Time-Resolved Detection of Light-Induced Dimerization of Monomeric

Article pubs.acs.org/JPCB

Time-Resolved Detection of Light-Induced Dimerization of Monomeric Aureochrome‑1 and Change in Affinity for DNA Yuki Akiyama,† Yusuke Nakasone,† Yoichi Nakatani,‡ Osamu Hisatomi,‡ and Masahide Terazima*,† †

Department of Chemistry, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan Department of Earth and Space Science, Graduate School of Science, Osaka University, Osaka 560-0043, Japan

‡

S Supporting Information *

ABSTRACT: Aureochrome (Aureo) is a recently discovered blue light sensor protein initially from Vaucheria f rigida, in which it controls blue light-dependent branch formation and/or development of a sex organ by a light-dependent change in the affinity for DNA. Although photochemical reactions of Aureo-LOV (LOV is a C-terminal light-oxygen-voltage domain) and the N-terminal truncated construct containing a bZIP (Nterminal basic leucine zipper domain) and a LOV domain have previously been reported, the reaction kinetics of the change in affinity for DNA have never been elucidated. The reactions of Aureo where the cysteines are replaced by serines (AureoCS) as well as the kinetics of the change in affinity for a target DNA are investigated in the time-domain. The dimerization rate constant is obtained as 2.8 × 104 M−1 s−1, which suggests that the photoinduced dimerization occurs in the LOV domain and the bZIP domain dimerizes using the interaction with DNA. Surprisingly, binding with the target DNA is completed very quickly, 7.7 × 104 M−1 s−1, which is faster than the protein dimerization rate. It is proposed that the nonspecific electrostatic interaction, which is observed as a weak binding with DNA, may play a role in the efficient searching for the target sequence within the DNA.

1. INTRODUCTION

mechanism of light regulation with biological function, and as a tool in optogenetics.11,12 The initial photoreaction of the LOV domain was studied by light absorption detection, and was identified as the adduct formation between the isoalloxazine ring of flavin mononucleotide (FMN) and the sulfur of the cysteine residue in the LOV domain.13−16 The subsequent reaction dynamics of Aureos were revealed by the transient grating (TG) method.17 In the dark, the LOV domain of Aureo1 exists as an equilibrium between the monomer and the dimer, and the LOV domain exhibits photoinduced dimerization from the monomer with a rate constant that is proportional to the concentration of the LOV domain. However, the N-terminal truncated construct containing the bZIP and LOV domain (ZL) exists in the dimeric form in the dark and showed a conformational change after photoexcitation. However, the subsequent protein−DNA interaction is yet to be well elucidated in particular in the timedomain. Although a blue light-dependent change in the affinity of Aureo from V. f rigida for sequence specific DNA has not been reported after the first paper, an interesting proposal on the light-regulated transcription mechanism has recently been reported.18 The wild-type ZL forms the dimer by intermolecular disulfide linkages at Cys162 and Cys182. When the

Light sensing is a vital function for most living organisms. Aureochrome (Aureo) is a recently discovered blue light-sensor protein initially in Vaucheria f rigida.1 It has two homologues, aureochrome-1 (Aureo1) and aureochrome-2 (Aureo2), and the biological functions have been suggested to be blue lightdependent branch formation and the development of a sex organ, respectively.1,2 Since then, several orthologs of Aureos have been identified from various organisms, such as brown algae Saccharina japonica,3 Fucus distichus,1 and diatom Phaeodactylum tricornutum.4,5 Aureos consist of an N-terminal basic leucine zipper (bZIP) domain for transcription regulation, and a C-terminal light-oxygen-voltage (LOV) domain for sensing light. Generally, bZIP proteins have α-helical DNA binding motifs that comprise a family of eukaryotic transcription factors. The bZIP proteins form the dimer through Leu residues that repeat each 7 amino acids, and bZIP residues form hydrogen bonds with DNA bases of the binding site, which often consist of 4−10 base pairs.6−10 The DNA sequence that the bZIP domain of Aureo recognizes have been determined as TGACGT.1 In the case of the Aureos, the Nterminal located effector domain (bZIP domain) is regulated light dependently by the C-terminal LOV domain, and this effector-sensor topology is different from most of the LOV domain proteins in which the photosensory domain precedes the C-terminal effector domain. This reaction has been attracting much attention for understanding the molecular © 2016 American Chemical Society

Received: June 7, 2016 Revised: July 11, 2016 Published: July 12, 2016 7360

DOI: 10.1021/acs.jpcb.6b05760 J. Phys. Chem. B 2016, 120, 7360−7370

Article

The Journal of Physical Chemistry B

2.2. Measurements. The experimental setup of the TG measurement was similar to that reported previously.17,24,25 Briefly, a laser pulse from a dye laser (Lumonics, HyperDye 300; wavelength = 465 nm) pumped by an excimer laser (Lambda Physik, XeCl operation; 308 nm) was used as an excitation beam, and a diode laser (835 nm) was used as a probe beam. The power of the excitation laser was set to be approximately 20 μJ/mm2 per pulse except for the measurements of the excitation intensity dependence on the reaction (1.4−540 μJ/mm2pulse). The magnitude of the grating wavenumber (q) was determined by the thermal grating signal of a calorimetric standard sample (bromocresole purple), which releases all of the photon energy of the excitation light as thermal energy within the time response of our system (∼20 ns). More than ten recorded signals were averaged to improve the S/N ratio of the signal. To avoid possible multiexcitation, the sample was stirred after each laser shot. All samples were filtered with a centrifugal filter (PALL, 0.2 μm) before measurements. All measurements were performed at 298 K. Circular dichroism (CD) measurements were performed using a CD spectropolarimeter (J720W1, JASCO). The path length of the sample cell was 10 mm. For the CD measurement of the light activated sample, the sample solution was initially illuminated by blue laser light (445 nm, 3 W) continuously and each CD spectrum was recorded just after stopping illumination. Given that the measurements took less than 1 min and the half-life of the Aureo1 active state is 11 min, the contribution of dark state species while measuring the light state is negligible. The dynamic light scattering (DLS) experiments were carried out using a green diode laser (532 nm, 100 mW) as a probe light. The scattering angle was 90° for all measurements. Incident laser power was manually controlled with an equipped neutral density optical filter. The scattered light was detected with a cooled photomultiplier through an optical fiber, and selfcorrelation of its intensity fluctuation was calculated by a correlator (FDLS-3000; Otuka Electronics, Japan). NMR sample tubes (5 mm diameter) were used for measurements at room temperature (298 K). Prior to the experiments, sample solutions were filtered with a 0.2 μm syringe filter. 2.3. Principle of the TG Method. Detailed principles of the TG method have been reported previously.26,27 Briefly, in the TG method, the refractive index change (δn), which is generated after the photoexcitation of the chemical species, is detected as the intensity of a diffracted probe beam (the TG signal). Under a weak diffraction condition and a negligible light absorbance of the probe light, the intensity of the TG signal (ITG(t)) is proportional to the square of δn. There are two main contributions to the signal. First, the refractive index change owing to the temperature change arising from the nonradiative relaxation from the excited state (the thermal grating). This component decays with a rate constant of Dthq2, where Dth is the thermal diffusivity of the solution and q is the grating wavenumber. The other contribution comes from the refractive index change owing to the absorption spectrum change (population grating) and partial molar volume change (volume grating). The sum of both population and volume gratings are referred to as the species’ grating signal.

