Virus-Mimicking Cell Capture Using Heterovalency Magnetic DNA

Subscriber access provided by UNIV OF TEXAS DALLAS

Biological and Medical Applications of Materials and Interfaces

Virus-Mimicking Cell Capture Using HeteroValency Magnetic DNA Nano-Claws Zhiru Wang, Weiwei Qin, Jialang Zhuang, Minhao Wu, Qian Li, Chunhai Fan, and Yuanqing Zhang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b21998 • Publication Date (Web): 08 Mar 2019 Downloaded from http://pubs.acs.org on March 10, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Virus-Mimicking Cell Capture Using Hetero-Valency Magnetic DNA Nano-Claws

Zhiru Wang1, Weiwei Qin1,5*, Jialang Zhuang1, Minhao Wu2, Qian Li3, 4, Chunhai Fan3, 4* and Yuanqing Zhang1*

1School

of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006, China;

2Department

of Immunology, Zhongshan School of Medicine, Sun Yat-sen University, 74

Zhongshan 2nd Road, Guangzhou 510080, China; 3Division

of Physical Biology and Bioimaging Center, Shanghai Synchrotron Radiation

Facility, CAS Key Laboratory of Interfacial Physics and Technology, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800, China; 4School

of Chemistry and Chemical Engineering, and Institute of Molecular Medicine, Renji

Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200240, China; 5College

of Materials and Energy, South China Agriculatural University, Guangzhou 510642,

China

Corresponding Author: *Email: [email protected]. *Email: [email protected]. *Email: [email protected].

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Synergy represents a natural approach for high-efficiency recognition in biological systems. Inspired by the recognition mechanism of viral infection of mammalian cells, here we develop hetero-valency magnetic DNA nano-claws with octopus arms morphology for synergetic cell capture. We demonstrated that the rigid-flexible DNA nano-claws can load multiple antibodies (Abs) targeting different epitopes for enhanced capture of cancer cells, especially significantly increasing the capture efficiency to MDA-MB-231 cells up to 82.3±7.1%. We also employed DNA nano-claws with the combined use of multiple Abs to capture circulating tumor cells from clinical samples with high efficiency and specificity. We expect that the DNA nano-claws not only could play a key role in liquid biopsy, but also could be expanded more applications benefiting from its modularity and programmability to modify various functionalities in future.

KEYWORDS: viral infection mechanism-inspired strategy, synergy effect, circulating tumor cells capture, DNA nanostructure, rolling circle amplification

1. INTRODUCTION： High-efficiency recognition in biological processes, e.g., viral infection, is often realized exploiting synergistic effects from multiple biomolecules.1-4 However, the cooperation strategy from kinds of function components to enhance recognition is less exploited. We were inspired to mimic the recognition mode of virus to enhance the recognition and capture efficiency of the extremely low abundance of circulating tumor cells (CTCs).

The ability to capture rare CTCs in peripheral blood is highly desirable for early cancer detection, progression prediction, curative effect evaluation and prognosis evaluation.57

Current widely used strategy (affinity-based separation methods) is employing anti-

epithelial cell adhesion molecule (EpCAM) antibody as recognition molecule.8-13


Page 2 of 26

Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


However, the expression level about EpCAM of CTCs is highly down-regulated due to various physiological processes, resulting in different phenotypes of CTCs in the blood.14-16 Using this strategy suffers from loss of CTCs with low or no EpCAM expression, so the combined use of multiple heterogeneous antibodies (Abs) is likely to enhance the recognition ability and capture efficiency of CTCs with diverse phenotypes.

DNA nanostructure was selected to load Abs due to its high controllability, high precision and easy modification.17-19 More importantly, DNA has two properties: flexibility (single strand DNA, ssDNA) and rigidity (double strand DNA, dsDNA) 2024.

Here, we generated magnetic DNA nano-claws with octopus arms morphology by

using rolling circle amplification (RCA) and hybridizing specific part of the tandem DNA strand of RCA product to capture and isolate CTCs. We demonstrated that the virus-mimetic magnetic DNA nano-claws can not only be loaded with multiple Abs, but also can be given enough access to the surface of the cells, enabling enhanced recognition and isolation of cancer cells. Then we demonstrated that the hetero-valency magnetic DNA nano-claws method enhanced the capture of breast cancer cells, especially triple negative breast cancer cells, and can be successfully applied to isolate CTCs from blood samples of breast cancer patients. In addition, the magnetic DNA nano-claws are also successfully used to profile cellular phenotype.

2. EXPERIMENTAL SECTION 2.1 Materials and Reagents. DNA sequences in the work were synthesized and processed by Invitrogen (Shanghai, China). DynaMag™-2 Sample Rack (12321D) was also purchased from Invitrogen. Phosphate buffer solution (PBS, Gibco), Dulbecco’s modified Eagle’s medium (DMEM, Gibco), Penicillin–streptomycin, Fetal bovine serum (FBS, Gibco), trypsin, streptavidin-magnetic beads, CellTracker Deep Red, dNTPs and Fluorescien-12-dUTP were purchased from Life technologies. Hexamethyl Disilazane

(HMDS)

and

streptavidin

were

obtained

from

Sigma-Aldrich.

