Doxorubicin and siRNA Codelivery via Chitosan-Coated pH

Article pubs.acs.org/molecularpharmaceutics

Doxorubicin and siRNA Codelivery via Chitosan-Coated pHResponsive Mixed Micellar Polyplexes for Enhanced Cancer Therapy in Multidrug-Resistant Tumors Adeel Masood Butt,†,∥ Mohd Cairul Iqbal Mohd Amin,*,† Haliza Katas,† Nor Azian Abdul Murad,§ Rahman Jamal,§ and Prashant Kesharwani⊥,# †

Centre for Drug Delivery Research, Faculty of Pharmacy, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, Kuala Lumpur 50300, Malaysia § UKM Medical Molecular Biology Institute (UMBI), Universiti Kebangsaan Malaysia (UKM), Jalan Ya’acob Latiff, Bandar Tun Razak, Cheras, Kuala Lumpur 56000, Malaysia ⊥ Use-inspired Biomaterials & Integrated Nano Delivery (U-BiND) Systems Laboratory, Department of Pharmaceutical Sciences, Eugene Applebaum College of Pharmacy and Health Sciences, Wayne State University, 259 Mack Avenue, Detroit, Michigan 48201, United States

ABSTRACT: This study investigated the potential of chitosan-coated mixed micellar nanocarriers (polyplexes) for codelivery of siRNA and doxorubicin (DOX). DOX-loaded mixed micelles (serving as cores) were prepared by thin film hydration method and coated with chitosan (CS, serving as outer shell), and complexed with multidrug resistance (MDR) inhibiting siRNA. Selective targeting was achieved by folic acid conjugation. The polyplexes showed pH-responsive enhanced DOX release in acidic tumor pH, resulting in higher intracellular accumulation, which was further augmented by downregulation of mdr-1 gene after treatment with siRNA-complexed polyplexes. In vitro cytotoxicity assay demonstrated an enhanced cytotoxicity in native 4T1 and multidrug-resistant 4T1-mdr cell lines, compared to free DOX. Furthermore, in vivo, polyplexes codelivery resulted in highest DOX accumulation and significantly reduced the tumor volume in mice with 4T1 and 4T1-mdr tumors as compared to the free DOX groups, leading to improved survival times in mice. In conclusion, codelivery of siRNA and DOX via polyplexes has excellent potential as targeted drug nanocarriers for treatment of MDR cancers. KEYWORDS: polymeric micelles, nanoparticles, doxorubicin siRNA codelivery, simultaneous delivery, cytotoxicity, breast cancer, multidrug resistance

■

INTRODUCTION

Paclitaxel was encapsulated in PEG−PE micelles, improving its efficacy to inhibit tumors in vivo, as well as enhancing the apoptosis in MCF-7 cells in vitro.5 Diao and colleagues showed that encapsulating DOX in polyethylene glycol−polycaprolactone (PEG−PCL) micelles improved its cytotoxicity in drug resistant K562 cells.6 Various other polymers have been used for micelle based delivery of DOX, such as a mixture of vitamin E derivatives (TOS and TPGS2000), which improved cytotox-

Ample focus has been placed on using micelles as drug delivery systems for the treatment of various forms of cancer because of their characteristic and unique property of penetrating and accumulating in tumors (the enhanced permeability and retention (EPR) effect).1 In addition, the encapsulation of drugs within micelles provides benefits such as improved solubility and enhanced blood circulation times, reduced side effects, and enhanced antineoplastic activity. To date, a number of drugs has been encapsulated in micelles to obtain one of the above benefits, such as enhanced drug activity or solubility. For example, Pluronic block copolymers (poloxamers) have been used extensively to deliver small hydrophobic drugs.2−4 © 2016 American Chemical Society

Received: Revised: Accepted: Published: 4179

August 23, 2016 October 8, 2016 October 24, 2016 October 24, 2016 DOI: 10.1021/acs.molpharmaceut.6b00776 Mol. Pharmaceutics 2016, 13, 4179−4190

