ring Formation in Glycopeptide Antibiotic Biosynthesis is Catalysed by OxyE, Sci. Rep. In Press. 32. Haslinger, K., Peschke, M., Brieke, C., Maximowitsch, E., and Cryle, M. J. (2015) X-domain of peptide synthetases recruits oxygenases crucial for glycopeptide biosynthesis, Nature 521, 105-109. 33. Brieke, C., Peschke, M., Haslinger, K., and Cryle, M. J. (2015) Sequential In Vitro Cyclization by Cytochrome P450 Enzymes of Glycopeptide Antibiotic Precursors Bearing the X-Domain from Nonribosomal Peptide Biosynthesis, Angew. Chem., Int. Ed. 54, 15715-15719. 34. Brieke, C., Kratzig, V., Haslinger, K., Winkler, A., and Cryle, M. J. (2015) Rapid access to glycopeptide antibiotic precursor peptides coupled with cytochrome P450-mediated catalysis: towards a biomimetic synthesis of glycopeptide antibiotics, Org. Biomol. Chem. 13, 2012-2021. 35. Haslinger, K., Maximowitsch, E., Brieke, C., Koch, A., and Cryle, M. J. (2014) Cytochrome P450 OxyBtei Catalyzes the First Phenolic Coupling Step in Teicoplanin Biosynthesis, ChemBioChem 15, 2719-2728. 36. Peschke, M., Brieke, C., Goode, R. J. A., Schittenhelm, R. B., and Cryle, M. J. (2017) Chlorinated Glycopeptide Antibiotic Peptide Precursors Improve Cytochrome P450-Catalyzed Cyclization Cascade Efficiency, Biochemistry 56, 1239-1247. ACS Paragon Plus Environment


37. Forneris, C. C., Ozturk, S., Gibson, M. I., Sorensen, E. J., and Seyedsayamdost, M. R. (2017) In Vitro Reconstitution of OxyA Enzymatic Activity Clarifies Late Steps in Vancomycin Biosynthesis, ACS Chem. Biol. 12, 2248-2253. 38. Mollo, A., von Krusenstiern, A. N., Bulos, J. A., Ulrich, V., Akerfeldt, K. S., Cryle, M. J., and Charkoudian, L. K. (2017) P450 monooxygenase ComJ catalyses side chain phenolic crosscoupling during complestatin biosynthesis, RSC Adv. 7, 35376-35384. 39. Ulrich, V., Brieke, C., and Cryle, M. (2016) Biochemical and structural characterisation of the second oxidative crosslinking step during the biosynthesis of the glycopeptide antibiotic A47934, Beilstein J. Org. Chem. 12, 2849–2864. 40. Hadatsch, B., Butz, D., Schmiederer, T., Steudle, J., Wohlleben, W., Suessmuth, R., and Stegmann, E. (2007) The biosynthesis of teicoplanin-type glycopeptide antibiotics: Assignment of P450 mono-oxygenases to side chain cyclizations of glycopeptide A47934, Chem. Biol. 14, 10781089. 41. Stegmann, E., Pelzer, S., Bischoff, D., Puk, O., Stockert, S., Butz, D., Zerbe, K., Robinson, J., Suessmuth, R. D., and Wohlleben, W. (2006) Genetic analysis of the balhimycin (vancomycintype) oxygenase genes, J. Biotechnol. 124, 640-653. 42. Bischoff, D., Bister, B., Bertazzo, M., Pfeifer, V., Stegmann, E., Nicholson, G. J., Keller, S., Pelzer, S., Wohlleben, W., and Suessmuth, R. D. (2005) The biosynthesis of vancomycin-type glycopeptide antibiotics-a model for oxidative side-chain cross-linking by oxygenases coupled to the action of peptide synthetases, ChemBioChem 6, 267-272. 43. Bischoff, D., Pelzer, S., Holtzel, A., Nicholson, G. J., Stockert, S., Wohlleben, W., Jung, G., and Sussmuth, R. D. (2001) The biosynthesis of vancomycin-type glycopeptide antibiotics-new insights into the cyclization steps, Angew. Chem., Int. Ed. 40, 1693-1696. 44. Bischoff, D., Pelzer, S., Bister, B., Nicholson, G. J., Stockert, S., Schirle, M., Wohlleben, W., Jung, G., and Sussmuth, R. D. (2001) The biosynthesis of vancomycin-type glycopeptide antibiotics - the order of the cyclization steps, Angew. Chem., Int. Ed. 40, 4688-4691. 45. Sussmuth, R. D., Pelzer, S., Nicholson, G., Walk, T., Wohlleben, W., and Jung, G. (1999) New advances in the biosynthesis of glycopeptide antibiotics of the vancomycin type from Amycolatopsis mediterranei, Angew. Chem., Int. Ed. 38, 1976-1979. 46. Haslinger, K., Redfield, C., and Cryle, M. J. (2015) Structure of the terminal PCP domain of the non-ribosomal peptide synthetase in teicoplanin biosynthesis, Proteins: Struct., Funct., Bioinf. 83, 711-721. 47. Bogomolovas, J., Simon, B., Sattler, M., and Stier, G. (2009) Screening of fusion partners for high yield expression and purification of bioactive viscotoxins, Prot. Exp. Purif. 64, 16-23. 48. Sosio, M., Kloosterman, H., Bianchi, A., de Vreugd, P., Dijkhuizen, L., and Donadio, S. (2004) Organization of the teicoplanin gene cluster in Actinoplanes teichomyceticus, Microbiology 150, 95-102. 49. Bell, S. G., Xu, F., Johnson, E. O. D., Forward, I. M., Bartlam, M., Rao, Z., and Wong, L.-L. (2010) Protein recognition in ferredoxin-P450 electron transfer in the class I CYP199A2 system from Rhodopseudomonas palustris, J. Biol. Inorg. Chem. 15, 315-328. 50. Brieke, C., and Cryle, M. J. (2014) A Facile Fmoc Solid Phase Synthesis Strategy To Access Epimerization-Prone Biosynthetic Intermediates of Glycopeptide Antibiotics, Org. Lett. 16, 2454-2457. 51. Boger, D. L., Weng, J.-H., Miyazaki, S., McAtee, J. J., Castle, S. L., Kim, S. H., Mori, Y., Rogel, O., Strittmatter, H., and Jin, Q. (2000) Thermal Atropisomerism of Teicoplanin Aglycon Derivatives: Preparation of the P,P,P and M,P,P Atropisomers of the Teicoplanin Aglycon via Selective Equilibration of the DE Ring System, J. Am. Chem. Soc. 122, 10047-10055. 52. Sunbul, M., Marshall, N. J., Zou, Y., Zhang, K., and Yin, J. (2009) Catalytic Turnover-Based Phage Selection for Engineering the Substrate Specificity of Sfp Phosphopantetheinyl Transferase, J. Mol. Biol. 387, 883-898. 53. Hunter, S., Jones, P., Mitchell, A., Apweiler, R., Attwood, T. K., Bateman, A., Bernard, T., Binns, D., Bork, P., Burge, S., de Castro, E., Coggill, P., Corbett, M., Das, U., Daugherty, L., Duquenne, L., Finn, R. D., Fraser, M., Gough, J., Haft, D., Hulo, N., Kahn, D., Kelly, E., Letunic, I., Lonsdale, D., ACS Paragon Plus Environment