cysteines are replaced by serines, this mutant (AureoCS) exists as the monomeric form in the dark. Upon photoexcitation, dimerization occurs and the affinity with the target sequence DNA increases. Furthermore, the oxidation-redox potentials of the Cys residues, which form the disulfide bonds in the wildtype Aureo, are close to the redox conditions in the cell. From these facts, it was proposed that monomeric Aureo1 may be present in vivo and the light-dependent dimerization reaction is coupled with the change in affinity for DNA.18 The relationship between dimer formation and the affinity for the target DNA sequence has also been reported for Aureo from other species. Recently, a light-dependent affinity change of Aureo1a from Phaeodactylum tricornutum was studied based on the crystal structure, hydrogen/deuterium exchange, and solution scattering experiments.19 The light-induced dimerization of the LOV domain was observed and this dimerization enhanced the affinity for DNA. Photoinduced dimerization of the LOV domain from P. tricornutum with the A′α helix has also been reported by FT-IR and size exclusion chromatography measurements.20,21 These studies suggest that the dimerization may be a key step for the photoinduced change in affinity for the target DNA. However, neither the reaction scheme nor the dynamics have been clarified. Here we investigated the reaction dynamics of AureoCS in the time-domain to determine the reaction scheme and kinetics to elucidate the relationship between the dimerization reaction and binding with the target DNA in greater detail.

2. MATERIAL AND METHODS 2.1. Materials. The expression plasmids of AureoCS were constructed as described previously.18,22 The plasmid containing AureoCS was introduced into BL21 (DE3) cells (Invitrogen). Cells were cultured in 2xYT medium containing ampicillin (100 μg/mL), and protein expression was induced by the addition of 1 mM isopropyl-β-D-thiogalactopyranoside. Cells were harvested by centrifugation at 4000 × g for 10 min and disrupted by sonication (TOMY, UD-201) on ice for 2 min twice with an output power of 60 W in a lysis buffer (400 mM NaCl, 2 mM MgCl2, 2 mM dithiothreitol (DTT), 0.2 mM phenylmethylsulfonyl fluoride, and 80 μg/mL DNaseI, 20 mM Tris-HCl, pH 7.0). Cell debris was removed by centrifugation at 65000 × g for 10 min, and AureoCS was purified with a NiNTA column (Ni SepharoseTM6 Fast Flow, GE Healthcare) and a HiTrap Heparin HP column (GE Healthcare). After removing imidazole, AureoCS was stored in buffer solution (400 mM NaCl, 1 mM DTT, and 20 mM Tris-HCl, pH 7.0) at 4 °C until used for measurements. The protein concentration was determined using the extinction coefficient at 447 nm (ε447 = 13 000 M−1cm−1).23 Two types of double strand DNA were prepared for investigating the change in affinity with AureoCS; “Target DNA” contains the binding sequence TGACGT (5′GACCTGAGTGCTCGAGCTGCGAGACGCTGTCTGACGTCAGACAGCGTCTCGCAGCTCGAGCACTCAGGTC-3′). “Reference DNA” does not contain the binding s e q u e n c e ( 5 ′ - G A C C T G A G T G C T C G A G CT G C G A GACGCTGTCCTAGCTAGGACAGCGTCTCGCAGCTCGAGCACTCAGGTC-3′). Both are 70 base pairs (42 kDa) and the sequences are identical except for 8 base pairs (underlined). Palindromic single strand oligonucleotide for the DNA strands were purchased from FASMAC, and annealed by heating to 100 °C then slowly cooling down to room temperature.

3. RESULTS 3.1. Photoreaction of AureoCS. A typical TG signal of AureoCS in the buffer at a concentration of 20 μM and at a grating wavenumber q2 = 1.1 × 1010 m−2 is shown in Figure 1a. 7361


Article

The Journal of Physical Chemistry B ITG(t ) = α{δnadd exp( −kaddt ) 2

+ δnth exp(−Dth q2t ) + δnspe(t )}

(1)

where α is a constant representing the system sensitivity. The pre-exponential factors of δnadd and δnth are the refractive index change by the adduct formation and that arising from the thermal grating, respectively. Furthermore, kadd is the rate constant of the adduct formation, and δnspe(t) represents the time-dependent refractive index change of the species grating appearing after the thermal grating component. After the thermal grating signal, the TG signal decayed to the baseline (∼100 ms in Figure 1a). At this q2 (1.1 × 1010 m−2 (Figure 1a)), the signal intensity before the decay at around 100 ms is almost a constant (5−30 ms). However, when the signal was measured at a larger q2, at which the thermal grating signal decayed faster, a weak rise component became apparent at 0.1−3 ms, as shown in the magnified signals of Figure 1b, which depicts the TG signals at various q2 normalized by the thermal grating signal intensity. The time range of this rise component did not depend on q2. This fact indicates that this rise component represents another reaction phase besides the adduct formation. Since there is no change in absorption over this time range for AureoCS, this component is attributed to the volume grating of AureoCS indicating a conformation change. This phase was not observed for Aureo-LOV and ZL. Hence, we consider that this conformation change is related to the bZIP-LOV domain interaction before the dimerization reaction described below. It is apparent that the time range of the next strong risedecay component depended on q2 (Figure 1b). Hence, this signal was attributed to the protein diffusion process (diffusion peak). If the reaction kinetics can be ignored in the diffusion signal, the temporal profile should be expressed by a biexponential function:26,27

Figure 1. (a) Typical TG signal after photoexcitation of AureoCS at 20 μM and q2 = 1.1 × 1010 m−2. The inset shows the magnified signal in the middle time range of the figure. (b) TG signals normalized by the thermal grating signal intensity at various q2. The inset shows the magnified signals in the time range of 10 μs−20 ms. The q2-values are shown in the legend of the figure.