Article

Molecular Pharmaceutics Scheme 1. Schematic of the Preparation Method for Polyplexes and Mechanism of Improved Therapeutic Efficacy of Doxorubicin (DOX) in MDR Cellsa

a

After injection into the blood circulation, polyplexes target the tumors and release DOX in tumor microenvironment due to acidic pH and folate receptor targeting. Free DOX is pumped out of the cells by drug efflux pumps. However, when DOX is delivered by polyplexes, drug efflux pumps are inhibited by downregulation of mdr-1 gene due to siRNA mediated knockdown and micellar nanocarriers, improving its efficacy in multidrugresistant cancers.

icity, reducing the IC50 from 58 to 5 μg/mL in MCF-7 cells and prompting 100% long-term survival in MCF-7 and CT26 tumor models.7 Another micellar formulation, NK911 (PEG− poly(aspartic acid) conjugated to doxorubicin), has reached phase II clinical trials against metastatic pancreatic cancer.1 Similarly, a mixed micellar formulation of Pluronic (SP1049C) encapsulating DOX has reached stage 3 clinical trials.4 Recently, stimuli-responsive drug delivery approaches (particularly pH-responsive drug delivery) have been widely explored for anticancer treatments.8 Chitosan, owing to its excellent biocompatibility, has been widely used for the development of drug delivery systems. It has been reported that CS could provide pH-responsive drug release because of its amino groups that can be protonated at acidic pH.8 For example, porous silica layers were capped with a CS-based hydrogel film and used for insulin delivery. The CS film acted as a pH-responsive barrier to control insulin release, blocking the release at pH 7.4 and releasing pH 6.9 A major problem with chemotherapeutic anticancer drugs is the development of multidrug resistance (MDR), which reduces the therapeutic efficacy. One approach to overcome this problem is to use nanocarriers such as liposomes,10

nanoparticles,11 or micellar systems.12,13 Furthermore, the use of siRNAs that target particular genes has been shown to reduce resistance problems.14 However, delivering siRNA to tumor cells is a major challenge as enzymes present in the circulation degrade siRNA or it is immediately cleared by the reticuloendothelial system (RES) once inside the body.15 To overcome this problem, siRNA may be complexed with oppositely charged macromolecules such as chitosan16 or polyethylenimine17 forming nanoparticles or micelles.18 Codelivery of siRNA and encapsulated anticancer drugs is a promising approach to improve therapeutic efficacy. Various studies have shown that nanocarrier based codelivery of drugs with siRNA against the MDR genes suppressed P-glycoprotein (P-gp) expression in drug resistant cell lines, which in turn increased the retention of encapsulated drugs.19−21 Although, codelivery of siRNA and drugs is a promising approach, there is a major issue with designing these nanocarriers. Most of the anticancer drugs are highly hydrophobic in nature whereas siRNA is hydrophilic, resulting in reduced loading efficiencies.14 Here, we report a novel but simple approach to overcome this problem. DOX encapsulated in mixed micelles (for 4180