Page 18 of 20

Page 19 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Lopez, R., Madera, M., Maslen, J., McAnulla, C., McDowall, J., McMenamin, C., Mi, H., Mutowo-Muellenet, P., Mulder, N., Natale, D., Orengo, C., Pesseat, S., Punta, M., Quinn, A. F., Rivoire, C., Sangrador-Vegas, A., Selengut, J. D., Sigrist, C. J. A., Scheremetjew, M., Tate, J., Thimmajanarthanan, M., Thomas, P. D., Wu, C. H., Yeats, C., and Yong, S.-Y. (2011) InterPro in 2011: new developments in the family and domain prediction database, Nucl. Acids Res. 54. Chiu, H.-T., Hubbard, B. K., Shah, A. N., Eide, J., Fredenburg, R. A., Walsh, C. T., and Khosla, C. (2001) Molecular cloning and sequence analysis of the complestatin biosynthetic gene cluster, Proc. Nat. Acad. Sci. USA 98, 8548-8553. 55. Rausch, C., Hoof, I., Weber, T., Wohlleben, W., and Huson, D. (2007) Phylogenetic analysis of condensation domains in NRPS sheds light on their functional evolution, BMC Evolution. Biol. 7, 78. 56. Bruner, S. D., Weber, T., Kohli, R. M., Schwarzer, D., Marahiel, M. A., Walsh, C. T., and Stubbs, M. T. (2002) Structural Basis for the Cyclization of the Lipopeptide Antibiotic Surfactin by the Thioesterase Domain SrfTE, Structure 10, 301-310. 57. Samel, S. A., Wagner, B., Marahiel, M. A., and Essen, L.-O. (2006) The Thioesterase Domain of the Fengycin Biosynthesis Cluster: A Structural Base for the Macrocyclization of a Non-ribosomal Lipopeptide, J. Mol. Biol. 359, 876-889. 58. Frueh, D. P., Arthanari, H., Koglin, A., Vosburg, D. A., Bennett, A. E., Walsh, C. T., and Wagner, G. (2008) Dynamic thiolation-thioesterase structure of a non-ribosomal peptide synthetase, Nature 454, 903-906. 59. Gaudelli, N. M., Long, D. H., and Townsend, C. A. (2015) beta-Lactam formation by a nonribosomal peptide synthetase during antibiotic biosynthesis, Nature 520, 383-387. 60. Kittilä, T., Schoppet, M., and Cryle, M. J. (2016) Online Pyrophosphate Assay for Analyzing Adenylation Domains of Nonribosomal Peptide Synthetases, ChemBioChem 17, 576-584.



TOC Graphic 38x18mm (300 x 300 DPI)


Page 20 of 20

The thioesterase domain in glycopeptide antibiotic biosynthesis is

Recommend Documents