Universal mRNA Translation Enhancement with Gold Nanoparticles

Subscriber access provided by Universitaetsbibliothek | Johann Christian Senckenberg

Article

Universal mRNA Translation Enhancement with Gold Nanoparticles Conjugated to Oligonucleotides with a Poly(T) Sequence Kian Ping Chan, Sheng-Hao Chao, and James Chen Yong Kah ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b16390 • Publication Date (Web): 24 Jan 2018 Downloaded from http://pubs.acs.org on January 27, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Universal mRNA Translation Enhancement with Gold Nanoparticles Conjugated to Oligonucleotides with a Poly(T) Sequence

Kian Ping Chan1,2,3, Sheng-Hao Chao2,4*, James Chen Yong Kah1,3*

K. P. Chan 1 NUS Graduate School for Integrative Sciences and Engineering, Centre for Life Sciences (CeLS), #05-01, 28 Medical Drive, Singapore 117456 J. C. Y. Kah 1 NUS Graduate School for Integrative Sciences and Engineering, Centre for Life Sciences (CeLS), #05-01, 28 Medical Drive, Singapore 117456 3

Department of Biomedical Engineering, National University of Singapore, 4 Engineering Drive 3, Blk E4, #04-08, Singapore 117583 E-mail: [email protected]

S.-H. Chao 2 Bioprocessing Technology Institute, Agency for Science, Technology and Research, Singapore, 20 Biopolis Way, #06-01 Centros, Singapore 138668 E-mail: [email protected] 4

Department of Microbiology and Immunology, National University of Singapore, 5 Science Drive 2, Blk MD4, Level 3, Singapore 117597 Keywords: gold nanoparticles, oligonucleotides, mRNA translation, protein synthesis, cellfree systems

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract DNA conjugated gold nanoparticles (AuNPs) have been shown to enhance the translation of mRNA. However, the specific sequence on the DNA dictates the specific mRNA to be enhanced. This study describes poly(thymine) functionalized AuNPs (AuNP-p(T)DNA) that is capable of enhancing the translation of any mRNA templates that are incorporated into pcDNA6 vector with BGH polyadenylation signal (P(A)). We demonstrated this by incorporating four genes: green fluorescence protein (GFP), general control nonderepressible 5 (GCN5), cAMP responsive element binding protein 1 (CREB1) and X-box binding protein 1-spliced (XBP-1S) separately into pcDNA6 vector with BGH P(A) before their expression in HeLa lysate. The addition of AuNP-p(T)DNA to HeLa lysate containing GFP, GCN5, CREB1, and XBP-1S mRNA increased protein synthesis by 1.80, 1.99, 1.95 and 2.20-fold respectively. Similar translation enhancement was also observed in a multiplex reaction containing the mRNA of three genes together in the lysate. Complementary p(T)DNA hybridization to the poly(A) tail of the mRNA was critical as removal of p(T)DNA or BGH P(A) in XBP-1S mRNA, or replacement of p(T)DNA with p(A)DNA reduced the translation back to baseline level. Lastly, an optimum length of 25 nucleotides for the DNA oligomer and a AuNP-p(T)DNA:mRNA ratio of 0.658 achieved a 3.08-fold translation enhancement. The AuNP-p(T)DNA nanoconstruct could be incorporated into commercial cell-free protein synthesis kits as a universal translation enhancer.


Page 2 of 26

Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Cell-free protein synthesis has emerged as an attractive alternative to synthesize protein compared to traditional cell-based method since the pioneering work by Nirenberg and Matthaei found that whole cell integrity was not necessary for protein synthesis and that crude cell lysate extract was sufficient 1. Cell-free method enables direct manipulation of reaction conditions, use of non-natural amino acids, promotion of favorable protein folding 2, and high-throughput protein production 3-6. In addition, cell-free method permits the sole study of mRNA translation process by uncoupling the mRNA translation step from the preceding gene transcription 7. Arising from this, many studies have sought to optimize the cell-free protein synthesis method through fine tuning key reaction conditions including pH and temperature, and reacting components such as amino acids and proteins translation machinery to achieve a yield greater than milligram level of protein per millilitre 8. The use of nanotechnology showed promise in further improving the yield of protein synthesis since DNA conjugated gold nanoparticles (AuNP-DNA) was capable of modulating protein synthesis through delivery of antisense DNA 9, pro-apoptotic BAX mRNA

10

and apoptosis-inducing BIM

protein 11. Indeed, we and other groups have recently incorporated nanotechnology into cellfree system to achieve an even higher protein yield. By conjugating DNA oligonucleotide with specific sequence to gold nanoparticles (AuNP-DNA), we made use of the non-specific adsorption of cellular translation machinery on AuNPs and hybridization between the oligonucleotide and mRNA to create focal points of high concentrations of mRNA translation components that enhanced the efficiency of protein synthesis up to 2-fold in both rabbit reticulocyte lysate 12-13 and HeLa lysate 14. Gold nanoparticles (AuNPs) were used due to their ease of conjugation to thiol-terminated DNA

15-17

, their cellular biocompatibility and good

colloidal stability of AuNP-DNA in biological environment 18-19.



However, the existing AuNP-DNA nanoconstruct requires a unique DNA oligomer that binds specifically to their respective mRNA template for the synthesis of a particular protein of interest to be enhanced. This means that a different oligonucleotide has to be designed and introduced to cell-free systems to separately enhance the mRNA translation of each different protein. The selection, design and evaluation of a specific oligonucleotide for each protein is tedious and hence non-efficient for multi-protein synthesis. In this study, we examined the use of poly(A) tails present universally in all mRNAs as the recognition site for AuNPs conjugated to oligonucleotides with a poly(T) sequence (AuNPp(T)DNA), that would allow AuNP-p(T)DNA to enhance translation of any mRNA templates in cell-free systems. To ensure the consistent synthesis of a long poly(A) tail, we used a BGH polyadenylation signal (P(A)) that would incorporate a chain of 200 to 250 adenine nucleotides

20

at the end of inserted mRNA templates during transcription. We hypothesized

that all mRNA templates with a poly(A) tail could hybridize to the poly(T) DNA oligomers on AuNP-p(T)DNA to enhance their protein synthesis in vitro (Figure 1).