DOI: 10.1021/acs.molpharmaceut.6b00776 Mol. Pharmaceutics 2016, 13, 4179−4190

Article

Molecular Pharmaceutics

CAIRUL/12-DEC/484-DEC-2012-DEC-2013). Handling and euthanization were carried out as per the ethical guidelines. The mice were provided with free access to food and water and observed every day for any signs of illness or discomfort. The cages were cleaned, and the bedding was changed every 3 days. The temperature set at 22−24 °C and a 12 h dark/light cycle was used. Mice were acclimatized for at least 2 weeks before the start of experiments. Mice were kept on gamma irradiated laboratory animal rodent diet. The groups treated with FA functionalized micelles or polyplexes were fed a special diet, which did not contain FA (FA deficient diet; Altromin C1027, Bielefeld, Germany). In these groups, mice were fed the folate free diet for at least 4 weeks prior to the beginning of the experiments. The FA free diet was continued for the entire time course of the experiments. Synthesis and Characterization of Folate Conjugated CS. FA was conjugated to CS by carbodiimide coupling reaction as previously reported.25 Briefly, FA was reacted with NHS followed by DCC. Activated FA was then reacted with CS and final product was purified by centrifugation, dialysis, and freeze-drying. The conjugation of CS with FA was confirmed by NMR analysis. Degree of substitution of FA was determined by UV visible spectroscopy, as previously described.26 Briefly, a known amount of dried CS−FA conjugate was dissolved in dimethysulfoxide (DMSO), and its UV absorbance at 365 nm was measured to determine the concentration of FA in the conjugate. Serially diluted FA in DMSO was used to construct a calibration curve. Preparation of Micelles and Polyplexes. Micelles and polyplexes were prepared by thin film hydration and simple complexation method. Briefly, PF127 (20 mg) and TPGS (1 mg) were dissolved in chloroform and mixed micelles were prepared by the thin film hydration method as previously reported.13 Mixed micelles were then coated with CS or CS-FA (20 mg, 1 mg/mL in acetate buffer pH 4.5). For preparation of polyplexes, siRNA (13.5 μg, 10 μM) was added to the prepared CS or CS-FA coated mixed micelles and vortexed vigorously. After vortexing for 30 s, polyplexes were incubated at room temperature for 1 h in order to allow for siRNA complexation with the micelles. TPGS was added to micelle preparations to overcome the low EE and DLC as well as to obtain polyplexes that had enhanced stability, due to the emulsifying characteristics of TPGS. In addition, it has been hypothesized that TPGS has therapeutic enhancing properties such as overcoming MDR and selectively targeting cancer cells, which could improve the therapeutic efficacy of DOX or other codelivered anticancer drugs. For preparation of DOX-siRNA coloaded polyplexes, DOX was encapsulated in mixed micelles prior to CS coating. After CS coating, siRNA was complexed to the micelles as previously described. Physicochemical Characterization of Micelles and Polyplexes. For size and zeta potential measurement, freshly prepared micelles or polyplexes (with or without FA, at pH 7.4 and pH 5) were suspended in deionized water or phosphate buffer. Size and zeta potential was determined by dynamic light scattering (25 °C in triplicate) using a zetasizer (Zetasizer Nano ZS, Malvern Instruments, Malvern, UK). Morphology was visualized by transmission electron microscopy (TEM, Tecnai Spirit, FEI, Eindhoven, Netherlands), and critical micelles concentration (CMC) was determined by KI/I2 method.27 DOX loading and EE were determined by UV method as previously reported.28 The loading efficiency of

improved stability) served as cores and were coated with CS, which functioned to entrap and complex siRNA on the polyplex surface (Scheme 1). The mixed micellar core was formed by PF127, a block copolymer of poly(ethylene oxide) (PEO) and poly(propylene oxide) (PPO), and TPGS, a water-soluble derivative of vitamin E that has the potential to synergize with the actions of drugs such as DOX, enhancing the therapeutic efficacy as well as reducing MDR.13,22,23 The outer coating of cationic CS was used to allow for the delivery of siRNA and to provide pHresponsiveness.24 In addition, FA conjugation serves to reduce the off-target effects and further enhances the therapeutic efficacy. All these characteristics could enhance the efficacy of DOX against MDR cancer cells. In this study, DOXencapsulating mixed micellar polyplexes decorated with chitosan-folate were developed. Size, zeta-potential, CMC, in vitro and in vivo DOX uptake into tumor cells, gene silencing efficacy, in vitro cytotoxicity, and in vivo antitumor activities were assessed.