δnspe(t ) = −δnR exp( −DR q2t ) + δnPexp( −DPq2t )

(2)

where δni and Di (i = P or R) are the refractive index change and the diffusion coefficient of the i species (product (P) and reactant (R)). Comparing the sign of the thermal grating (δnth < 0), we determined the signs of the refractive index changes of the rise and decay components of the diffusion signal to be negative and positive, respectively. From these signs, the rise and decay components were respectively attributed to the diffusion processes of the reactant and the product. The slower rate constant of the product diffusion indicates DP < DR; that is, the diffusion coefficient decreases upon the product formation. The observed D-change clearly indicates the presence of a conformational change and/or oligomer state change. We will discuss the origin of this change later in this article. It should be noted that not only the time range of the signal, but also the diffusion peak intensity were dependent on q2 (Figure 1b). This behavior is qualitatively explained as follows. On a short time scale, the diffusion signal intensity was weak, because the change in D is small over this period (DP ≈ DR), and the first and the second terms in eq 2 are canceled. With increasing the observation time, DP gradually decreased, and the difference between DP and DR increased, so that the diffusion peak intensity increased. In particular, it is important to note that the diffusion signal having the rise-decay profile at the short time range (Figure 1b, q2 = 2.4 × 1012 m−2) disappeared and only one decay component arising from the diffusion (with the rise component owing to the reaction

The TG signal rose with the time response of our experimental system (∼20 ns), decayed to the baseline, and exhibited a risedecay profile twice within a time range of 2 μs to 10 s. The initial decay-rise-decay profile until ∼3 ms in the figure was expressed well by a biexponential function with a weak constant background, which is a part of the latter rise-decay peak. The time constant of the first component was 2.1 μs, and was independent of the q2 value indicating that this phase represents a chemical reaction process. Given that the qualitative temporal profile as well as this time constant are similar to that observed after the photoexcitation of the LOV domains of phototropins (phot1-LOV2 (1.9 μs)28 and phot2LOV2 (0.9 μs)29), as well as the LOV domain of Aureo1 (2.8 μs),17 this phase was attributed to the adduct formation between FMN and the cysteine residue in the LOV domain of AureoCS. The time constant of the second decay component depended on the q2-value and agreed with that of the rate constant of Dthq2, which was determined from a signal of the calorimetric reference sample. Consequently, this component was attributable to the thermal grating (δnth) caused by the thermal energy released from the excited molecule and the enthalpy change of the reaction. Hence, the temporal profile of the signal (ITG(t)) until ∼10 ms at this q2 should be expressed by 7362


Article


next I2 → P process was characterized by the diffusion signals at various q2. The analytical expression to describe this timedependent diffusion was reported previously,30 and is given by

phase) was observed (e.g., Figure 1b; black line). The single diffusion decay indicates that there is only one diffusion component, that is, D does not change over this time range. The temporal profile of the TG signal was analyzed using the reaction model of Scheme 1, where I1 denotes the initial

⎡⎛ ⎞ k2 ITG(t ) = α⎢⎜δnI 2 − δnP ⎟ 2 ⎢⎣⎝ (DI 2 − DP )q + k 2 ⎠

Scheme 1

exp{−(DI 2q2 + k 2)t } −δnR exp( −DR q2t ) ⎤2 + δnP exp( −DP q t )⎥ ⎥⎦ (DI 2 − DP )q2 + k 2 k2

photoadduct state that forms with a time constant of 2.1 μs. Next, the I1 → I2 process with the rate constant of k1, represents the q2 independent reaction kinetics, which manifests itself by the volume grating before the diffusion signal. The last step, from I2 to P with the rate constant of k2, is the phase of the D-change. Here, P stands for the final product of AureoCS. Given that we observed only one diffusion component in the short time range (Figure 1b, q2 = 2.4 × 1012 m−2), D of the reactant (R), I1 and I2 should be identical. The I1 → I2 process was analyzed by a single exponential function for the weak rise signal which appears before the following molecular diffusion signal at q2 = 2.8 × 1011 m−2, and we determined the rate constant k1 to be (3 ± 1) × 102 s−1. The

2

(3)

where δnI2 and DI2, are the refractive index changes owing to the intermediate I2, and the diffusion coefficient of I2, respectively. As described above, DI2 should be equal to DR. By fitting the diffusion peak in the long time range (Figure 1a) by a biexponential function (eq 2), DR and DP were determined to be (8.1 ± 0.4) × 10−11 m2s−1 and (5.3 ± 0.5) × 10−11 m2s−1, respectively. By using these parameters, the observed TG signals over a wide observation time range at various q2 values were reproduced very well with only two adjustable parameters, δnI2, and a reaction rate, k2. The rate

Figure 2. Typical TG signals at two different concentrations at a q2 of (a) 4.1 × 1011 m−2 and (b) 1.1 × 1010 m−2. (c) The diffusion signals at various concentrations of AureoCS at q2 = 6.7 × 1010 m−2 (solid lines) and the best-fit curves (broken lines). The concentrations are shown in the legend of the figure. (d) Plot of k2 against a concentration of the monomeric AureoCS, which was calculated based on the dissociation constant (Kd = 131 μM)23 of the dark state. The fitted line with a linear function is shown as a blue line. 7363