Glutaraldehyde, sodium chloride (GR) and absolute ethyl alcohol (GR) were supplied by Sinopharm Group. Calcien-AM, Hoechst 33342, 4% Paraformaldehyde (PFA), Cy3



labeled IgG were purchased from Beyotime. 1×Tris-EDTA buffer (TE) were supplied by Solarbio. T4 DNA ligase, 10 ×T4 ligase buffer, DNA phi29 polymerase and 10× DNA polymerase buffer were purchased from New England Biolabs (NEB). PElabeled anti-cytokeratin 7/8 (PE-CK) and FITC-labeled anti-CD45 (FITC-CD45) were supplied by BD Biosciences. 0.1% Triton were obtained from Aladdin. Biotin labeled anti-EpCAM antibody, anti-HER-2 affibody molecule and anti-EGFR antibody were purchased from Abcam. The fresh blood from healthy people and breast cancer patients collected from the First Affiliated Hospital of Sun Yat-sen University. All other chemicals were of analytical grade, and water was purified using a Millipore filtration system (Milli-Q water). The experiments protocol has been reviewed and approved by the Medical Ethics Committee of Zhongshan School of Medicine, Sun Yat-sen University. The approval number is 2016-032. DNA Sequences (from 5’ to 3’) DNA Primer:

TTTTTTTTTTTTTTTTTTTTGCTATAGTTGGAGCTGAT

DNA Template:

Phos-AACTATAGCGTCCAGTGAATGCGAGTCCGTCTA GGAGAGTAGTACAGCAGCCATCAGCTCC

Biotin-DNA probe: Biotin-CAGTGAATGCGA GTCCGTCTAGGAGAGTAG FAM-DNA probe:

FAM-CAGTGAATGCGA GTCCGTCTAGGAGAGTAG

2.2 Cells Culture. All breast cancer cell lines (MCF-7, MDA-MB-231 and SK-Br3) were kindly provided by Dr. Minhao Wu’s lab at Zhongshan School of Medicine of Sun Yat-sen University. Hela cell was generously gifted from Prof. Peiqing Liu’s lab at school of Pharmaceutical Sciences of Sun Yat-sen University. Cells were cultured in DMEM media supplemented with 10% FBS and 1% penicillin–streptomycin at 37℃ at 5% CO2 in cell incubator. Cells were passaged and harvested with trypsin while reached 80% confluency. 2.3 Preparation of Magnetic DNA Nano-claws (MDNCs) and Magnetic DNA Nano-spheres (MDNSs). To prepare MDNSs solution of 30μL, 3μL streptavidinmagnetic beads (MBs, 10mg/mL) and 15μL biotinylated DNA primers (1×10-6 M) were suspended in the solution of 15μL 2×TEN buffer (prepared by 1×TE Buffer and 2M sodium chloride) and then incubated for 30 min at room temperature. After removal of


Page 4 of 26

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


surplus DNA primers, added 30μL circular DNA templates (1×10-6 M) hybridized with DNA primers for 1h and then the solution was treated with 0.3μL T4 ligase for 2h at room temperature to ligate the gap of DNA template. Then free DNA templates and T4 ligase was separated via magnet. The solution was displaced by rolling circular amplification (RCA) solution containing 6μL dNTPs (1×10-3 M), 0.75μL phi29 DNA polymerase as well as 23.25μL 1×polymerase buffer, then the RCA reaction was incubated at room temperature for 3h. After magnetic separation, the surplus RCA reaction solution was discarded and MDNSs were stored in 1×TE buffer at 4℃. To prepare MDNCs, excess biotinylated DNA probes were added in the RCA solution to form “Octopus arms” morphology and constructed MDNCs were resuspended in 1×TE buffer. Generally, these solution was sonicated for minutes to avoid aggregation. All reaction procedures were conducted under gentle rotation to resist natural sinking of magnetic beads. 2.4 Fluorescent Images of MDNCs, MDNSs, antibodies-MDNCs (Abs-MDNCs). To characterize the MDNSs and MDNCs via fluorescent images, 1μL Fluorescein-14dUTP (0.4×10-3 M) was mixed into the RCA solution and 2.5μL FAM labeled DNA probes (1×10-6 M) were added into the RCA solution of 30μL containing 3μL MBs of 10mg/mL, respectively. After removal of surplus RCA solution, produced MDNSs and MNDCs were resuspended in 1×TE buffer and dropped in the glass slide to observe under fluorescent microscope. To determine successful conjugation of antibodies (Abs) on the MDNCs, 2.5μL biotinylated DNA probes (5×10-6 M) were added into the 30μL RCA solution to form biotin-MDNCs. Then 30μL streptavidin (1×10-6 M) and 2μL biotin-labeled anti-EpCAM (1.2×10-5 M) stepwise decorated on MDNCs for 30 min of every step at 4℃. After washing 3 times using 1×PBS solution, 30μL Cy3-labeled IgG (1×10-6 M) was incubated with anti-EpCAM-MDNCs at 4℃ for 30 min in the dark. Have been removed surplus Cy3-labeled IgG, the fluorescent MDNCs were resuspended in 1×PBS buffer and dropped on a glass slide to observe under fluorescent spectroscope. 2.5 Dynamic Light Scattering (DLS) and Zeta Potential Measurements. For preparing MDNCs and MDNSs to DLS measurement, their RCA reacted for 6h at room



temperature. Then 10μL MDNCs and 10μL MDNSs were diluted by 1mL 1×TE buffer, respectively. As control, naked magnetic beads were resuspended in the same solution. To avoid aggregation of magnetic beads, sufficient sonication for minuets was needed. The DLS and Zeta potential measurements were carried out on the Zetasizer Nano ZS90 (Malvern). 2.6 Scanning Electron Microscope (SEM) Measurement of MDNSs, MDNCs, Abs-MDNCs-Cells. MDNSs and MDNCs of same volume (10μL) were sonicated for minutes and dropped on two clean silicon wafers respectively and these silicon wafers were pre-cleaned by “Piranha” solution. These samples were dried with air naturally in the fuming cupboard at room temperature overnight. Then the silicon wafers were treated with metal spraying for electric conduction. The SEM measurement was carried out on the Field Emission Scanning Electron Microscope JSM-6330F (JEOL). AntiEpCAM-MDNCs were incubated with MCF-7 cells for 30 min at 4℃ and separated via magnet. Captured MCF-7 cells were treated with 2.5% glutaraldehyde at room temperature overnight for fixed cell tissue and were dehydrated by the gradient ethanol (30%, 50%, 70%, 90%, 95% and 100%) stepwise for 15 min of every step. Then captured cells were treated with 50% HMDS for 15 min and were suspended in 100% HMDS solution. The cells were dropped onto the clean silicon wafer for air drying in the hood naturally, followed by sprayed with metal for conduction. The measurement was carried out on the Thermal Field Emission Environmental Scanning Electron Microscope Quanta 400F (FEI) at an accelerating voltage of 20.0 kV. 2.7 The Comparison of Load Ability between MDNSs and MDNCs. 1.25μL FAM labeled DNA probes (0.1/1/10×10-6 M) were added into 15μL RCA solution of MDNCs, respectively. The RCA solution reacted lasted for 1.5h at room temperature in dark to generate fluorescent MDNCs. For preparing fluorescent MDNSs, the RCA reaction also lasted for 1.5h to produce MDNSs and then the MDNSs were incubated with 1.25μL FAM labeled DNA probes (0.1/1/10×10-6 M) for 1.5h in dark. MDNSs and MDNCs were washed using 1×PBS buffer to remove surplus fluorescent DNA probes and dropped onto the glass slides to observe under fluorescent microscope. The fluorescence intensities of them were analysis by the Image J software.