■

EXPERIMENTAL SECTION Materials. Pluronic F127 (PF127), chitosan (CS, low molecular weight), TPGS, dicyclohexyl carbodimide (DCC), N-hydroxy succinimide (NHS), folic acid (FA), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). DOX hydrochloride (DOX.HCl) was purchased from EMD Biosciences (Calbiochem, San Diego, CA, USA). Triethylamine, diethyl pyrocarbonate (DEPC), dichloromethane (DCM), chloroform, Geneticin (G418), Triton X-100 (TX-100), and 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) were purchased from Merck Schuchardt OHG (Hohenbrunn, Germany). Plasmid vector with ORF clones of human ABC, subfamily B, member 1 (MDR1/ABCB1), were obtained from Origene (Rockville, MD, USA). Lipofectamine RNAi Max transfection reagent, trypsin-ethylenediaminetetraacetic acid (EDTA), Roswell Park Memorial Institute medium (RPMI-1640), Dulbecco’s modified Eagle’s medium (DMEM), and Fetal Bovine Serum (FBS) were purchased from Life Technologies (Gibco, Carlsbad, CA, USA). DyNAmo cDNA synthesis kit and DyNAmo color flash SYBR green qPCR kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Short interfering RNA (siRNA) targeting the ATP-binding cassette subfamily B member 1 (ABCB1)/mdr-1 gene (sense sequence: 5′GUUUGUCUACAGUUCGUAAtt-3′ was purchased from Life Technologies (Carlsbad, CA, USA). Cell Lines and Animals. 4T1 and WRL-68 cells were obtained from ATCC and were maintained as per ATCC guidelines. 4T1 cells were cultured in RPMI 1640 medium containing 10% FBS at 37 °C in a 95% air −5% CO2 atmosphere. WRL-68 cells were cultured in similar conditions using DMEM. Cells were regularly passaged at approximately 80% confluence. 4T1-mdr cells were obtained by transfection and selection of 4T1 cells with transfection ready pDNA encoding for the ABCB1 gene (mdr-1) as per instructions by manufacturer. Four to six week-old female BALB/c mice were obtained from the animal house UKM and maintained in a specific pathogen free environment in the transgenic lab of the UKM Medical Molecular Biology Institute (UMBI) at the Laboratory Animal Handling Unit of the Universiti Kebangsaan Malaysia (LARU, UKM). This study was approved by the animal ethics committee of the Universiti Kebangsaan Malaysia (FF/2012/ 4181


Article


°C, and stored at −80 °C until determination of DOX pharmacokinetics by HPLC analysis. The data obtained from HPLC was analyzed by PKSolver software.32 The data was fitted using the noncompartmental analysis (NCA) option in the software. The parameters obtained included, area under the curve (AUC0‑t) from the first to last time point, mean residence time (MRT), half-life time (t1/2), volume of distribution (Vd), and clearance. In Vivo Antitumor Efficacy Study. Tumors were induced by either orthotopic or tail vein injection, or by subcutaneous implantation. Tumors were treated by administration of free DOX or DOX-loaded micelles or polyplexes by tail vein injection (4 mg/kg). Tumor size was recorded every 3 days and tumor volume was calculated by the formula (L × W2)/2 where L and W represent the greatest longitudinal diameter or length and greatest transverse diameter or width of the tumors. Mice were euthanized after completion of the experiments by cervical dislocation under isoflurane anesthesia. Blood was collected in microcentrifuge tubes (prerinsed with 6% EDTA solution) by cardiac puncture, and the plasma was collected and stored. Survival Analysis. Animals were divided into five groups (n = 6). A control included healthy mice without tumors. The groups containing mice with tumor models received normal saline, free DOX, DOX-loaded micelles, or DOX-loaded polyplexes. Treatment was continued for 2 months or until there were no surviving animals in the saline or DOX groups, at which point the mice were euthanized and organs were collected for analysis. During the treatment, mice were monitored for any signs of illness or weight loss and were sacrificed if weight loss was >25% of the starting weight. For the orthotopic model, the control group received no tumor cells, whereas other groups received orthotopic implantations of 1 × 105 4T1 or 4T1-mdr cells. For the experimental metastasis model, 5 × 104 4T1 or 4T1-mdr cells were injected by tail vein. Treatment with DOX or DOX-loaded micelles was administered as previously described and the number of surviving animals was noted at each time point. Survival curves were plotted against time. In Vivo and ex Vivo Optical Imaging of DOX Uptake in Tumors. Free DOX or DOX-loaded polyplexes were administered by tail vein injection (10 mg/kg) in 4T1-mdr tumor bearing mice, 24 h before imaging. Back of the mice was shaved under isofluorane anesthesia before imaging, and mice were placed into iBox Scientia Small Animal Imaging System (UVP, CA, USA). After whole-body in vivo imaging, mice were euthanized and tumors were excised and directly imaged (exposure time was set at 30 s for fluorescence images). Histological Examination. After treatment completion, organs (liver, heart, kidney, and spleen) and tumor tissues were excised and fixed in 10% neutral buffered formalin. The formaldehyde-fixed tissue samples were embedded in paraffin, processed, and stained with haematoxylin and eosin (H&E). Lungs were first immersed in Bouin’s fixative for 24 h followed by extensive washing in 70% ethanol to prepare for counting of the metastatic lung nodules. Statistical Analysis. The data are shown as mean values with standard deviations, of a minimum of three independent experiments. Statistical analysis was performed with Graph Pad Prism (GraphPad 5.0 Software, CA, USA) by one-way ANOVA followed by posthoc Tukey or Dunnett’s multiple-comparison test.