Article

The Journal of Physical Chemistry B constant of the D-change determined from the fitting was k2 = 0.52 ± 0.02 s−1 at this concentration. 3.2. Dimerization of AureoCS. The determined DR value is reasonable for the AureoCS monomer (27 kDa), compared with D values of other proteins with a similar size: 9.2 × 10−11 m2s−1 for phot1-LOV2 with a linker region (26 kDa),31 8.2 × 10−11 m2s−1 for dimeric phot1-LOV1 (34 kDa),32 and 7.8 × 10−11 m2s−1 for dimeric Aureo1-LOV (35 kDa).17 This result indicates that AureoCS in the dark state exists dominantly as a monomer, which is reasonable considering the reported dissociation constant (Kd = 131 μM) of the dark state.23 There are two possible origins to explain the reduction of D by the photoreaction; size change owing to oligomer formation and a conformation change, such as unfolding/folding of the secondary structure. To clarify the origin of the observed Dchange (DP < DR), we measured the AureoCS concentration ([AureoCS]) dependence on the diffusion signal. Figure 2a and b depict typical diffusion signals at 20 μM and 90 μM of AureoCS at two different q2 (q2 = 4.1 × 1011 m−2 and 1.1 × 1010 m−2) normalized by the grating signal after the thermal grating decay, which is proportional to the number of photoexcited proteins (the I1 species). An apparent difference is notable: the rise-decay diffusion signal appearing around 100 ms was much weaker for the 20 μM solution than that of the 90 μM solution (Figure 2a). Even for a later time range (i.e., at a smaller q2-value, Figure 2b), the diffusion signal for the 90 μM solution was larger. These features can be explained in terms of a faster change in D at the higher concentration. We analyzed the diffusion signals at various concentrations using eq 3 (Figure 2c) to determine the concentration dependence of the rate constant k 2 . The values are plotted against the concentration of monomeric form of AureoCS in Figure 2d. The rate constant was proportional to the concentration. This result implies that the origin of the D-change is the dimerization reaction of AureoCS. The rate constant was expressed by k 2 = k i2[AureoCS]

Figure 3. CD spectra of AureoCS in the dark state (black line) and in the light state (red line).

excited monomer form the dimer, or two excited monomers form the dimer. We measured the diffusion signal at various light intensities in the range of 1.4−540 μJ/mm2pulse, and found that the root square of the TG signal intensity, which is proportional to the number of dimerization events, linearly increased with the laser power intensity in the range of 1.4−150 μJ/mm 2 pulse (Figure 4a). This fact implies that the dimerization occurs between the AureoCS in the light state and in the dark state. Previously, it was reported that the

(4)

where ki2 is the intrinsic bimolecular reaction rate constant. From the slope of the plot, ki2 is determined to be (2.8 ± 0.1) × 104 M−1 s−1. Interestingly, this value is close to the reported rate constant for the LOV domain of Aureo1 ((3.0 ± 0.2) × 104 M−1 s−1 from Figure 2b in ref 17.). The similar rate constant of the dimerization rate suggests that the LOV domain, rather than the bZIP domain, is the photoinduced dimerization site of AureoCS. The above analysis indicates that the dimerization is the main origin of the D-change. However, if the dimerization is the only source of the D-change, the molecular size doubles and the reduction of the D-value is estimated to decrease (1/2)1/3 ∼ 1/ 1.26 times according to the Stokes−Einstein relationship. Given that the observed reduction of D (DR/DP = 1.53) is larger than this estimation, we consider that the conformation is also changed by the dimerization. To examine this possibility, the CD spectrum was measured in the dark and after blue-light illumination (Figure 3). It was found that the CD intensity decreased upon illumination suggesting that the conformation change also contributed to the D-change. Since the light induced CD change was not observed for the ZL dimer,17 this result indicates that the conformation change occurs at the same time of the dimerization. Finally, there are two possible reaction schemes for lightinduced dimer formation: the ground state monomer and

Figure 4. (a) The laser power dependence of the root square of the TG signal intensity (red squares). The solid blue line represents the fitting line with a linear function (the range for the fitting was 1.4 μJ/ mm2pulse ∼150 μJ/mm2pulse). The plot in the range of 1.4 μJ/ mm2pulse ∼17 μJ/mm2pulse is magnified in the inset. (b) The molecular diffusion signals of AureoCS obtained under various excitation pulse energies. The signals are normalized with the peak intensities of the diffusion signals. 7364


Article


Figure 5. (a) Typical TG signal after photoexcitation of AureoCS (20 μM) (red line) and of AureoCS (20 μM) with the target DNA (10 μM) (blue line). Magnified species grating signals (δnspe(t)) after the thermal grating signal at different q2 values ((b) 6.2 × 1011 m−2, (c) 1.6 × 1010 m−2, (d) 2.5 × 109 m−2). (e) Comparison of the diffusion signals of the AureoCS (red line), AureoCS with the target DNA (blue line), and AureoCS with the reference DNA (green line). The signals are normalized at the peak intensity.

dimeric form of AureoCS was dominant under a continuous blue-light illumination condition.18 Under the continuous light illumination condition, it may be reasonable to consider that most of the AureoCS becomes photoexcited. Hence, the two excited monomers can also form the dimer. However, the present measurement indicates that one photoexcited monomer is sufficient for formation of the dimer. We consider that the dimer having two photoexcited monomers under the continuous light illumination condition is produced by the photoexcitation of the dimer having one ground state monomer and one photoexcited state monomer, because the dimer formation rate is much faster than the recovery rate of the

photoexcited state. We consider that this is a case of physiological conditions in nature. The results presented in the following sections are obtained under the weak excitation energy conditions (∼20 μJ/mm2pulse); i.e., the dimer of one ground state and one photoexcited monomers. When the excitation laser power increased above 150 μJ/ mm2pulse, however, the laser power dependence deviated from the linear relation (Figure 4a), which must be due to the saturation effect. Under such conditions, the dimer of two photoexcited monomers should contribute to the diffusion signal. However, we found that the temporal profile of the diffusion signal did not depend on the laser intensity even at 7365


Article


shift is not large compared with that for AureoCS with the target DNA. This result confirms that the interaction with the target DNA is the specific interaction. Nevertheless, a small temporal shift of the diffusion signal of AureoCS with the reference DNA was observable, and this shift suggests that the reference DNA possesses a weak affinity with AureoCS, which may be a nonspecific interaction owing to the electrostatic force.33−35 For determination of the reaction kinetics, the q-dependence of the diffusion signal was analyzed. The effect of DNA on the diffusion signal became more apparent at a longer time range (Figure 5b−d). This and the above features support that the target DNA interacts with AureoCS after the photoinduced dimerization of AureoCS. We analyzed the q2-dependence of the diffusion signal based on Scheme 2, where I1, I2, and P are