Page 4 of 26

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic showing the use of AuNP-p(T)DNA in enhancing the translation of different mRNA templates. Genes of interest were inserted separately into pcDNA6 plasmid vector containing BGH polyadenylation (P(A)) signal and transcribed to produce respective mRNA templates with a poly(A) tail. AuNP-p(T)DNA was added to mRNA templates to allow hybridization between poly(T) oligonucleotide on AuNP and poly(A) tail on the mRNA, which facilitated the increased production of respective proteins.

We demonstrated universal enhancement in the mRNA translation of four different genes using the same AuNP-p(T)DNA without changing the DNA oligonucleotide sequence: Green Fluorescence Protein (GFP) and three endogenous human genes, general control nonderepressible 5 (GCN5)

21-22

, CAMP responsive element binding protein 1 (CREB1)

and X-box binding protein 1-spliced (XBP-1S)

24-25

23

. The cDNAs of four selected genes were

cloned into pcDNA6 plasmid which contained a BGH P(A) for transcription of a stable and long poly(A) tail. We observed close to 2-fold enhancement of protein synthesis with AuNPp(T)DNA, which dropped back to baseline protein synthesis level on removal of either p(T)DNA oligomers on AuNP or BGH P(A) from the gene of interest, or replacement of p(T)DNA by p(A)DNA. The outcome of this study showed that the AuNP-p(T)DNA conjugate could be useful as an additive to cell-free protein synthesis systems to universally enhance the in vitro translation of any mRNAs of interest.

Results and Discussion RNA gel electrophoresis of mRNA templates A jellyfish gene (GFP) and three endogenous human genes (GCN5, CREB1, and XBP-1S) were selected as model genes in our study. These genes were chosen to cover a range of mRNA sizes from 960 bps (GFP) to 2,823 bps (GCN5) and a respective protein size of 27 kDA to 94 kDa (Figure 2a). All genes were cloned into pcDNA6 plasmid vector before BGH 5 ACS Paragon Plus Environment


P(A) and transcribed to produce respective mRNA templates. All mRNA transcribed were verified using RNA gel electrophoresis which showed a band corresponding to their expected mRNA size (Figure 2b, red arrows). We noted also that the termination of transcription could proceed past BGH P(A), thus showing a secondary mRNA template that corresponded to non-terminated mRNA in the RNA gel (Figure 2b, yellow arrow). The size of these bands also matched the predicted length of non-terminated mRNA. Since DNase treatment was performed after transcription and together with a low initial concentration of DNA templates compared to mRNA products, it was unlikely that the larger band corresponded to DNA templates.

Figure 2. (a) List of genes inserted into pcDNA6 plasmid vector and their respective mRNA and protein sizes. Information on predicted length of non-terminated mRNA, expected mRNA size and expected protein size for all genes was presented. (b) All mRNA synthesized was 6 ACS Paragon Plus Environment

Page 6 of 26

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


subjected to RNA gel electrophoresis and mRNA size determined based on band migration (red arrow) agreed with their respective expected mRNA size (gene size plus 200 bases of adenine). A secondary bright band (yellow arrow) was also present that corresponded to nonterminated transcription of linearized DNA templates.

The presence and accessibility of poly(A) tail in the mixed population of mRNA samples was further verified by performing reverse transcription on synthesized mRNA using poly(T) primers, followed by PCR (RT-PCR). The same primers used for cloning were used to amplify the gene of interest from start to stop codon. A distinct bright band corresponding to respective gene size obtained from RT-PCR of their mRNA template suggested successful reverse transcription; a result of hybridization between poly(A) tail and poly(T) DNA primer (See Supporting Information, Figure S1). Furthermore, all mRNA template sizes determined from RNA ladder (Figure 2B) had approximately 200 more bases compared to their respective gene size determined from DNA ladder (Figure S1), indicating the presence of poly(A) tail.

Characterization of DNA conjugated AuNPs The citrate-capped AuNPs synthesized were monodispersed, isolated and had an average diameter of 10.8 ± 0.05 nm as determined from TEM images (Figure 3a). The UV-vis absorption spectrum of AuNPs showed a peak absorption at 520 nm, with negligible peak broadening after conjugation to p(T)DNA of different lengths (Figure 3b), indicating colloidal stability of AuNP-p(T)DNA.



Figure 3. Characterization of synthesized citrate-capped AuNPs conjugated to 15, 25 and 35 nucleotides of thymine (AuNP-p(T)DNA). (a) TEM image of synthesized citrate-capped AuNPs. (b) UV-vis spectrum of AuNP and AuNP-p(T)DNA normalized at 400 nm showed an absorbance peak of 520 nm. (c) Hydrodynamic dimeter, DH of AuNPs and AuNP-p(T)DNA measured from dynamic light scattering (DLS) showed a rightward shift in histogram profile with longer p(T)DNA, indicating increasing DH with p(T)DNA size. (d) An increase in average DH measured from DLS was observed for 15p(T)DNA (17.23 ± 0.63nm), 25p(T)DNA (21.76 ± 0.24nm) and 35p(T)DNA (28.06± 0.66nm), as expected from a longer chain of nucleotides. (e) All samples measured had a negative zeta potential, ζ due to negatively charged citrate or p(T)DNA. (f) A similar number of p(T)DNA per AuNP (~85) was obtained for all AuNP-p(T)DNA samples.