siRNA was determined using a nanoquant plate,29 and the binding efficiency of siRNA with polyplexes was visualized by gel electrophoresis.30 The ability of polyplexes to protect the complexed siRNA was evaluated by serum protection assay as described earlier.31 The drug release studies were carried out in pH 5 and 7.4 release media using the dialysis bag method previously described.28 Cytotoxicity of DOX-Loaded Micelles. The cytotoxicity of free DOX and DOX-loaded polyplexes was evaluated in 4T1 or 4T1-mdr cell lines using an MTT assay. Mouse mammary carcinoma 4T1 or 4T1-mdr cells were seeded in 96-well plates at a density of 104 cells per well. The next day, the exhausted medium was changed with fresh media containing DOX, DOXloaded micelles, or DOX-loaded polyplexes. Treatment was carried out for 48 h following after which cells were washed with PBS and 100 μL fresh medium containing 10% MTT was added to all the wells. Cells were then incubated for 4 h. Subsequently, the medium containing MTT was carefully removed, and the formazan crystals were dissolved by the addition of 100 μL of acidified isopropanol (0.04 N HCl in IPA). Plates were incubated for an additional 20 min and read at 570 nm using a microplate reader (Infinite M200; Tecan, Männedorf, Switzerland). Intracellular DOX Uptake Assay. Intracellular DOX uptake assay was performed using a fluorescence method. 4T1 or 4T1-mdr cells were seeded (1 × 106 cells per dish) in 35 mm culture dishes and allowed to reach confluence. The culture medium was exchanged for media containing 50 μM DOX, DOX-loaded micelles, or DOX-loaded polyplexes, and cells were incubated for 4 h to allow uptake to take place. After the incubation period, the treatment medium was aspirated. Cells were washed with ice cold PBS three times and lysed with 1 mL of 1% Triton X-100. DOX concentration was determined using a fluorescence microplate reader. For fluorescence imaging, the cells were washed with PBS and stained with Hoechst 33342 after incubation with DOX, DOX-loaded micelles, or DOX-loaded polyplexes. Images were captured under a fluorescence microscope to visualize the uptake of DOX. Real-Time qRT-PCR for Gene Expression Analysis. 4T1-mdr cells (5 × 105) were seeded in 12-well plates and transfected with naked siRNA, siRNA complexed with lipofectamine, or polyplexes for 48 h. Post-transfection, cells were washed with PBS and lysed directly in the plate wells using Trizol reagent. Total RNA was extracted and reverse transcribed using DyNAmo cDNA synthesis kit. Real time qRT-PCR was performed on a Bio-Rad CFX Connect RealTime PCR system using DyNAmo color flash SYBR green qPCR kit as per manufacturer instructions. The primers sequences used for amplification of mdr-1 mRNA were TGCTGGTTGCTGCTGCTTACA for forward and GCCTATCTCCTGTCGCATTATAG for reverse primer (amplicon size 110). GAPDH was used as internal reference gene, forward primer AACAGCAACTCCCACTCTTC and reverse primer sequence CCTGTTGCTGTAGCCGTATT (amplicon size 111). In Vivo Studies. Pharmacokinetics of DOX and DOXLoaded Polyplexes in BALB/c Mice. For the pharmacokinetic evaluation of DOX, 8−10 week-old female BALB/c mice were used. Free DOX or DOX-loaded polyplexes were administered by single I.V. injection (10 mg/kg). At each time point, three mice were sacrificed and blood was collected for analysis. The plasma was retrieved by centrifugation at 2000g for 10 min at 4 4182