Page 6 of 26

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.8 Fluorescent Image of Cell Bound to Abs-MDNCs. 2.5μL biotinylated DNA probes (5×10-6 M) were added into the 30μL RCA solution. MDNCs were incubated with 30μL streptavidin (1×10-6 M) and 30μL anti-EpCAM (0.4×10-6 M) stepwise. Harvested MCF-7 cells were stained with CellTracker Deep Red for 15 min in the cell incubator, followed by washing times by sterilized PBS. Then 30μL anti-EpCAMMDNCs were incubated with 200μL stained cells (~1000 cells) at 4℃ for 30 min using gentle rotation. These cells were imaged by fluorescence microscope in a 96-well plate. 2.9 Cell Capture in PBS and Whole Blood. Harvested cells stained with CellTracker Deep Red were counted by hemacytometer and spiked in PBS or whole blood solution at the final volume of 200μL respectively. Whole blood was collected from healthy human and stored in the anticoagulant tube at 4℃. The blood samples should be processed immediately as soon as possible. Discarding the upper serum after centrifuging at 800 rpm for 10min, PBS of same volume as discarding serum was added into the blood. Anti EpCAM-MDNCs were prepared by the method as above and incubated with cells at 4℃ for 30min in dark, followed by washing times by PBS. Captured cells were resuspended in PBS solution and counted in a 32-well plate under fluorescence microscope. Cocktail-Abs-MDNCs were prepared for capturing SK-Br-3 and MDA-MB-231 cells. Based on the method of preparing anti-EpCAM-MDNCs, cocktail of Abs containing anti-EpCAM (30μmol), anti-EGFR (30μmol) and anti-HER2 (30μmol) were conjugated onto the MDNCs (prepared by 3μL MBs of 10mg/mL) after streptavidin (30μmol) conjugation. In the purity experiment, MCF-7 cells and HeLa cells were stained with Hoechst 33342 and CellTracker Deep Red, respectively Captured cells were observed and counted under fluorescence microscope. All the capture efficiency and purity were calculated from the two formulas: 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑎𝑝𝑡𝑢𝑟𝑒𝑑 𝑐𝑒𝑙𝑙𝑠 × 100% 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑝𝑖𝑘𝑒𝑑 𝑐𝑒𝑙𝑙𝑠 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑎𝑝𝑡𝑢𝑟𝑒𝑑 𝑝𝑜𝑠𝑖𝑡𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 Purity = × 100% 𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑝𝑖𝑘𝑒𝑑 𝑐𝑒𝑙𝑙𝑠

Capture Efficiency =

2.10 CTCs Detection in Clinical Samples from Breast Cancer Patients. The clinical peripheral blood samples were collected from breast cancer patients and were pretreated immediately. Whole blood were centrifuged at 800g for 10 min to separate



serum and the upper serum was discarded. The same volume of PBS as discarded the serum was added into the remaining blood, followed by mixed completely. Excess cocktail-Abs-MDNCs (MDNCs of 50μL were prepared by 5μL MBs of 10 mg/mL) were assembled using MDNCs and cocktails of Abs containing anti-EpCAM, antiEGFR and anti-HER-2 of equal mol. And then the cocktail-Abs-MDNCs were incubated with blood samples (0.5mL) for 45min at 4℃ using gentle rotation. After magnetic separation, captured cells were incubated with 4% PFA for 15min to fix the cell. Then the washed residue was treated with 0.1% Triton X-100 for 15min and washed by PBS. After that, cells were immersed in the block solution-1% BSA for 40min, followed by washing times. Finally, the blood samples were stained with PECK and FITC-CD 45 for 40 min in dark, and then Hoechst 33342 was added into the solution to stain cell nucleus for 10 min. Stained cells were resuspended in PBS solution containing 0.1% BSA and imaged in the 32-well plate to calculate under fluorescence microscope. 2.11 Captured Cells Culture and Cells Viability Analysis. Captured cells were separated by magnet and resuspended in whole DMEM medium containing 20% FBS and 1% penicillin-streptomycin. Then cells were cultured in a 96-well plate in cell incubator. At the day of 2, 4, 10, cells were washed by PBS and the supplement was replaced with fresh whole DMEM. The growth of cells was observed with microscope. The captured cells were stained with Calcein-AM (10μM) to verify live cells at 37℃ for 30 min, followed by washing times via PBS. Then cells were observed under fluorescence microscope. 2.12 Identification Assay of “dual-labeling” MDNCs for HER-2 Molecule on Cancer Cells. To prepare “dual-labeling” MDNCs, 2.5μL FAM labeled DNA probes (1×10-6 M) were added in the RCA reaction solution of 15μL containing 1.5μL MBs of 10mg/mL. After incubation for 1.5h, 3μL biotinylated DNA probes (1×10-6 M) were participated in the system for 1.5h at the room temperature. Then MDNCs were decorated with streptavidin and biotin labeled anti-HER-2 at 4 ℃ for 30-60 min stepwise. Above all experiments were operated using gentle rotation in the dark. Harvested cells were stained with different cell dyes to meet experiment requirement.