the strong laser intensity (Figure 5b). This fact indicates that the diffusion sensitive conformational change as well as the dimer formation kinetics do not depend on the laser power; i.e., the kinetics and D-value of the dimer having one ground state monomer and one photoexcited monomer are very similar to those of the dimer having two photoexcited monomers. Considering the fact that the observed CD signal after the blue-light illumination (Figure 3) must represent the conformational change of the dimer having the two photoexcited monomers (because the blue-light intensity for accumulating the light state was strong (3 W)), we suggest that the secondary structure change of the dimer having one ground state monomer and one photoexcited monomer may be similar to that of the dimer having two photoexcited monomers, which was observed by the CD measurements. This finding supports the previous conclusion that the conformation change detected by the CD spectrum occurs mostly at the dimerization process. 3.3. Photoinduced Affinity of AureoCS for DNA. Based on the reaction scheme of AureoCS determined in the above section, we next investigated the photoinduced change in affinity for the target DNA in the time-domain. The TG signals for the absence and presence of the target DNA were compared under the same conditions. Figure 5 depicts the TG signals of 20 μM AureoCS, and a mixture of 20 μM AureoCS with 10 μM target DNA at various q2. There are some important points we should note. First, in the short time range (the signal of Figure 5b at q2 = 6.2 × 1011 m−2), the TG signal of AureoCS with the target DNA is almost identical to that of AureoCS without the target DNA. If the target DNA interacts with AureoCS in the dark, the molecular weight of the reactant (69 kDa = 42 kDa (DNA) + 27 kDa (AureoCS)) should be larger than that of AureoCS (27 kDa), and this change should result in the slow diffusion. However, since the decay rate of the signal, which is given by DRq2, is the same as that of the AureoCS sample without the target DNA, it is apparent that the target DNA does not interact with AureoCS in the dark. Furthermore, if the target DNA interacts with the photoexcited monomeric AureoCS before the dimerization reaction, we should observe a D-change by this interaction as a rise-decay diffusion signal at this large q2. However, the grating signal did not show any Dchange in this time range before the dimerization. Hence, we can conclude that the target DNA does not interact with the photoexcited monomeric AureoCS until the dimerization. Second, the target DNA influences the diffusion signal at a longer time range, in which the photoexcited AureoCS dimerized (Figure 5c and d); that is, the diffusion signal intensity increased and shifted to the longer time range. To clarify the origin of these features, we fit the diffusion signal of AureoCS with the target DNA after 4 s by a biexponential function (eq 2). The diffusion signal was reproduced with D of the reactant (8.1 ± 0.4) × 10−11 m2s−1, which agrees with that of AureoCS, and D of the final product (3.9 ± 0.1) × 10−11 m2s−1. Compared with DP = 5.3 × 10−11 m2s−1 obtained for the AureoCS sample without the target DNA, one should note that D of the final product becomes much smaller by the addition of the target DNA to the solution. This result is a clear indication that the target DNA interacts with the photodimerized AureoCS. To examine whether this interaction is a specific interaction, we compared the diffusion signals of AureoCS, AureoCS with the target DNA, and AureoCS with the reference DNA (Figure 5e). It is apparent that the diffusion signal of AureoCS with the reference DNA is similar to that of AureoCS, and the temporal

Scheme 2

the same states as Scheme 1, (P is the dimerized state of AureoCS), and PD indicates the final product, which represents the photoinduced dimer AureoCS interacting with the target DNA. The rate constant of k3 represents the rate constant of the binding between AureoCS dimer and the target DNA. At the same time, the target DNA contributes to the diffusion signal, because it should be a reactant of the association reaction. The analytical expression based on this scheme is presented in the Supporting Information (SI-1). For reducing the ambiguity of the fitting of the signal, we fixed some parameters during the fitting process as follows. Since the reaction until P in Scheme 2 is considered to be the same as that without the target DNA (Scheme 1), the amplitude (δnR, δnI1, δnI2, δnP), the diffusion coefficients (DR = DI1 = DI2, DP), and the rate constants (k1, k2) are fixed to those determined above from the sample without the target DNA. Furthermore, DPD should be equal to D of the final product determined from the small q2 measurement. The diffusion coefficient of the target DNA (DDNA = (6.5 ± 0.5) × 10−11 m2s−1) was measured independently by the DLS method and used for the TG analysis. We also fixed the sensitivity parameter α in eq 1 to that determined from the TG signal for the sample without the target DNA. Hence, the adjustable parameters are δnPD, δnDNA, and k3. The signals at various q2 at [DNA] = 10 μM were fitted reasonably and the rate constant of binding DNA was determined to k3 = 0.98 ± 0.5 s−1. It is interesting to note that the binding rate constant is slightly larger than that of the dimerization reaction of AureoCS (k2 = 0.52 ± 0.3 s−1). Hence, the dimerization reaction is the rate-determining step in this case. Given that the root-mean-square of the diffusion signal intensity increased almost linearly with the laser intensity in the range of 1.4−150 μJ/mm2pulse (Figure 4a), the power of excitation used here (20 μJ/mm2pulse) was much weaker than the saturation intensity. Hence, the number of photoexcited AureoCS upon excitation with a laser power of 20 μJ/mm2pulse should be much less than the initial concentration of AureoCS (20 μM). Therefore, [DNA] (=10 μM) in the above experiment should be an excess amount compared with the concentration of the dimerized AureoCS. Under these conditions, the unidirectional reaction of P → PD in Scheme 2 seems to be reasonable. However, we found that the diffusion signal intensity increased with increasing [DNA] even at a 7366


Article

The Journal of Physical Chemistry B longer time range (i.e., under a very small q2 condition) compared with the dimerization reaction rate (Figure 6). This

x=

k −3 k i3[DNA] + k −3

(7)

The concentration dependent signal was analyzed by eq (S5) with adjustable parameters of δnP, δnDNA, ki3, k−3, and D0PD. The signal was reasonably well reproduced with the parameters of ki3 = (7.7 ± 1.0) × 104 M−1 s−1, k−3 = 0.26 ± 0.10 s−1, and D0PD = (3.7 ± 0.4) × 10−11 m2s−1. The value of D0PD is reasonable for the complex of AureoCS dimer and DNA (96 kDa) compared with other proteins of similar size: 4.7 × 10−11 m2s−1 for conalbumin (75 kDa),36 4.5 × 10−11 m2s−1 for gonadotropin (99 kDa),37 and 4.3 × 10−11 m2s−1 for collagenase (109 kDa).37 The slightly smaller value for D0PD, compared with those of the reported proteins of similar size, may arise from the conformational change observed for the dimeric AureoCS (see above) and/or the nonspherical shape of the AureoCS dimer and DNA complex. The dissociation constant of the light state Kd was determined to be (3.4 ± 1.4) μM from ki3 and k−3. It is worth noting that the intrinsic bimolecular rate constant of the association of AureoCS and DNA (ki3 = 7.7 × 104 M−1 s−1) is almost 3-times larger than that of the dimerization of AureoCS (ki2 = 2.8 × 104 M−1 s−1). This result indicates that the rate-determining step in Scheme 2 is protein dimerization, and the recognition of the target DNA sequence is faster. The reaction scheme and the kinetics of the light induced dimerization and DNA binding of AureoCS is depicted in Figure 7.