Article


■

RESULTS AND DISCUSSION Synthesis and Characterization of FA Conjugated CS. The formation of folate conjugated CS was confirmed by 1H NMR. As shown in Figure 1, the 1H NMR spectrum of FA

Figure 2. (a) CMC of polyplexes determined by KI/I2 method. (b) TEM image of polyplexes. (c) In vitro release profiles of DOX at pH 7 (physiological) and pH 5 (tumor mimicking). Each data point represents mean ± SD of three separate experiments, n = 3. (d) Electrophoretic mobility of siRNA and polyplexes at different N/P CS/siRNA ratios. (e) Stability of naked siRNA and siRNA complexed with polyplexes in the presence of serum.

Figure 1. 1H NMR spectra of CS-FA conjugate, FA, and CS.

shows a signal at 8.62 ppm, which corresponds to the C7 H of the pterin ring. Signals at 8.15, 7.66, 6.93, 6.70, 4.48, 4.30, 2.51, and 1.08−2.09 correspond to the FA protons from H18, H13/ 15, H10, H12/16, H9, H19, H22, and H21, respectively. The 1 H NMR spectrum of CS-FA showed the characteristic FA peaks at 6.70 and 7.55 ppm corresponding to the aromatic protons of FA (at (H12/16) and (H13/15), respectively), as well as at 8.62 ppm corresponding to C7 H of FA.33 Furthermore, FA protons also appear at 2.09 ppm. In addition, the peak at 3.03 ppm corresponded to the C2 H of CS, and the peaks in the region 3.3−3.8 ppm corresponded to the CS hydrogens at C3−C6. The degree of substitution on a molarto-molar basis was 4:1 mol of FA to CS. The concentration of FA in the conjugate was 14 ± 1%, whereas the degree of substitution of FA onto CS was 7 ± 0.4%, as determined from UV measurements. Folic acid has an α- and γ-carboxylic acid group, with γ-carboxylic group having higher activity than αcarboxylic group. The DCC/NHS method has been shown to be selective toward the activation of γ-carboxylic group, and therefore, there should be no concerns with its specificity for the active sites of folate receptors.34 Characterization of Micelles and Polyplexes. CMC is one of the most important parameters in determining the in vivo stability of micelles. As the encapsulation efficiency (EE) of DOX was lower when using PF127 alone, TPGS was used to produce mixed micelles with increased EE. Furthermore, adding TPGS to PF127 reduced the CMC (Figure 2a), which was previously reported to be due to increased hydrophobic interactions.28 The low CMC suggests a stable micellar system, which could withstand the dilution that occurs with injection into the blood.35 If CMC is high, the micelles tend to dissociate more easily upon dilution in the blood; therefore, the lower the CMC, the better the stability and lesser dissociation upon dilution. The CMC in our study was 0.001% or 0.01 mg/mL, and we injected 100 μL of 1 mg/mL of polyplexes in the mice. Considering that a 25 g mouse has a blood volume of around 1.7 mL,36 the injected polyplexes concentration was 0.058 mg/mL, about 6 times higher than the