Page 8 of 26

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fluorescent cells with red fluorescence were dyed with CellTracker Deep Red and cells with blue fluorescence were dyed with Hoechst 33342. Mimicking the blood samples of clinical breast cancer patients, two cell lines of the same count were mixed into one sample. “dual-labeling” MDNSs were incubation with cells for 30 min at 37℃ in the dark. Then the mixed cells were dropped into a 24-microwell plate and imaged with fluorescent microscope in the channel of FITC, DAPI and TRITC, respectively. The fluorescence intensity of MDNCs in the same area around the target cell can be counted as the effective fluorescence intensity. The recognition step was conducted by Image J. And the relative fluorescent intensity of MDNCs was calculated by the formula: Relative fluorescent intensity =

𝑒𝑓𝑓𝑒𝑐𝑡𝑖𝑣𝑒 𝑓𝑙𝑢𝑜𝑟𝑒𝑠𝑐𝑒𝑛𝑡 𝑖𝑛𝑡𝑒𝑛𝑠𝑖𝑡𝑦 𝑜𝑓 𝑝𝑜𝑠𝑖𝑡𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 × 100% 𝑒𝑓𝑓𝑒𝑐𝑡𝑖𝑣𝑒 𝑓𝑙𝑢𝑜𝑟𝑒𝑠𝑐𝑒𝑛𝑡 𝑖𝑛𝑡𝑒𝑛𝑠𝑖𝑡𝑦 𝑜𝑓 𝑛𝑒𝑔𝑎𝑡𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠

3. RESULTS AND DISCUSSION: First, based on rolling circle amplification (RCA) approach, we assembled magnetic DNA nano-spheres (MDNSs) and magnetic DNA nano-claws (MDNCs) structures (Scheme 1). As determined by scanning electron microscope (SEM), DNA nanospheres were produced on the magnetic beads, MDNSs, which is consistent with the reported morphology of RCA product in the solution (Figure 1b).25, 26 To unfold these spheres, DNA probes (short single-strand DNA) are introduced to specifically hybridize part of the tandem DNA strand during RCA process to generate MDNCs (Figure 1c).27, 28 Because the hybridization of DNA probes, MDNCs are endowed with rigid and flexible properties thus construct 3D “octopus arms” morphology. The average hydrated diameter of MDNSs and MDNCs measured by dynamic light scattering (DLS) is 1357.7nm and 2043.3nm, respectively, suggesting that MDNCs are much more stretched than MDNSs (Figure 1d). The relative high electronnegativity of MDNCs (Figure 1e) makes it exhibit good stability and dispersibility in solution, enabling the solution to be stored stably and could be separated by magnet rapidly (Figure 1f). We then utilized Fluorescein-12-dUTP and FAM labeled DNA probes to merge into DNA chains and hybridize with DNA chains, respectively, to verify the



successful construction of MDNSs and MDNCs visually (Figure 1g, 1h). And the successful conjugation of antibodies (Abs) on MDNCs is also confirmed via immunofluorescence method, which paves the way of subsequent experiments (Figure 1i). Moreover, we have demonstrated that fluorescence tagging cannot be absorbed on the naked magnetic beads (MBs) nonspecifically (Figure S1 and all pictures in left of Figure 1g/h/i).

Having constructed MDNSs and MDNCs, we next evaluated the loading capacities of MDNCs and MDNSs. By hybridizing with FAM labeled DNA probes with low, medium and high concentration respectively, the loading capacities of MDNCs and MDNSs were determined comprehensively by comparing these fluorescence intensities. As shown in Figure 2a and Figure S2, strong fluorescence is visible inside fluorescent MDNCs, whereas MDNSs incubated with DNA probes exhibit weak fluorescence. And the fluorescence intensity of MDNCs is roughly twice of the intensity of MDNSs (Figure 2b), clearly suggesting that MDNCs indeed have much higher loading capability. However, the gap of fluorescence intensity between MDNSs and MDNCs is obviously reduced at low DNA concentration. The reason for this may be that this DNA concentration is too low to achieve saturation point of MDNSs, thus MDNCs and MDNSs could approximately hybridize equivalent DNA probes. Overall, we showed that MDNCs are capable of loading more DNA molecules over MDNSs, owing to their extended DNA chains, which offer much more available hybridization sites for DNA probes.

Then, the cell capture and cell-binding abilities of MDNSs and MDNCs are investigated. MCF-7 cell (a breast cancer cell line overexpressing EpCAM) is selected as target cell. First, the capture abilities of naked MBs, anti-EpCAM-MBs were compared with that of anti-EpCAM-MDNSs as well as anti-EpCAM-MDNCs. As shown in Figure 2d, Abs-MDNCs exhibit better performance for cancer cells detection over MBs and MDNSs, possibly because the hybridization of RCA product with biotin-DNA probes produced more sites for antibody binding. For MDNCs, the result could be attributed


Page 10 of 26

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to the outstanding load capability, and the long and flexible DNA nano-claws of MDNCs, which have advantages over MDNSs to access the surface of cell membrane easily. Therefore, the “octopus arms” morphology enable Abs could access the surface of cell membrane with high accuracy, especially compared with the rigid spheres structure of MDNSs (Figure 2c). As given in Figure 2e and 2f, we directly observe that MCF-7 cells were captured by anti-EpCAM-MDNCs firmly and specifically. All these results powerfully confirmed that DNA nano-claws structure is very helpful for enhancing Abs-loading and cells-binding abilities of MDNCs, which could intensively contribute to rare cancer cells capture further.

We further evaluated the capture performance of Abs-MDNCs. MDNCs decorated with anti-EpCAM Abs were incubated with MCF-7 cells of different numbers and the numbers of captured cells reveal the outstanding capture capability of MDNCs, extremely against cancer cells of low abundance whether in PBS or whole blood (Figure 3a). And then MCF-7 cells of 200, 500 and 1000 were respectively spiked into HeLa cells (EpCAM-negative) of 1.0×104, to verify the capture efficiency and purity in the background interfered by noise. By the counting and analysis of captured positive cells, the capture efficiency and purity were around 95% and 85%, respectively, demonstrating the high capture capacity and satisfactory specificity of MDNCs to cells of interest in the complex surrounding (Figure 3b). However, CTCs are in a state of dynamic change, CTCs between various patients and of one patient at different time points are different.