Figure 6. Diffusion signals measured at various concentrations of the target DNA. The concentrations are indicated by the legend in the figure.

result implies that not all photodimerized AureoCS bind with the DNA, but the binding is partial. This result indicates that the P → PD process is not actually unidirectional, but P and PD are in equilibrium as shown in Scheme 3, where ki3 is the Scheme 3

■

DISCUSSION The bZIP domain interacts with the target DNA, usually as the dimer in many cases.7−10,38 Whether bZIP proteins dimerize after binding with the target DNA or before the binding has previously been investigated. For example, it was reported that bZIP proteins of CREB and GCN4 bind with DNA in a monomeric form and then dimerize.39−42 However, the dimerization site of AureoCS after photoexcitation seems to be the LOV domain rather than the bZIP domain, because the second-order rate constant of the dimerization was similar to that of the isolated LOV domain. Furthermore, AureoCS does not form the dimer before photoexcitation. Therefore, from these observations, we consider that the interaction between bZIP domains of AureoCS are weak, and the dimerization of the LOV domain has the role of keeping the bZIP domains

second-order rate constant and k−3 is the rate constant for the reverse reaction. To take this equilibrium into account, we analyzed the [DNA] dependent signal by assuming: k 3 = k i3[DNA] + k −3

(5)

And 0 DPD = xDP + (1 − x)DPD

(6)

0 DPD

where is D of the photoinduced dimer AureoCS interacting with the target DNA and (1-x) is the fraction of this species. The fraction of x is given by

Figure 7. Reaction scheme and the kinetics of the light induced dimerization and DNA binding of AureoCS. The modeled structures are constructed by using crystal structures of LOV domain of Pt-Aureo1 (Protein Data Bank entry 4DKL) and bZIP domain of CREB (Protein Data Bank entry 1DH3). 7367


Article


the secondary structure changes in the light state. Additionally, in case of wild-type ZL (the construct containing bZIP domain and LOV domain), the change in CD spectrum upon illumination was negligible, possibly because the construct exists as a dimer even in the dark state.17,22 On the basis of these findings, the secondary structural change should be caused by the dimerization reaction and this structural rearrangement may also be related to the DNA binding. It is rather surprising to note that although the difference in the base pair between the reference and target DNA used in this study is very minor (∼9% base pairs in the total base pairs), a large difference was observed in the diffusion signal even after 1 s (Figure 5e); that is, it is faster than the rate constant of the rate-determining dimerization reaction (k2 = (1.9 s)−1). This result indicates that the searching speed for the specific sequence in the DNA is rather fast. We propose that the nonspecific electrostatic interaction, which was observed as the weak binding with the reference DNA, may play a role in the efficient searching for the target DNA strand.44,45

close together. After forming the dimer at the LOV domain sites, the bZIP domains form a stable dimer by the interaction with the target DNA. This scheme may be consistent with the kinetic model that the bZIP domain dimerizes using the interaction with the DNA. It was previously reported that Aureo-LOV exists in equilibrium between the monomer and dimer in the dark.17,23 On the contrary, AureoCS dominantly exists as the monomer under our experimental condition in the dark, and is dimerized upon photoillumination. These two findings suggest that the dimerization site of the LOV domain in the dark is blocked by the bZIP domain to inhibit dimer formation in the dark. This raises the question if the dimer site is blocked, how can AureoCS form the dimer after photoexcitation? There may be two possible explanations for the photoinduced dimerization of the LOV domain of AureoCS. First, the dimerization site that was blocked by the bZIP domain (closed form) may be exposed by the blue light illumination (opened form) and AureoCS is dimerized at this dimerization site, which is the same site as the dimerization site in the dark. However, we found that dimerization occurs between photoexcited AureoCS and AureoCS in the dark. Hence, the dimerization site in the dark is still blocked in one of the AureoCS monomers, and the above possibility may be less plausible. Considering the former report that stated AureoCS is in equilibrium between monomer and dimer even in the dark,23 the blocking of the dimerization site of the LOV domain may not be perfect owing to a kind of fluctuation. In this case, the photoexcited AureoCS can bind the less populated opened form of the dark-adapted AureoCS, but this model is unlikely, because the dimerization rate should be slower than that of the only LOV domain. Second, if the dimerization site in the dark is different from that in the light and the light-induced conformation change in the LOV domain enhances the interprotein interaction with the LOV domain of the AureoCS, the observations can be consistently explained. Hence, we consider that the latter possibility, where the dimerization site in the dark is different from that in the light, is more plausible. The volume change observed prior to the dimerization reaction should be a triggering process to enhance the interaction between two LOV domains. In the case of Aureochrome 1a from Phaeodactylum tricornutum (Pt-Aureo1a), although the two Cys residues (C162 and C182 in Vf-Aureo1) are not conserved, it has been reported that the dimeric form is dominant both in the dark and light.19,43 In the dark-adapted dimeric form, the LOV and bZIP domains interact with each other directly to inhibit the DNA binding.19 Light illumination induces the dissociation of the LOV domain from the bZIP domain and the subsequent LOV-LOV dimerization. This LOV-LOV dimerization results in increased structural dynamics of the bZIP domain which enhances the affinity of Pt-Aureo1a for its target DNA.19 Another model has recently been reported for Pt-Aureo1a where the LOV-LOV interaction is strong enough in the dark to form the dimer. In this case, light illumination induces a domain movement which stiffens the bZIP dimer by elongation of the helical structure of the bZIP region and enhances DNA binding.43 Although these models are different from our model, where the photoinduced intermolecular dimerization is relevant for the DNA binding, the structural perturbation on the bZIP domain might be conserved for Vf-Aureo1, because the reduction of D (DR/DP = 1.53) is larger than the estimation based on the volume change associated with the dimerization (DR/DP = 1.26). The CD intensity change also indicates that

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jpcb.6b05760. Analytical expression for the temporal profile of the TG signal of Scheme 2 (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Telephone: +81-75-753-4026; E-mail: mterazima@kuchem. kyoto-u.ac.jp. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Grant-in-Aid for Scientific Research (25288005), and the Grant-in-Aid for Scientific Research on Innovative Areas (research in a proposed research area) (20107003, 25102004) from the Ministry of Education, Science, Sports, and Culture in Japan (to MT.).