Page 8 of 26

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Dynamic light scattering (DLS) measurement of AuNPs and AuNP-p(T)DNA showed an increase (right shift) in size histogram profile of AuNP-p(T)DNA compared to AuNPs (Figure 3c). There was also a right shift in size histogram for AuNPs conjugated to increasing length of p(T)DNA. This was reflected as an increase in average hydrodynamic diameter, DH: AuNP-15p(T)DNA (17.23 ± 0.63nm), AuNP-25p(T)DNA (21.76 ± 0.24nm) and AuNP35p(T)DNA (28.06 ± 0.66nm) (Figure 3d). The absence of large aggregates in the DLS size histogram further indicated a stable AuNP-p(T)DNA colloid. Both AuNPs and AuNPp(T)DNA had negative zeta potential, ζ due to the surface coating of negatively charged citrate and DNA respectively (Figure 3e). The number of p(T)DNA per AuNP were quantified and found to be 84.8 ± 2.2 (15p(T)DNA), 82.1 ± 2.1 (25p(T)DNA) and 89.2 ± 3.9 (35p(T)DNA) (Figure 3f), comparable to that reported by others

26

, with no statistically

significant difference in the number of p(T)DNA conjugated between different length of p(T)DNA (one-way ANOVA (F(3, 11) = 1.563, p = 0.2614). This was unlike that reported previously where an inverse correlation between DNA density and DNA length (12-mer and 44-mer) was observed

19

. A longer DNA strand comprising multiple nucleotides could

potentially wrap the surface of AuNPs due to multiple contact points of non-specific adsorption between the nucleotides and gold surface, thus decreasing the DNA loading density. Here, the DNA oligomer in our study comprised only of thymine, which was reported to have the least adsorption energy to gold surface 27, thus reducing the tendency of poly(T) to wrap around the surface of AuNPs. The reduced non-specific adsorption in poly(T) therefore allowed for similar DNA loading density between different chain lengths.

Enhancement of mRNA translation with AuNP-p(T)DNA as a universal enhancer The addition of 5 nM of AuNP-25p(T)DNA to 1 µg of mRNA templates terminated with a long poly(A) tail in HeLa lysate led to an enhanced mRNA translation in all four genes of interest in this study, while retaining the colloidal stability of AuNP-25p(T)DNA in HeLa 9 ACS Paragon Plus Environment


lysate with no visible precipitate. An enhancement factor of 1.80, 1.99, 1.95 and 2.20-fold relative to baseline mRNA translation were observed for GFP, GCN5, CREB1 and XBP-1S, respectively in the presence of AuNP-25p(T)DNA (Figure 4, blue bar). In comparison, AuNPs alone (Figure 4, grey bar) produced similar protein levels with no statistically significant difference as mRNA only control (Figure 4, white bar) for all four genes. We noted that other mRNAs already present in the lysate could also bind to AuNP25p(T)DNA. However, the majority of the mRNA inside the HeLa lysate were exogenously added and served as the main target for AuNP-DNA. Furthermore, translation enhancement was shown to be unaffected by the presence of other mRNA (Figure 5).

Figure 4. Enhanced mRNA translation for all four proteins with AuNP-25p(T)DNA. (a-d) Western blot images showing the qualitative amount of proteins synthesized in HeLa lysate with the addition of AuNPs or AuNP-25p(T)DNA compared to a control without AuNPs. (e) Quantitative analysis of protein synthesized based on Western blot images with ImageJ showed a significant mRNA translation enhancement with AuNP-25p(T)DNA compared to control without p(T)DNA and AuNPs. *One-tail t test, p < 0.01, N = 4 (GFP), N = 5 (GCN5 & CREB1), N = 6 (XBP-1S). 10 ACS Paragon Plus Environment

Page 10 of 26

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The presence of p(T)DNA oligomers was shown to be crucial for translation enhancement, likely due to successful recruitment of mRNA templates by hybridization to their poly(A) tail. The requirement for hybridization was demonstrated in our previous work

14

. This universal

enhancement observed in the four different genes using a single AuNP-25p(T)DNA nanoconstruct hybridizing to the poly(A) tail was unlike those previously reported where 5’Kozak region

12

or 3’-UTR

14

was chosen as gene-specific hybridization site to enhance the

translation of a unique gene. Despite the different hybridization site, similar enhancement level was obtained not only for a reporter gene (GFP), but also endogenous human genes (GCN5, CREB1, XBP-1S). Although Park et al. previously reported that poly(T) DNA oligomers did not have an effect on translation of mCherry mRNA 13, we believed that the P(A) signal used in our study may play an important role in enhancing the translation. Since BGH P(A) was shown to be twice as effective as SV40 P(A) 28, it is plausible that transcribed mRNA with BGH P(A) had a higher population of mRNA carrying poly(A) tail that was able to hybridize to p(T)DNA compared to mRNA with SV40 P(A). This universal enhancer using AuNP-25p(T)DNA also performed equally well for mRNA templates of different sizes. There was no statistically significant difference between the enhancement factor using AuNP-25p(T)DNA for genes as small as 960 bps (GFP) to 1400 bps (CREB1 and XBP-1S) to 2800 bps (GCN5) (one-way ANOVA (F(4, 18) = 2.627, p = 0.0884). In a typical mRNA translation, a longer mRNA may pose a problem for quick recycling of ribosomes due to a longer distance between initiation and termination site. However, in our AuNP-p(T)DNA nanoconstruct, mRNA would hybridize to p(T)DNA oligomers on AuNPs’ surface and create a dense localized concentration of mRNA around the AuNPs to facilitate quick recycling of ribosomes from one mRNA to another. Therefore, we observed little effect of mRNA size on the translation enhancement. 11 ACS Paragon Plus Environment


The universal enhancer AuNP-25p(T)DNA was not only capable of enhancing the translation of individual mRNA, it was also able to simultaneously translate multiple mRNAs at similar enhancement levels as single mRNA in a multiplex reaction containing a mixture of three mRNAs: GFP, GCN5 and XBP-1S mRNA together in the lysate. We observed a 1.65fold, 2.21-fold and 1.99-fold enhancement in translation of GFP, GCN5 and XBP-1S mRNA respectively relative to baseline mRNA translation for each gene (Figure 5, blue bar). The different in enhancement level compared to a single population of mRNA used was small. The co-translation of three mRNA simultaneous increased the complexity of the translation system with potential cross hybridization between different types of mRNA to result in such small variations in the level of translation enhancement. Nonetheless, the outcome demonstrated the robustness of AuNP-p(T)DNA for multiplex translation enhancement, which might benefit high-throughput transcriptomics and proteomics studies.