CTC phenotypic heterogeneity is closely related to the patients’ survival following treatment, so capturing as many cancer cells as possible is very necessary for diagnosis.29 Inspired by the mechanism of virus infection against mammalian cells, the synergy work strategy is employed to promote recognition and affinity binding efficiency for capturing other breast cancer cells （SK-BR-3 and MDA-MB-231) in addition to MCF-7. The strategy is achieved by integrating multiple Abs into MDNCs to form hetero-valency magnetic DNA claws (cocktail-Abs-MDNCs). Many reports



proved that Human epidermal growth factor receptor-2 (HER-2) and epidermal growth factor receptor (EGFR) molecules express on the cell membrane of these breast cancer cells with different level, as well as EpCAM.30-32 Cocktail of Abs containing antiEpCAM, anti-HER-2 and anti-EGFR Abs of equal mol are jointly conjugated on MDNCs for capturing these breast cancer cells. As expected, the capture yield of SKBR-3 and MDA-MB-231 cells increase from 82.24±2.13% to 87.74±1.77% and 34.35±1.70% to 82.3±7.10%, respectively (Figure 3c). The result strongly suggests that synergy generated from the combined use of multiple Abs is conducive to boost the capture efficacy and specificity, especially for greatly enhancing the capture performance of triple-negative breast cancer cells. Nevertheless, the capture effect of MCF-7 cells by using cocktail-Abs-MDNCs is not well as the effect using antiEpCAM-MDNCs, which may be attributed to that all Abs competitively occupied these conjugation sites on MDNCs, thus the capture efficacy of MCF-7 cells (overexpress EpCAM) suffered from this adverse effect. In addition, as given in Figure 3d, AbsMDNCs bound on these cells are directly observed. For SK-BR-3 and MDA-MB-231 cells, the number of cocktail-Abs-MDNCs attached on these cells is much more than anti-EpCAM-MDNCs, illustrating that recognition and cell-binding capability of MDNCs were enhanced by synergistic effect of multiple Abs. Furthermore, MDNSs and MDNCs decorated with multiple Abs were evaluated of their capture behavior against SK-BR-3 and MDA-MB-231 cells, and as shown in Figure S3, MDNCs are demonstrated again which still behave better than MDNSs. We further confirmed the captured cells viability using Calcein-AM staining (Figure S4a), which reveals that our strategy is almost harmless to cells. To determine whether the captured cells are suitable for downstream culture, the captured cells were subcultured in whole medium to detect the growth and proliferation at Day 2, Day 4 and Day 10 under microscope images (Figure S4b). The result suggests that the strategy has almost no effect on the proliferation ability of captured cells.

Having established the hetero-valency magnetic DNA nano-claws capture strategy, we tested the capture ability of MDNCs in clinical samples. Cocktail-Abs-MDNCs were


Page 12 of 26

Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


applied to capture CTCs in whole blood collected from breast cancer patients (Figure S5). Having been pretreated immediately, fresh whole blood was incubated with cocktail-Abs-MDNCs for magnetic isolation of CTCs, and then the isolated cells were identified via three-color immunofluorescent method33-34. As given in Figure 4a, cells stained with Hoechst+/PE-CK-/FITC-CD45+ were identified as WBCs while cells stained with Hoechst-/PE-CK+/FITC-CD45- were identified as CTCs. The CTCs number counted from fluorescent images ranges from 6 to 19 per 0.5mL in patient group while no CTC is detected in healthy people group (Figure 4b). Successful capture of CTCs from clinical samples actually demonstrates that cocktail-AbsMDNCs hold promise to play a key role in liquid biopsy field.

In addition to being an effective tool for isolating CTCs, MDNCs were explored more applications due to its modularity. We developed “dual-labeling” MDNCs labeled with fluorescence and Abs simultaneously, to provide a convenient way for identifying heterogeneous cancer cells visually (Figure 5a). Lacking expression of estrogen receptor (ER), progesterone receptor (PR) as well as HER-2, triple-negative breast cancer is regard as a dangerous type of breast cancer that result in few anticancer drugs work effectively.35 The expression level of HER-2 receptor is generally used to diagnose the type of breast cancer for treating with targeted therapeutic schedule.36-37 As proof of concept, HER-2 expression status of SK-BR-3 (positive for HER-2), MCF7 (negative for HER-2) and MDA-MB-231 (negative for HER-2) cells are profiled via the “dual-labeling” MDNCs which were labeled with fluorescence and anti-HER-2 to confirm the identification function of MDNCs.

Mimicking breast cancer patient’s blood, different artificial blood samples consisting of two cancer cell lines were incubated with the “dual-labeling” MDNCs respectively and identified under fluorescent microscope. As shown in Figure 5b, the multifunctional MDNCs are clearly observed to selectively binding on the cells of SKBR-3 rather than MDA-MB-231 and MCF-7, confirming that the MDNCs could precisely identify HER-2 positive cancer cells. And the quantification of relative



fluorescence intensity proves again the excellent identification capability of the multifunctional MDNCs (Figure 5c). In a word, it was demonstrated that MDNCs could be explored multi functions and have shown great promise to profile molecule expression status of CTCs at single cell level. In the future, “dual-labeling” MDNCs are expected to be improved as a whole system consisting of functions of rare CTCs capture, isolation, profiling and sorting.

4. CONCLUSIONS: In summary, inspired from the synergy in biological process, we developed a magnetic DNA nanostructure with hetero-valency claws (MDNCs) to recognize target specifically and isolate CTCs efficiently. Assembled MDNCs exhibits excellent capture ability to cancer cells, especially to triple negative breast cancer cells, and is successfully applied to detect CTCs in clinical samples. The ways to accomplish such improvement are concluded as: 1) High recognition effect and further promoted capture performance achieved by multiple Abs acting in synergy; 2) The DNA nano-claws structure with rigidity and flexibility could be more close to the cell membrane to access targets easily and could load more Abs. For the magnetic DNA nano-claws strategy, not only its outstanding performance of CTCs capture is proved, its identification function to profile cell subtype is also favorably demonstrated. In short, benefiting from its properties of well-modification and modularity, we believe that MDNCs could be decorated with various biomolecules to extend broad applications in areas of biosensing and cancer diagnosis in the future.