■

REFERENCES

(1) Takahashi, F.; Yamagata, D.; Ishikawa, M.; Fukamatsu, Y.; Ogura, Y.; Kasahara, M.; Kiyosue, T.; Kikuyama, M.; Wada, M.; Kataoka, H. AUREOCHROME, a Photoreceptor Required for Photomorphogenesis in Stramenopiles. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (49), 19625−19630. (2) Takahashi, F. Blue-Light-Regulated Transcription Factor, Aureochrome, in Photosynthetic Stramenopiles. J. Plant Res. 2016, 129 (2), 189−197. (3) Deng, Y.; Yao, J.; Fu, G.; Guo, H.; Duan, D. Isolation, Expression, and Characterization of Blue Light Receptor AUREOCHROME Gene From Saccharina Japonica (Laminariales, Phaeophyceae). Mar. Biotechnol. 2014, 16 (2), 135−143. (4) Huysman, M. J. J.; Fortunato, A. E.; Matthijs, M.; Costa, B. S.; Vanderhaeghen, R.; Van den Daele, H.; Sachse, M.; Inzé, D.; Bowler, C.; Kroth, P. G.; et al. AUREOCHROME1a-Mediated Induction of the Diatom-Specific Cyclin dsCYC2 Controls the Onset of Cell Division in Diatoms (Phaeodactylum Tricornutum). Plant Cell 2013, 25 (1), 215−228. (5) Bowler, C.; Allen, A. E.; Badger, J. H.; Grimwood, J.; Jabbari, K.; Kuo, A.; Maheswari, U.; Martens, C.; Maumus, F.; Otillar, R. P.; et al. The Phaeodactylum Genome Reveals the Evolutionary History of Diatom Genomes. Nature 2008, 456 (7219), 239−244.

7368


Article

The Journal of Physical Chemistry B (6) Vinson, C. R.; Hai, T.; Boyd, S. M. Dimerization Specificity of the Leucine Zipper-Containing bZIP Motif on DNA Binding: Prediction and Rational Design. Genes Dev. 1993, 7 (6), 1047−1058. (7) Vinson, C. R.; Sigler, P. B.; McKnight, S. L. Scissors-Grip Model for DNA Recognition by a Family of Leucine Zipper Proteins. Science 1989, 246 (4932), 911−916. (8) Landschulz, W. H.; Johnson, P. F.; McKnight, S. L. The Leucine Zipper: A Hypothetical Structure Common to a New Class of DNA Binding Proteins. Science 1988, 240 (4860), 1759−1764. (9) Fujii, Y.; Shimizu, T.; Toda, T.; Yanagida, M.; Hakoshima, T. Structural Basis for the Diversity of DNA Recognition by bZIP Transcription Factors. Nat. Struct. Biol. 2000, 7 (10), 889−893. (10) Schütze, K.; Harter, K.; Chaban, C. Post-Translational Regulation of Plant bZIP Factors. Trends Plant Sci. 2008, 13, 247−255. (11) Grusch, M.; Schelch, K.; Riedler, R.; Reichhart, E.; Differ, C.; Berger, W.; Inglés-Prieto, A.; Janovjak, H. Spatio-Temporally Precise Activation of Engineered Receptor Tyrosine Kinases by Light. EMBO J. 2014, 33 (15), 1713−1726. (12) Mitra, D.; Yang, X.; Moffat, K. Crystal Structures of aureochrome1 LOV Suggest New Design Strategies for Optogenetics. Structure 2012, 20 (4), 698−706. (13) Swartz, T. E.; Corchnoy, S. B.; Christie, J. M.; Lewis, J. W.; Szundi, I.; Briggs, W. R.; Bogomolni, R. A. The Photocycle of a FlavinBinding Domain of the Blue Light Photoreceptor Phototropin. J. Biol. Chem. 2001, 276 (39), 36493−36500. (14) Kottke, T.; Heberle, J.; Hehn, D.; Dick, B.; Hegemann, P. PhotLOV1: Photocycle of a Blue-Light Receptor Domain from the Green Alga Chlamydomonas Reinhardtii. Biophys. J. 2003, 84 (2), 1192− 1201. (15) Schleicher, E.; Kowalczyk, R. M.; Kay, C. W. M.; Hegemann, P.; Bacher, A.; Fischer, M.; Bittl, R.; Richter, G.; Weber, S. On the Reaction Mechanism of Adduct Formation in LOV Domains of the Plant Blue-Light Receptor Phototropin. J. Am. Chem. Soc. 2004, 126 (35), 11067−11076. (16) Schüttrigkeit, T. A.; Kompa, C. K.; Salomon, M.; Rüdiger, W.; Michel-Beyerle, M. E. Primary Photophysics of the FMN Binding LOV2 Domain of the Plant Blue Light Receptor Phototropin of Avena Sativa. Chem. Phys. 2003, 294 (3), 501−508. (17) Toyooka, T.; Hisatomi, O.; Takahashi, F.; Kataoka, H.; Terazima, M. Photoreactions of Aureochrome-1. Biophys. J. 2011, 100 (11), 2801−2809. (18) Hisatomi, O.; Nakatani, Y.; Takeuchi, K.; Takahashi, F.; Kataoka, H. Blue Light-Induced Dimerization of Monomeric Aureochrome-1 Enhances Its Affinity for the Target Sequence. J. Biol. Chem. 2014, 289 (25), 17379−17391. (19) Heintz, U.; Schlichting, I. Blue Light-Induced LOV Domain Dimerization Enhances the Affinity of Aureochrome 1a for Its Target DNA Sequence. eLife 2016, 5, e11860. (20) Herman, E.; Sachse, M.; Kroth, P. G.; Kottke, T. Blue-LightInduced Unfolding of the Jα Helix Allows for the Dimerization of Aureochrome-LOV from the Diatom Phaeodactylum Tricornutum. Biochemistry 2013, 52 (18), 3094−3101. (21) Herman, E.; Kottke, T. Allosterically Regulated Unfolding of the A′α Helix Exposes the Dimerization Site of the Blue-Light-Sensing Aureochrome-LOV Domain. Biochemistry 2015, 54 (7), 1484−1492. (22) Hisatomi, O.; Takeuchi, K.; Zikihara, K.; Ookubo, Y.; Nakatani, Y.; Takahashi, F.; Tokutomi, S.; Kataoka, H. Blue Light-Induced Conformational Changes in a Light-Regulated Transcription Factor, Aureochrome-1. Plant Cell Physiol. 2013, 54 (1), 93−106. (23) Nakatani, Y.; Hisatomi, O. Molecular Mechanism of Photozipper, a Light-Regulated Dimerizing Module Consisting of the bZIP and LOV Domains of Aureochrome-1. Biochemistry 2015, 54 (21), 3302−3313. (24) Nada, T.; Terazima, M. A Novel Method for Study of Protein Folding Kinetics by Monitoring Diffusion Coefficient in Time Domain. Biophys. J. 2003, 85 (3), 1876−1881. (25) Nishida, S.; Nada, T.; Terazima, M. Kinetics of Intermolecular Interaction during Protein Folding of Reduced Cytochrome C. Biophys. J. 2004, 87 (4), 2663−2675.