Figure 5. Simultaneous co-translation of multiple mRNA in HeLa lysate retained similar enhancement level as individual mRNA when incubated with AuNP-25p(T)DNA. (a) Western blot image showed the co-expression level of GFP, GCN5 and XBP-1S upon incubation with AuNP and AuNP-25p(T)DNA. (b) The Western blot image was quantified using ImageJ and a significant translation enhancement was observed for all three genes with AuNP25p(T)DNA and not AuNP. *One-tail t test, p < 0.05, N = 3.


Page 12 of 26

Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Disruption of hybridization between poly(T)DNA and poly(A)-tail eliminated XBP-1S mRNA translation enhancement Hybridization between poly(T) DNA oligomers and poly(A)-tail of mRNA templates was critical for translation enhancement as we observed that the removal of poly(T) DNA oligomers or replacement of poly(T) DNA with poly(A) DNA oligomer from AuNP25p(T)DNA reduced translation to baseline level. We prepared and characterized AuNPp(A)DNA (See Supporting Information, Figure S3) before introducing it to HeLa lysate containing XBP-1S mRNA. A significant drop in enhancement factor from 2.11-fold with AuNP-p(T)DNA to 1.24-fold with AuNP-p(A)DNA was observed (Figure 6a and 6b). This demonstrated the importance of poly(T) DNA for successful hybridization and thus translation enhancement with the poly(A)-tail of mRNA since the poly(A) DNA oligomer on AuNPs was unable to hybridize to this poly(A)-tail. To further demonstrate the importance of hybridization, we prevented polyadenylation in XBP-1S mRNA by removing the BGH P(A) (∆BGH) in XBP-1S plasmid. From RT-PCR result, only the mRNA of XBP-1S and not XBP-1S (∆BGH) had a DNA band corresponding to XBP-1S gene size (Figure 6c) using XBP-1S specific primer. This is a result of successful cDNA synthesis led by hybridization between poly(T) primer and poly(A) tail found in XBP1S and not XBP-1S (∆BGH). Furthermore, the absence of poly(A) tail in the transcribed XBP-1S (∆BGH) mRNA was also shown in the RNA gel as a missing bright band at around 1440 kbp (See Supporting Information, Figure S2) since transcription was not able to terminate due to the absence of a stop signal provided by poly(A) tail.



Figure 6. The requirement of hybridization between poly(T) DNA on AuNP-p(T)DNA and poly(A)-tail in mRNA for enhancement of mRNA translation. Western blot image showed the qualitative amount of XBP-1S protein upon either (a) replacement of poly(T) DNA with poly(A) DNA on AuNPs or (d) removal of poly(A)-tail in mRNA. (b) The Western blot image was quantified using ImageJ and a significant reduction in XBP-1S mRNA translation was found when poly(T) DNA was replaced with poly(A) DNA on AuNPs (N = 3). (c) Agarose gel electrophoresis was performed on PCR products obtained from reverse transcription of XBP-1S (∆BGH) and XBP-1S mRNA using poly(T) primer followed by PCR of cDNA. A DNA band corresponding to XBP-1S gene size was observed using XBP-1S mRNA and not XBP-1S (∆BGH) mRNA, signifying the successful removal of poly(A)-tail. (e) The Western blot image was quantified using ImageJ and a significant reduction in XBP1S mRNA translation was shown upon removal of poly(A)-tail when incubated with AuNPp(T)DNA (N = 6). *One-tail t test, p < 0.01. 14 ACS Paragon Plus Environment

Page 14 of 26

Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The addition of AuNP-25p(T)DNA to HeLa lysate containing XBP-1S (∆BGH) mRNA had a reduced enhancement factor of only 1.10-fold compared to XBP-1S (2.12-fold), while the absence of the poly(A) tail in XBP-1S (∆BGH) mRNA had no effect on its translation with the AuNPs and mRNA only controls (Figure 6e). Therefore, hybridization between p(T)DNA oligomers and poly(A) tail of mRNA was crucial for translation enhancement and removal of either one of them would eliminate any translation enhancement.

Effect of p(T)DNA oligomer length and AuNP-p(T)DNA:mRNA ratio in translation enhancement We varied the p(T)DNA oligomers length to examine if the degree of hybridization with poly(A) tail would affect the mRNA translation enhancement. As the p(T)DNA oligomers length increased from 15 nucleotides (nt) to 25 nt, we observed a significant improvement in translation enhancement of GCN5 from 1.70-fold to 2.08-fold (p < 0.05), although further increase in oligomer length to 35 nt yielded no significant improvement (2.15-fold) (Figure 7a). Since the mechanism behind translation enhancement depended on hybridization between p(T)DNA oligomers and poly(A) tail of mRNA as discussed earlier, a short 15p(T)DNA oligomer may not have sufficient binding energy with the poly(A) tail to recruit a large number of mRNA to AuNP-p(T)DNA compared to a longer 25p(T)DNA. However, we have also found previously that hybridization with too high a binding affinity between the conjugated DNA oligomer and mRNA would not lead to any further improvement in translation enhancement

14

. This could account for the limited increase in translation

enhancement as the oligomer length increased further from 25 nt to 35 nt.