ASSOCIATED CONTENT Supporting Information Fluorescent images for characterizations about MDNSs, MDNCs and Abs-MDNCs, the loading ability of MDNSs and MDNCs to load DNA probe of different concentration, capture efficiency about cocktail-Abs-MDNSs and cocktail-Abs-MDNCs to capture SK-BR-3, MDA-MB-231 cells, images about cell viability assay and re-culture


Page 14 of 26

Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


captured cells, schematic diagram for capturing CTCs in patients’ blood samples.

AUTHOR INFORMATION Corresponding Author: *Email: [email protected]. *Email: [email protected]. *Email: [email protected]. ORCID： Yuanqing Zhang：0000-0002-8761-5328 Chunhai Fan: 0000-0002-7171-7338 Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENT: We thank the National Key R&D Program of China (2016YFA0201200), the National Natural Science Foundation of China (81601571, 81771932 and 21705167) and Guangdong

Natural

Science

Fund

for

Distinguished

Young

Scholars

(2017A030306016 and 2016A030306004) for financial support.

REFERENCES: (1) Rehermann, B.; Nascimbeni, M. Immunology of Hepatitis B Virus and Hepatitis C Virus Infection. Nat. Rev. Immunol. 2005, 5, 215-229. (2) Don Ganem, M. D.; Prince, A. M.; D, M. Hepatitis B Virus Infection — Natural History and Clinical Consequences. N. Engl. J. Med. 2004, 350, 1118-29. (3) Bullough, F. M. H. P. A.; Skehel, J. J.; Wiely, D. C. Structrue of Influenz Haemagglutinin at the pH of Membrane Funsion. Nature 1994, 433, 834-841.



(4) Fauci, A. The Human Immunodeficiency Virus: Infectivity and Mechanisms of Pathogenesis. Science 1988, 239, 617-622. (5) Lianidou,E. S.; Markou, A. Circulating Tumor Cells in Breast Cancer: Detection Systems, Molecular Characterization, and Future Challenges. Clin Chem. 2011, 57, 1242-1255. (6) Alix-Panabieres, C; Pantel, K. Challenges in Circulating Tumour Cell Research. Nat. Rev. Cancer 2014, 14, 623-631. (7) Siravegna, G.; Marsoni, S.; Siena, S.; Bardelli, A. Integrating Liquid Biopsies into the management of cancer. Nat. Rev. Clin. Oncol. 2017, 14, 531-548. (8) Yoon, H. J.; Kim, T. H.; Zhang, Z.; Azizi, E.; Pham, T. M.; Paoletti, C.; Lin J.; Ramnath, N.; Wicha, M. S.; Hayes, D. F.; Simeone, D. M.; Nagrath, S. Sensitive Capture of Circulating Tumour Cells by Functionalized Graphene Oxide Nanosheets. Nat. Nanotechnol. 2013, 8, 735-741. (9) Park, M. H.; Reategui, E.; Li, W.; Tessier, S. N.; Wong, K. H.; Jensen, A. E.; Thapar, V.; Ting, D.; Toner, M.; Stott, S. L.; Hammond, P. T. Enhanced Isolation and Release of Circulating Tumor Cells Using Nanoparticle Binding and Ligand Exchange in a Microfluidic Chip. J. Am. Chem. Soc. 2017, 139, 2741-2749. (10) Nagrath, S.; Sequist, L. V.; Maheswaran, S.; Bell, D. W.; Irimia, D.; Ulkus, L.; Smith, M. R.; Kwak, E. L.; Digumarthy, S.; Muzikansky, A.; Ryan, P.; Balis, U. J.; Tompkins, R. G.; Haber, D. A.; Toner, M. Isolation of Rare Circulating Tumour Cells in Cancer Patients by Microchip Technology. Nature 2007, 450, 1235-1239. (11) Xiong, K.; Wei, W.; Jin, Y.; Wang, S.; Zhao, D.; Wang, S.; Gao, X.; Qiao, C.; Yue, H.; Ma, G.; Xie, H. Y. Biomimetic Immuno ‐ Magnetosomes for High ‐ Performance Enrichment of Circulating Tumor Cells. Adv. Mater. 2016, 28, 7929-7935. (12) Mahla Poudineh, M. L.; Ahmed, S.; Matthew Nguyen, L. N.; Kermanshah L.; Mohamadi, R. M.; Sargent E. H.; Kelley. S. O. Profiling Functional and Biochemical Phenotypes of Circulating Tumor Cells Using a Two-Dimensional Sorting Device. Angew. Chem. 2017, 56, 163-8. (13) Wang, S.; Liu, K.; Liu, J.; Yu, Z. T.; Xu, X.; Zhao, L.; Lee, T.; Lee, E. K.; Reiss, J.; Lee, Y. K.; Chung, L. W.; Huang, J.; Rettig, M.; Seligson, D.; Duraiswamy, K. N.;