CMC of the polymer, indicating the stability on dilution for the micelles used in the present study. The average size of the polyplexes, as determined by dynamic light scattering (DLS) measurements, was 92 ± 11 and 101 ± 10 nm with a low polydispersity index (PDI, 0.222 ± 0.007 and 0.317 ± 0.011), whereas the zeta potential was 7 ± 2 and 10 ± 3 mV at simulated physiological (7.4) and tumor (5) pH, respectively. The small polyplex size can be advantageous for passive targeting as the polyplexes could penetrate the solid tumors and accumulate by the EPR effect. As shown in Figure 2b, the TEM analysis reported similar polyplexes size and a spherical morphology. The drug loading content (DLC) and EE of DOX were 18 ± 2.1% and 72 ± 7%, respectively. DOX release from polyplexes exhibited a pH-responsive behavior, as it was affected by the pH of the release media. As shown in Figure 2c, DOX release from micelles was lesser at pH 7.4 than at pH 5. After 1 week, only 38% of DOX was released from micelles at pH 7.4 compared to 70% at pH 5. This release pattern is similar to that in our previous report on DOX release from PF127-TPGS mixed micelles.28 However, DOX release from polyplexes was slower, which could be due to the presence of electrostatic interactions and the additional CS-siRNA surface layer that hinder DOX release. Furthermore, the presence of CS could also play a role in this pH-responsive DOX release, as the amine groups become protonated at low pH, which improves CS solubility. The loading efficiency of siRNA in polyplexes was >95%, and a strong binding with polyplexes was shown in gel retardation assay (Figure 2d) at CS to siRNA N/P ratios of 100:1, 50:1, and 10:1. It can thus be suggested that negatively charged phosphates of siRNA and positive CS chains interacted with each other to form stable complexes. The polyplexes protected siRNA from degradation in serum as a result of the complexation between CS and siRNA (Figure 2e). 4183


Article

Molecular Pharmaceutics Codelivery with siRNA Enhances Intracellular DOX Uptake by Reducing mdr-1 Expression. Effect of mdr-1 siRNA loaded polyplexes on gene silencing of mdr gene in drug resistant 4T1-mdr cells was investigated by real-time qRT-PCR as shown in Figure 3a. The mdr-1 siRNA delivery by polyplexes