Figure 7. Enhancement of mRNA translation by AuNP-p(T)DNA is dependent on p(T)DNA length and ratio of AuNP-p(T)DNA to mRNA. Western blot images showing the synthesis of GCN5 protein in HeLa lysate dosed with AuNP and AuNP-p(T)DNA of (a) different oligomer length of 15 nt, 25 nt and 35 nt of thymine (N = 3), and (b) different concentrations of 3 nM, 10 nM and 30 nM (N = 3), which were subsequently quantified using ImageJ after normalizing to actin. (c) Western Blot image showing the production of GCN5 protein in HeLa lysate having different amount: 0.5 µg, 1 µg and 2 µg of GCN5 mRNA (N = 3), and was also subsequently quantified using ImageJ. (d) The level of GCN5 production as the ratio of AuNP:mRNA was varied based on the conditions used in (b) and (c). *One-tail t test, p < 0.1, **One-tail t test, p < 0.05.

We also found that the translation enhancement was dependent on AuNP-p(T)DNA-tomRNA ratio. By fixing 1 µg of GCN5 mRNA in the HeLa lysate, an increase in concentration 16 ACS Paragon Plus Environment

Page 16 of 26

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of AuNP-25p(T)DNA from 3 nM, 10 nM to 30 nM led to an increase in enhancement factor of 1.75, 2.39 and 2.98-fold respectively, while an increase in concentration of our AuNP control showed no concentration-dependent change in GCN5 synthesis (Figure 7b). Conversely, by fixing the concentration of AuNP-25p(T)DNA in HeLa lysate at 10 mM, a decreasing amount of mRNA from 2 µg, 1 µg to 0.5 µg led to improved enhancement factor of 1.92, 2.07 and 3.01-fold respectively (Figure 7c). Taken together, at a AuNPp(T)DNA:mRNA ratio < 0.1, no difference in GCN5 synthesis was observed between AuNP and

AuNP-25p(T)DNA,

and

the

difference

became

significant

only at

AuNP-

p(T)DNA:mRNA ratio beyond 0.1 (Figure 7d). In our study, up to 3.08-fold enhancement factor was observed using a high AuNP-p(T)DNA:mRNA ratio of 0.658. Here, the GCN5 synthesis increased with AuNP-p(T)DNA:mRNA ratio, thus suggesting that the AuNPp(T)DNA:mRNA ratio could be used to tune the protein synthesis amount. Since AuNPp(T)DNA remained monodispersed in HeLa lysate, a high ratio of AuNP-p(T)DNA to mRNA would provide more p(T)DNA to be available for hybridization to mRNA, thus reducing the recycling time taken by ribosomes and mRNA to cycle between different p(T)DNA strands for translation, not just within the vicinity of the same AuNP-p(T)DNA but also between different AuNP-p(T)DNAs in the vicinity of each other. This made the mRNA translation process more efficient, thereby leading to a higher translation enhancement factor.

Conclusion In this study, translation enhancement was observed in four different mRNAs using a common universal AuNP-p(T)DNA nanoconstruct that could increase the mRNA translation enhancement factor near to 3-fold. We concluded that poly(A) tail on the mRNA of interest was a feasible hybridization site for poly(T) DNA oligomers conjugated AuNPs to hybridize and recruit the translation machineries to the AuNPs to facilitate the mRNA translation process. Both the poly(T) DNA oligomer and the poly(A) tail on the mRNA were critical 17 ACS Paragon Plus Environment


Page 18 of 26

components as the absence of either component brought mRNA translation back to baseline levels. Furthermore, an optimum length of 25 nt for the oligomer and a high AuNPp(T)DNA:mRNA ratio of 0.658 were able to increase the enhancement of mRNA translation up to 3.08-fold. The outcome of our study in cell lysate suggested the potential of AuNPp(T)DNA to be extended to enhance translation in live cells. Such cellular studies present at least two main challenges not present in a cell-free system for the AuNP-p(T)DNA to work effectively in translation enhancement. These include a sufficiently high uptake of the AuNPDNA into the cells, and their endosomal escape from endocytic vesicles. Nonetheless, even in cell-free system, our AuNP-p(T)DNA could already find useful application as a generic additive in cell-free protein synthesis systems such as cell lysate kit to improve the yield of any protein encoded in the plasmid.

Experimental Section Synthesis and characterization of AuNPs AuNPs were synthesized based on a previously published protocol

29

. The synthesized

citrate-capped AuNPs were purified by repeated centrifugation at 9,000 rpm for 20 min using nuclease free water and stored at 4°C before use. The morphology of synthesized AuNPs was examined under transmission electron microscopy (TEM) (JEM-1220, JEOL Ltd., Japan). Optical properties of AuNPs were measured using UV-vis absorption spectroscopy (UV2450, Shimadzu, Japan) and subsequently used to calculate their concentration 30 and surface plasmon resonance wavelength. The zeta potential (ζ) and hydrodynamic diameter (DH) of AuNPs were measured using a Zetasizer (Nano ZS, Malvern, UK) at 25°C, based on the principle of dynamic light scattering (DLS).