Page 16 of 26

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Shen, C. K.; Tseng, H. R. Highly Efficient Capture of Circulating Tumor Cells by Using Nanostructured Silicon Substrates with Integrated Chaotic Micromixers. Angew. Chem. 2011, 50, 3084-3088. (14) Navin, N.; Kendall, J.; Troge, J.; Andrews, P.; Rodgers, L.; McIndoo, J.; Cook, K.; Stepansky, A.; Levy, D.; Esposito, D.; Muthuswamy, L.; Krasnitz, A.; McCombie, W. R.; Hicks, J.; Wigler, M. Tumour Evolution Inferred by Single-Cell Sequencing. Nature 2011, 472, 90-94. (15) Yu, A. B. M.; Wittner, B. S.; Stott, S. L.; Smas, M. E.; Ting, D. T.; Isakoff, S. J.; Ciciliano, J. C.; Wells, M. N.; Shah, A. M.; Concannon, K. F.; Donaldson, M. C.; Sequist, L. V.; Brachtel, E.; Sgroi, D. Circulating Breast Tumor Cells Exhibit Dynamic Changes in Epithelial and Mesenchymal Composition. Science. 2013, 339, 580-584. (16) Went, P. T. H.; Lugli, A.; Meier, S.; Bundi, M.; Mirlacher, M.; Sauter, G.; Dirnhofer, S. Frequent EpCam protein expression in human carcinomas. Hum. Patho. 2004, 35, 122-128. (17) Seeman, N. C. Nanomaterials Based on DNA. Annu. Rev. Biochem. 2010, 79, 6587. (18) Jones, M. R.; Seeman, N. C.; Mirkin, C. A. Programmable Materials and the Nature of the DNA Bond. Science 2015, 347, 1260901. (19) Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E. M.; Hogele, A.; Simmel, F. C.; Govorov, A. O.; Liedl, T. DNA-based Self-Assembly of Chiral Plasmonic Nanostructures with Tailored Optical Response. Nature 2012, 483, 311-314. (20) Ali, M. M.; Li, F.; Zhang, Z.; Zhang, K.; Kang, D. K.; Ankrum, J. A.; Le, X. C.; Zhao, W., Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine. Chem. Soc. Rev. 2014, 43 (10), 3324-41. (21) Anne, A.; Agnès Bouchardon, A.; Moiroux, J., 3‘-Ferrocene-Labeled Oligonucleotide Chains End-Tethered to Gold Electrode Surfaces: Novel Model Systems for Exploring Flexibility of Short DNA Using Cyclic Voltammetry. J. Am. Chem. Soc. 2003, 125 (5), 1112-3. (22) (a) Yanli, Z.; Ying, W.; Haibo, W.; Jian-Hui, J.; Guo-Li, S.; Ru-Qin, Y.; Jinghong, L., Electrochemical DNA biosensor based on the proximity-dependent surface



hybridization assay. Anal. Chem. 2009, 81 (5), 1982-1987. (23) Pan, D.; Zuo, X.; Wan, Y.; Wang, L.; Zhang, J.; Song, S.; Fan, C., Electrochemical Interrogation of Interactions between Surface-Confined DNA and Methylene Blue. Sensors 2007, 7 (11), 2671-2680. (24) Zhang, Y.; Wang, Y.; Wang, H.; Jiang, J. H.; Shen, G. L.; Yu, R. Q.; Li, J., Electrochemical DNA Biosensor Based on the Proximity-Dependent Surface Hybridization Assay. Anal. Chem. 2009, 81 (5), 1982-1987. (25) Zhu, G.; Hu, R.; Zhao, Z.; Chen, Z.; Zhang, X.; Tan, W. Noncanonical SelfAssembly of Multifunctional DNA Nanoflowers for Biomedical Applications. J. Am. Chem. Soc. 2013, 135, 16438-16445. (26) Han, S.; Lee, J. S.; Lee, J. B. Synthesis of Multi-Functional DNA Nanosphere Barcode System for Direct Cell Detection. Nanoscale 2017, 9, 14094-14102. (27) Zhao, W.; Gao, Y.; Kandadai, S. A.; Brook, M. A.; Li, Y. DNA Polymerization on Gold Nanoparticles through Rolling Circle Amplification: Towards Novel Scaffolds for Three‐Dimensional Periodic Nanoassemblies. Angew. Chem. 2006, 45, 2409-2413. (28) Yan, J.; Hu, C.; Wang, P.; Zhao, B.; Ouyang, X.; Zhou, J.; Liu, R.; He, D.; Fan, C.; Song, S. Growth and Origami Folding of DNA on Nanoparticles for HighEfficiency Molecular Transport in Cellular Imaging and Drug Delivery. Angew. Chem. 2015, 54, 2431-2435. (29) Scher, H. I.; Graf, R. P.; Schreiber, N. A.; McLaughlin, B.; Jendrisak, A.; Wang, Y.; Lee, J.; Greene, S.; Krupa, R.; Lu, D.; Bamford, P.; Louw, J. E.; Dugan, L.; Vargas, H. A.; Fleisher, M.; Landers, M.; Heller, G.; Dittamore, R. Phenotypic Heterogeneity of Circulating Tumor Cells Informs Clinical Decisions between AR Signaling Inhibitors and Taxanes in Metastatic Prostate Cancer. Cancer Res. 2017, 77, 5687-5698. (30) Zhao, L.; Tang, C.; Xu, L.; Zhang, Z.; Li, X.; Hu, H.; Cheng, S.; Zhou, W.; Huang, M.; Fong, A.; Liu, B.; Tseng, H. R.; Gao, H.; Liu, Y.; Fang, X. Enhanced and Differential Capture of Circulating Tumor Cells from Lung Cancer Patients by Microfluidic Assays Using Aptamer Cocktail. Small 2016, 12, 1072-1081. (31) Osta, W. A.; Chen, Y.; Mikhitarian, Kaidi.; Mitas, M.; Salem, M.; Hannun, Y. A.; Cole, D. J.; Gillanders, E. W. EpCAM Is Overexpressed in Breast Cancer and Is a