(26) Terazima, M. Time-Dependent Intermolecular Interaction during Protein Reactions. Phys. Chem. Chem. Phys. 2011, 13 (38), 16928−16940. (27) Terazima, M. Diffusion Coefficients as a Monitor of Reaction Kinetics of Biological Molecules. Phys. Chem. Chem. Phys. 2006, 8 (5), 545−557. (28) Nakasone, Y.; Eitoku, T.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Kinetic Measurement of Transient Dimerization and Dissociation Reactions of Arabidopsis Phototropin 1 LOV2 Domain. Biophys. J. 2006, 91 (2), 645−653. (29) Eitoku, T.; Nakasone, Y.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Conformational Dynamics of Phototropin 2 LOV2 Domain with the Linker upon Photoexcitation. J. Am. Chem. Soc. 2005, 127 (38), 13238−13244. (30) Tanaka, K.; Nakasone, Y.; Okajima, K.; Ikeuchi, M.; Tokutomi, S.; Terazima, M. Light-Induced Conformational Change and Transient Dissociation Reaction of the BLUF Photoreceptor Synechocystis PixD (Slr1694). J. Mol. Biol. 2011, 409 (5), 773−785. (31) Nakasone, Y.; Eitoku, T.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Dynamics of Conformational Changes of Arabidopsis Phototropin 1 LOV2 with the Linker Domain. J. Mol. Biol. 2007, 367 (2), 432−442. (32) Nakasone, Y.; Zikihara, K.; Tokutomi, S.; Terazima, M. Photochemistry of Arabidopsis Phototropin 1 LOV1; Transient Tetramerization. Photochem. Photobiol. Sci. 2013, 12, 1171−1179. (33) Lohman, T. M.; DeHaseth, P. L.; Record, M. T. PentalysineDeoxyribonucleic Acid Interactions: A Model for the General Effects of Ion Concentrations on the Interactions of Proteins with Nucleic Acids. Biochemistry 1980, 19 (15), 3522−3530. (34) Privalov, P. L.; Dragan, A. I.; Crane-Robinson, C. Interpreting protein/DNA Interactions: Distinguishing Specific from Non-Specific and Electrostatic from Non-Electrostatic Components. Nucleic Acids Res. 2011, 39 (7), 2483−2491. (35) Metallo, S. The Role of a Basic Amino Acid Cluster in Target Site Selection and Non- Specific Binding of bZIP Peptides to DNA. Nucleic Acids Res. 1997, 25 (15), 2967−2972. (36) Rabbani, G.; Ahmad, E.; Zaidi, N.; Khan, R. H. pH-Dependent Conformational Transitions in Conalbumin (Ovotransferrin), a Metalloproteinase from Hen Egg White. Cell Biochem. Biophys. 2011, 61 (3), 551−560. (37) Freitas, R. A., Jr. Nanomedicine, Vol. I: Basic Capabilities; Landes Bioscience: Texas, U. S. A., 1999. (38) Ellenberger, T. E.; Brandl, C. J.; Struhl, K.; Harrison, S. C. The GCN4 Basic Region Leucine Zipper Binds DNA as a Dimer of Uninterrupted α Helices: Crystal Structure of the Protein-DNA Complex. Cell 1992, 71 (7), 1223−1237. (39) Berger, C.; Piubelli, L.; Haditsch, U.; Rudolf Bosshard, H. Diffusion-Controlled DNA Recognition by an Unfolded, Monomeric bZIP Transcription Factor. FEBS Lett. 1998, 425 (1), 14−18. (40) Cranz, S.; Berger, C.; Baici, A.; Jelesarov, I.; Bosshard, H. R. Monomeric and Dimeric bZIP Transcription Factor GCN4 Bind at the Same Rate to Their Target DNA Site. Biochemistry 2004, 43 (3), 718−727. (41) Kohler, J. J.; Metallo, S. J.; Schneider, T. L.; Schepartz, a. DNA Specificity Enhanced by Sequential Binding of Protein Monomers. Proc. Natl. Acad. Sci. U. S. A. 1999, 96 (21), 11735−11739. (42) Metallo, S. J.; Schepartz, A. Certain bZIP Peptides Bind DNA Sequentially as Monomers and Dimerize on the DNA. Nat. Struct. Biol. 1997, 4 (2), 115−117. (43) Banerjee, A.; Herman, E.; Serif, M.; Maestre-Reyna, M.; Hepp, S.; Pokorny, R.; Kroth, P. G.; Essen, L. O.; Kottke, T. Allosteric Communication between DNA-binding and Light-responsive Domains of Diatom Class I Aureochromes. Nucleic Acids Res. 2016, 44, 5957. (44) Berg, O. G.; Winter, R. B.; Von Hippel, P. H. Diffusion-Driven Mechanisms of Protein Translocation on Nucleic Acids. 1. Models and Theory. Biochemistry 1981, 20 (24), 6929−6948. 7369


Article

The Journal of Physical Chemistry B (45) Esadze, A.; Iwahara, J. Stopped-Flow Fluorescence Kinetic Study of Protein Sliding and Intersegment Transfer in the Target DNA Search Process. J. Mol. Biol. 2014, 426 (1), 230−244.

7370


Time-Resolved Detection of Light-Induced Dimerization of Monomeric

Recommend Documents