AuNP-DNA conjugation


Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA oligomers purchased from Integrated DNA Technologies (USA) had a 5’-thiol end modification to facilitate covalent thiolate-gold binding to surface of AuNPs. A full length of thymine nucleotide (nt) additionally minimized self-adsorption of DNA on the AuNP surface 31

. Three oligomer length of interest, comprising of 15, 25 and 35 nt of thymine were selected

to hybridize to poly(A) tail of transcribed GFP, GCN5, CREB1 and XBP-1S mRNAs. The plasmids of all four genes were sequenced by Axil Scientific Pte. Ltd., Singapore. Prior to conjugation, the mercaptopropanol disulphide bond protecting the thiol terminal group of commercially purchased DNA oligomers was reduced with tris (2-carboxyethyl) phosphine (TCEP) (Sigma Aldrich, USA). A mixture of 1 µL of 100 µM DNA, 10 µL of 40 mM TCEP and 89 µL of 1x Tris-borate-EDTA (TBE) buffer were mixed and incubated for 3 h at room temperature according to the recommended protocol from the manufacturer although the addition of TCEP may not be a critical step

27

. Unlike dithiothreitol (DTT),

removal of TCEP was not necessary as it would not interfere with the conjugation step. DNA conjugation to AuNPs was performed accordingly to previously reported low pH assisted method

16, 19

. Briefly, 120 µL of 1 µM DNA was first added to 100 µL of 10 nM

AuNPs and vortexed continuously. In the meantime, 55 µL of citrate buffer (100 mM Na3C6H5O7 and 242 mM HCl) was added to the mixture drop by drop before leaving for it to stand for 5 min for conjugation to occur. The low pH assisted method helped to reduced conjugation time needed and aided conjugation of adenine through protonation of base, with little effect on thymine

27

. However, the same DNA conjugation protocol was used out for

both poly(T) and poly(A) DNA for consistency. Prior to use, the AuNPs conjugated to oligonucleotides with a poly(T) sequence (AuNP-p(T)DNA) was purified by repeated centrifugation at 9,000 rpm for 20 min with nuclease free water to remove excess unbound DNA oligomers and TCEP. The optical properties, DH and ζ of AuNP-p(T)DNA were characterized in a similar manner as synthesized citrate-capped AuNPs.



Page 20 of 26

The number of DNA oligomers per AuNP was quantified by subtracting the excess amount of unbound DNA oligomers found in the supernatant collected during purification from the initial concentration of DNA oligomers added to the AuNPs. SYBR Gold nucleic acid stain (Life Technologies, US) was used to intercalate DNA oligomers and fluorescence measured using Infinite® 200 PRO (Tecan, Switzerland) was used to calculate DNA concentration based on calibrating standards of known DNA concentrations.

Preparation of DNA plasmid GCN5, CREB1 and XBP-1S genes were cloned into pcDNA6/myc-His A plasmid (Thermo Fisher Scientific, USA). Briefly, primers were designed to amplify the genes of interest by polymerase chain reaction (PCR) and inclusion of restriction sites for subsequent cloning into pcDNA6 plasmid; GCN5 (Forward (EcoRI): TTTTGAATTCATGGCGGAACC TTCCCAG, Reverse (XhoI): TTTTCTCGAGCTACTTG TCAATGAGGCCTCCC), CREB1 (Forward (EcoRI): TTTTGAATTCATGACCATGGAAT CTGGAGCC, Reverse (NotI): TTT TGCGGCCGCTTAATCTGATTTGTGGCAGTAAAG G) and XBP-1S (Forward (BamHI): TTTTGGATCCATGGTGGTGGTGGCAGC, Reverse (XhoI): TTTTCTCGAGTTAGACAC TAATCAGCTGGGGAAAG). GFP gene (cloned inside pcDNA3.1 vector with BGH P(A)) was purchased commercially (Thermo Fisher Scientific, USA). In another experiment, BGH P(A) was removed from pcDNA6/myc-His A plasmid (∆BGH) before incorporation of XBP-1S gene. Restriction enzyme (RE) BbsI was used for the cloning of XBP-1S gene as the cutting site was found within BGH P(A) and would thus disrupt its function. Another BbsI cut site found in pcDNA6 was mutated (adenine to cytosine) using QuikChange® Site-Directed Mutagenesis Kit (Stratagene, CA) according to protocol

provided.

Reverse

primer

was

also

designed

for

XBP-1S

(TTTTGCTATTGTCTTCTTAGACACTAATCAGCTGGGGAAAG) to have BbsI cut site and used to clone XBP-1S (∆BGH) plasmid. 20 ACS Paragon Plus Environment

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Transcription of DNA plasmids in vitro Plasmids containing various genes were linearized before performing in vitro transcription using MEGAscript® T7 Transcription Kit (Life Technologies, US) to produce uncapped GFP, GCN5, CREB1 and XBP-1S mRNA with poly(A) tail. DNA templates were removed by incubation of transcription products with TURBO DNase at 37 ºC for 15 min. Subsequent purification was performed using MEGAclear™ Transcription Clean-Up Kit (Life Technologies, US) and concentration of purified mRNA was measured using NanoDrop 2000c (Thermo Fisher Scientific, USA) before storage at -20 ºC. The size and integrity of mRNA was further determined by running a RNA gel electrophoresis with 1 µg of purified mRNA using standard protocol. The presence of poly(A) tail was found by performing reverse transcription on purified mRNA using poly(T) primers, followed by PCR (RT-PCR). The same set of primers found in Section 4.3 was used for each gene to selective amplify them from start to stop codon. A set of primers was designed for GFP; Forward: ATGGTGAGCAAGGGCGAG and Reverse: CTAGATTACTTGTACAGCTCGTCCATG. Finally, RT-PCR products were subjected to agarose gel electrophoresis using standard protocol to determine size of RT-PCR product. Transcription of XBP-1S (∆BGH) plasmid was performed in a similar manner as XBP-1S plasmid to produce XBP-1S (∆BGH) mRNA.