Page 18 of 26

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Potential Target for Breast Cancer Gene Therapy. Cancer Res. 2004, 64, 5818-5824. (32) Wilson, C. A.; Cajulis, E. E.; Green, J. L.; Olsen, T. M.; Chung, Y. A.; Damore, M. A.; Dering, J.; Calzone, F. J.; Slamon, D. J. HER-2 Overexpression Differentially Alters Transforming Growth Factor-β Responses in Luminal Versus Mesenchymal Human Breast Cancer Cells. Breast Cancer Res. 2005, 7, R1058-1079. (33) Hui, L.; Su, Y.; Ye, T.; Liu, Z.; Tian, Q.; He, C.; Zhao, Y.; Chen, P.; Wang, X.; Han, W.; Luo, Y.; Wang, B., Self-Sterilizing and Regeneratable Microchip for the Precise Capture and Recovery of Viable Circulating Tumor Cells from Patients with Cancer. ACS Appl. Mater. Interfaces 2018, 10 (1), 207-218.; (34) Peng, J.; Zhao, Q.; Zheng, W.; Li, W.; Li, P.; Zhu, L.; Liu, X.; Shao, B.; Li, H.; Wang, C.; Yang, Y., Peptide-Functionalized Nanomaterials for the Efficient Isolation of HER2-Positive Circulating Tumor Cells. ACS Appl. Mater. Interfaces 2017, 9 (22), 18423-18428. (35) Lehmann, B. D.; Bauer, J. A.; Chen, X.; Sanders, M. E.; Chakravarthy, A. B.; Shyr, Y.; Pietenpol, J. A. Identification of Human Triple-Negative Breast Cancer Subtypes and Preclinical Models for Selection of Targeted Therapies. J. Clin. Invest. 2011, 121, 2750-2767. (36) Jordan, N. V.; Bardia, A.; Wittner, B. S.; Benes, C.; Ligorio, M.; Zheng, Y.; Yu, M.; Sundaresan, T. K.; Licausi, J. A.; Desai, R.; O’Keefe, R. M.; Ebright, R. Y.; Boukhali, M.; Sil, S.; Onozato, M. L.; Iafrate, A. J.; Kapur, R.; Sgroi, D.; Ting, D. T.; Toner, M.; Ramaswamy, S.; Haas, W.; Maheswaran, S.; Haber, D. A. HER2 Expression Identifies Dynamic Functional States Within Circulating Breast Cancer Cells. Nature 2016, 537, 102-106. (37) Wu, L. L.; Tang, M.; Zhang, Z. L.; Qi, C. B.; Hu, J.; Ma, X. Y.; Pang, D. W. ChipAssisted Single-Cell Biomarker Profiling of Heterogeneous Circulating Tumor Cells Using Multifunctional Nanospheres. Anal. Chem. 2018, 90, 10518-10526.



Scheme 1. Schematic diagram of MDNCs, MDNSs, Abs-MDNCs and Abs-MDNSs illustrate their constructions.


Page 20 of 26

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Characterization of MDNCs and MDNSs. SEM images of a) naked MBs, b) MDNSs and c) MDNCs. d) Hydrated size (d.nm) and e)zeta potential (mV) of naked magnetic beads, MDNSs and MDNCs by DLS measurements. The PDI of naked MBs, MDNSs and MDNCs is 0.169, 0.198 and 0.156, respectively. f) Photograph of MDNCs solution before and after magnetic separation. Fluorescent images of g) Fluorescein-12 dUTP labeled MDNSs and its control group that without phi29 polymerase, h) MDNCs including FAM labeled DNA probes and its control group without phi29 polymerase, i) Cy3 IgG-Abs-MDNCs and its control group without Abs.



Figure 2. Comparison of cells binding ability between MDNSs and MDNCs. a) Fluorescent images of MDNSs and MDNCs which were treated with FAM labeled DNA probes of equivalent value (1μM). b) Quantification of normalized fluorescence intensity of MDNSs and MDNCs. Each experiment was repeated in at least 3 times. The error bars represent standard deviations of measurements within each experiment. c) Schemes of MDNSs and MDNCs binding with cancer cell on the membrane level respectively. d) Comparison of capture yields of MCF-7 cells using naked MBs, antiEpCAM-MBs, anti-EpCAM-MDNSs and anti-EpCAM-MDNCs. Each experiment was repeated in at least 3 times. The error bars represent standard deviations of measurements within each experiment. e) Bright, fluorescent and merged images of captured MCF-7 cell stained with CellTracker Deep Red. f) SEM image of MCF-7 cell that captured by anti-EpCAM-MDNCs.


Page 22 of 26

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Capture cancer cells using anti-EpCAM-MDNCs and cocktail- Abs-MDNCs. a) Confirming capture ability of anti-EpCAM-MDNCs to MCF-7 cells with different numbers. b) Capture efficiency and purity testing of anti-EpCAM -MDNCs in the cells mixture consisting of MCF-7 and HeLa cells. c) Comparison of capture efficiency to three cell lines between anti-EpCAM-MDNCs and cocktail -Abs-MDNCs. Each experiment in a) b) c) was repeated in at least 3 times. The error bars represent standard deviations of measurements within each experiment. d) Fluorescent images of MCF-7 /SK-BR-3/MDA-MB-231 cells captured by anti-EpCAM-MDNCs (the top images) and cocktail-Abs-MDNCs (the bottom images), respectively.



Figure 4. Capture CTCs in whole blood from clinical cancer patients using cocktail Abs-MDNCs. a) Fluorescent image of WBC and CTC basing on Three-color immunocytochemistry method. Aside from Hoechst-stained nucleus, PE-labeled CK/FITC-labeled CD 45+ was employed to identify WBC while PE-labeled CK+/FITClabeled CD 45- was used to identify CTC. b) CTCs count in the whole blood of 0.5mL from 2 healthy people and 7 breast cancer patients.


Page 24 of 26

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Identification function of MDNCs via dual labeling method to profile HER2 status taken on cancer cells. a) Fluorescent markers and affinity molecules were integrated into MDNCs to form “dual-labeling” MDNCs”. b) Comparison of identification of “dual-labeling” MDNCs to different cells mixture group by fluorescent images. (A)/ (B)/ (C) Group represent different cells mixture consisting MCF-7 and MDA-MB-231 cells /SK-Br-3 and MCF-7 cells /SK-Br-3 and MDA-MB-231 cells, respectively. Each cell lines were stained with different dyes (red fluorescence from CellTracker Deep Red and blue fluorescence from Hoechst 33342) to discrimination depending experiment requirement. c) Quantification of relative fluorescence intensity from MDNCs that attached on cells.



Table of Content.


Page 26 of 26

Virus-Mimicking Cell Capture Using Heterovalency Magnetic DNA

Recommend Documents