Translation of mRNA with poly(A) tail in vitro Translation of GFP, GCN5, CREB-1, XBP-1S and XBP-1S (∆BGH) mRNA was performed using a 1-Step Human In Vitro Protein Expression Kit (Human IVT kit, Thermo Scientific, USA). For each mRNA, 12 µL of 10 nM AuNP or AuNP-25p(T)DNA was added to 25 µL of HeLa cell lysate from the kit before adding 1 µg of mRNA and incubating at 37 oC for 2.5 h. To determine the effect of p(T)DNA oligomers length on translation enhancement, AuNP15p(T)DNA or AuNP-35p(T)DNA was also added to HeLa lysate. The effect of AuNP21 ACS Paragon Plus Environment


25p(T)DNA:mRNA ratio on mRNA translation enhancement was also investigated by either varying the AuNP-p(T)DNA concentration (3 nM, 10 nM or 30 nM) or varying the amount of mRNA in the HeLa lysate (0.5 µg, 1 µg or 2µg). To demonstrate multiplex mRNA translation, we incubated 0.33 µg of GFP, GCN5 and XBP-1S mRNA each (total 1 µg) with 12 µL of 10 nM AuNP or AuNP-25p(T)DNA in 25 µL of HeLa cell lysate for 2.5 h at 37 oC.

Quantification of synthesized proteins in vitro The synthesized GFP, GCN5, CREB-1, XBP-1S and XBP-1S (∆BGH) were quantified using western blot. Western blot was used in protein quantification as it was quantitative and it allowed for detection and quantification of proteins in their native state without the need to include a fluorescent tag as in fluorescence-based measurement which modified the proteins. Anti-GFP antibody (sc9996, Santa Cruz Biotechnology, Inc., 1:500), anti-GCN5 antibody (Cat#3305, Cell Signaling Technology, Inc., 1:1000), anti-CREB1 (Cat#9104, Cell Signaling Technology, Inc., 1:1000), anti-XBP-1S (sc7160, Santa Cruz Biotechnology, Inc., 1:1000) were used as primary antibodies to probe for GFP, GCN5, CREB-1, XBP-1S respectively. Anti-actin (Cat# MAB1501, Millipore, 1:2000) or anti-vinculin (ab18058, Abcam, plc., 1:1000) was used to detect actin or vinculin to verify equal sample loading since both are abundant proteins in cells. Horseradish peroxidase (Pierce, US) conjugated secondary antibodies were selected for chemiluminescence detection. Briefly, polyvinylidene difluoride (PVDF) blots were incubated with primary antibody overnight at 4 oC and repeatedly washed with PBS-Tween (10 mM sodium phosphate, 0.15M NaCl, 0.05% Tween-20) before addition of secondary antibody at room temperature for 1 h. After secondary antibody incubation, PVDF blots were repeatedly washed again with PBS-Tween before incubation with SuperSignal West Pico Substrate (Pierce, US). The intensity of protein bands was analyzed and quantified using ImageJ software reported previously

14

. Experiments were conducted in triplicates and statistical analyses using one22 ACS Paragon Plus Environment

Page 22 of 26

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tailed unpaired student’s t-test (since an enhancement in translation was expected) was performed to determine the significant of translation enhancement.

Supporting Information Supporting Information showing the detection of poly(A) tail in mRNA using RT-PCR and RNA gel electrophoresis for both XBP-1S and XBP-1S (∆BGH) are available.

Acknowledgements The funding used to support the research of the manuscript was from the Ministry of Education (MOE) AcRF Tier 1. KP Chan would like to acknowledge the scholarship support from A*STAR Graduate Scholarship.

References (1) Nirenberg, M. W., & Matthaei, J. H. The dependence of cell-free protein synthesis in E. coli upon naturally occurring or synthetic polyribonucleotides. Proceedings of the National Academy of Sciences 1961, 47 (10), 1588-1602. (2) Yin, G.; Swartz, J. R. Enhancing multiple disulfide bonded protein folding in a cell-free system. Biotechnology and bioengineering 2004, 86 (2), 188-195, DOI: 10.1002/bit.10827. (3) Katzen, F.; Chang, G.; Kudlicki, W. The past, present and future of cell-free protein synthesis. Trends in biotechnology 2005, 23 (3), 150-156, DOI: 10.1016/j.tibtech.2005.01.003. (4) Shimizu, Y., Inoue, A., Tomari, Y., Suzuki, T., Yokogawa, T., Nishikawa, K., & Ueda, T. Cell-free translation reconstituted with purified components. Nature biotechnology 2001, 19 (8), 751-755. (5) Sawasaki, T.; Ogasawara, T.; Morishita, R.; Endo, Y. A cell-free protein synthesis system for high-throughput proteomics. Proceedings of the National Academy of Sciences of the United States of America 2002, 99 (23), 14652-14657, DOI: 10.1073/pnas.232580399. (6) Spirin, A. S. High-throughput cell-free systems for synthesis of functionally active proteins. Trends in biotechnology 2004, 22 (10), 538-545, DOI: 10.1016/j.tibtech.2004.08.012. (7) Erickson, A. H., & Blobel, G. [3] Cell-free translation of messenger RNA in a wheat germ system. Methods in enzymology 1983, 96, 38-50. (8) Madin, K., Sawasaki, T., Ogasawara, T., & Endo, Y. A highly efficient and robust cellfree protein synthesis system prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes. Proceedings of the National Academy of Sciences 2000, 97 (2), 559-564. 23 ACS Paragon Plus Environment


(9) Kim, J. H.; Jang, H. H.; Ryou, S. M.; Kim, S.; Bae, J.; Lee, K.; Han, M. S. A functionalized gold nanoparticles-assisted universal carrier for antisense DNA. Chemical communications 2010, 46 (23), 4151-4153, DOI: 10.1039/c0cc00103a. (10) Yeom, J. H.; Ryou, S. M.; Won, M.; Park, M.; Bae, J.; Lee, K. Inhibition of Xenograft tumor growth by gold nanoparticle-DNA oligonucleotide conjugates-assisted delivery of BAX mRNA. PloS one 2013, 8 (9), e75369, DOI: 10.1371/journal.pone.0075369. (11) Ryou, S. M.; Yeom, J. H.; Kang, H. J.; Won, M.; Kim, J. S.; Lee, B.; Seong, M. J.; Ha, N. C.; Bae, J.; Lee, K. Gold nanoparticle-DNA aptamer composites as a universal carrier for in vivo delivery of biologically functional proteins. Journal of controlled release : official journal of the Controlled Release Society 2014, 196, 287-294, DOI: 10.1016/j.jconrel.2014.10.021. (12) Park, S., & Hamad-Schifferli, K. Enhancement of in vitro translation by gold nanoparticle− DNA conjugates. ACS nano 2010, 4 (5), 2555-2560. (13) Park, S. Design of gold nanoparticle and DNA oligomer conjugates for enhancement or suppression of in vitro gene expression. BioChip Journal 2013, 7 (2), 89-94, DOI: 10.1007/s13206-013-7202-z. (14) Chan, K. P.; Gao, Y.; Goh, J. X.; Susanti, D.; Yeo, E. L.; Chao, S. H.; Kah, J. C. Exploiting the Protein Corona from Cell Lysate on DNA Functionalized Gold Nanoparticles for Enhanced mRNA Translation. ACS applied materials & interfaces 2017, 9 (12), 10408-10417, DOI: 10.1021/acsami.6b15269. (15) Yeh, Y. C.; Creran, B.; Rotello, V. M. Gold nanoparticles: preparation, properties, and applications in bionanotechnology. Nanoscale 2012, 4 (6), 1871-1880, DOI: 10.1039/c1nr11188d. (16) Zhang, X.; Servos, M. R.; Liu, J. Instantaneous and quantitative functionalization of gold nanoparticles with thiolated DNA using a pH-assisted and surfactant-free route. Journal of the American Chemical Society 2012, 134 (17), 7266-7269, DOI: 10.1021/ja3014055. (17) Ding, Y.; Jiang, Z.; Saha, K.; Kim, C. S.; Kim, S. T.; Landis, R. F.; Rotello, V. M. Gold nanoparticles for nucleic acid delivery. Molecular therapy : the journal of the American Society of Gene Therapy 2014, 22 (6), 1075-1083, DOI: 10.1038/mt.2014.30. (18) Niemeyer, C. M., & Ceyhan, B. DNA-Directed Functionalization of Colloidal Gold with Proteins. Angewandte Chemie International Edition 2001, 40 (19), 3685-3688. (19) Zhang, X.; Servos, M. R.; Liu, J. Surface science of DNA adsorption onto citrate-capped gold nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2012, 28 (8), 3896-3902, DOI: 10.1021/la205036p. (20) Azzoni, A. R.; Ribeiro, S. C.; Monteiro, G. A.; Prazeres, D. M. The impact of polyadenylation signals on plasmid nuclease-resistance and transgene expression. The journal of gene medicine 2007, 9 (5), 392-402, DOI: 10.1002/jgm.1031. (21) Lew, Q. J.; Chu, K. L.; Chia, Y. L.; Soo, B.; Ho, J. P.; Ng, C. H.; Kwok, H. S.; Chiang, C.-M.; Chang, Y.; Chao, S.-H. GCN5 inhibits XBP-1S-mediated transcription by antagonizing PCAF action. Oncotarget 2015, 6 (1), 271. (22) Nagy, Z.; Tora, L. Distinct GCN5/PCAF-containing complexes function as co-activators and are involved in transcription factor and global histone acetylation. Oncogene 2007, 26 (37), 5341-5357. (23) Sheng, M.; Thompson, M. A.; Greenberg, M. E. CREB: A Ca2 (Plus)-Regulated Transcription Factor Phosphorylated by Calmodulin-Dependent Kinases. Science 1991, 252 (5011), 1427. (24) Lee, A.-H.; Iwakoshi, N. N.; Glimcher, L. H. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Molecular and cellular biology 2003, 23 (21), 7448-7459.


Page 24 of 26

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(25) Lew, Q. J.; Chu, K. L.; Lee, J.; Koh, P. L.; Rajasegaran, V.; Teo, J. Y.; Chao, S.-H. PCAF interacts with XBP-1S and mediates XBP-1S-dependent transcription. Nucleic acids research 2010, 39 (2), 429-439. (26) Hurst, S. J., Lytton-Jean, A. K., & Mirkin, C. A. Maximizing DNA loading on a range of gold nanoparticle sizes. Analytical chemistry 2006, 78 (24), 8313-8318. (27) Liu, B.; Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Analytical Methods 2017, 9 (18), 2633-2643. (28) Xu, Z.-L.; Mizuguchi, H.; Ishii-Watabe, A.; Uchida, E.; Mayumi, T.; Hayakawa, T. Strength evaluation of transcriptional regulatory elements for transgene expression by adenovirus vector. Journal of controlled release 2002, 81 (1), 155-163. (29) Kimling, J., Maier, M., Okenve, B., Kotaidis, V., Ballot, H., & Plech, A. Turkevich method for gold nanoparticle synthesis revisited. The Journal of Physical Chemistry B 2006, 110 (32), 15700-15707. (30) Haiss, W., Thanh, T.K., Aveyard, J., Fernig, D.G. Determination of Size and Concentration of Gold Nanoparticles from UV-Vis Spectra. Anal. Chem. 2007, 79 (11), 4215-4221. (31) Demers, L. M., Mirkin, C. A., Mucic, R. C., Reynolds, R. A., Letsinger, R. L., Elghanian, R., & Viswanadham, G. A fluorescence-based method for determining the surface coverage and hybridization efficiency of thiol-capped oligonucleotides bound to gold thin films and nanoparticles. Analytical chemistry 2000, 72 (22), 5535-5541.



Table of contents entry


Page 26 of 26

Universal mRNA Translation Enhancement with Gold Nanoparticles

Recommend Documents