intracellular DOX is an important indicator of the effectiveness of the micellar system. A cellular uptake study was carried out using fluorescence measurements, in order to investigate the effect of DOX-loaded micelles or polyplexes in 4T1-mdr cells. 4T1 or 4T1-mdr cells were seeded in 6-well plates at 1 × 106 cells per well and incubated with free DOX, DOX-loaded micelles, or DOX-loaded polyplexes. With the 4T1 cells, minimal intracellular DOX levels (5.27 ng/μg of protein) were found in the free DOX control group. However, DOX uptake almost doubled in the groups treated with DOX-loaded micelles (10 ng/μg of protein) or polyplexes (12 ng/μg of protein). This could be attributed to properties of TPGS that increase selective uptake in breast cancer cell lines, ultimately leading to enhanced cytotoxic activity. In 4T1 cells, although DOX uptake was enhanced when using micelles or polyplexes, the difference among the polyplexes and micelle groups was not significant (Figure 3b). However, in 4T1-mdr cells, DOX uptake significantly increased in the group treated with polyplexes (5 ng/μg of protein) compared to both the control (0.36 ng/μg of protein) and micelle (2.74 ng/μg of protein) treated groups (Figure 3c). This can be explained by a reduction in drug efflux caused by the presence of TPGS and siRNA targeted against the mdr-1 gene. Suppression of mdr-1 gene expression resulted in reduced drug efflux and enhanced uptake of DOX in cells. The fluorescence microscopy of cells (Figure 3d) showed that after treatment most of the DOX was distributed in cytoplasm and that nuclear levels were low in free DOX group. This could be due to the efflux of DOX from the cells. The treatment of cells with DOX encapsulated in micelles showed improved accumulation in the nucleus, which was perhaps due to the enhanced uptake due to the presence of TPGS and selective uptake via folate receptors. The treatment of cells with DOX encapsulated in polyplexes resulted in an enhanced accumulation, and strong DOX fluorescence was observed in the nucleus. This again could be attributed to the reduced drug efflux due to downregulation of mdr-1 gene and enhanced uptake due to the TPGS and folate receptor targeting in breast cancer cells. Based on these findings, it was suggested that the enhanced uptake could improve DOX cytotoxicity. In Vitro Cytotoxicity and in Vivo Antitumor Efficacy of DOX Is Enhanced When Delivered by Polyplexes. Encapsulation of DOX within micelle cores was shown to improve drug circulation times in the blood, which could enhance DOX cytotoxicity.2 This enhancement was also seen in our study and could occur because of increased contact times caused by the muco-adhesive properties of the CS coating the micelles. Moreover, TPGS has selective anticancer activity against breast cancer cells, which serves to improve cytotoxicity.39 It has been previously shown that TPGS produces reactive oxygen species (ROS), which enhances the toxicity of DOX.7 In addition, downregulation of mdr-1 gene enhances DOX uptake, which results in improved cytotoxicity. As shown by MTT assay, the encapsulation of DOX in polyplexes produced a pronounced enhancement in cytotoxicity that in turn caused a marked reduction in the IC50 (Figure 4a,b). In 4T1 cells, the IC50 of DOX was reduced from 664 to 148 nM (Figure 4c). The reduction in IC50 could be due to the reduced drug efflux and enhanced DOX retention previously observed in cells treated with DOX-loaded micelles or polyplexes (Figure 3b,c) due to the mdr-1 gene suppression. Furthermore, blank micelles or polyplexes did not cause any

Figure 3. (a) Suppression of mdr-1 gene expression quantified by realtime qRT-PCR. (b) Quantitative DOX uptake in 4T1 cells and (c) 4T1-mdr cells after treatment with DOX or DOX encapsulated in micelle or polyplexes determined by the fluorescence measurements. Data represents mean ± SD of three separate experiments, n = 3. (d) Intracellular uptake in 4T1-mdr cells 4 h after incubation with DOX, DOX-loaded micelles. or DOX-loaded polyplexes.

reduced the mdr-1 gene expression by 70% as compared to 89% reduction via commercial transfection reagent (Lipofectamine RNAi Max). Naked siRNA showed 60 days. In the experimental metastasis model (Figure 5B(b and d)), similar trends were observed although the overall survival times were reduced. The mice in groups treated with polyplexes had the longest surviving population with more than 50% of the animals surviving after 4 weeks. The enhanced efficacy of DOX-loaded micelles or polyplexes was likely a key factor in the improved survival times. The improvement in DOX efficacy was due to the prolonged blood circulation times of PF127 micelle protected DOX, the selective anticancer activity of TPGS, the selective FA mediated tumor targeting, the reduced RES clearance, and the muco-adhesive property of CS. In addition, the siRNA-mediated reduction of MDR improved the therapeutic efficacy of DOX, extending survival times. Treatment with DOX-Loaded Polyplexes Reduces Metastasis of 4T1 Cells in BALB/c Mice. The improved survival rates were coupled to reductions in metastasis. The control group receiving saline had the lowest survival rate, and analysis of the total number of lung nodules showed that these mice had the highest tumor burden, followed by the group treated with free DOX, which showed considerably lower metastasis of 4T1 cells (Figure 5A). However, with 4T1-mdr cells, the number of metastatic foci, or lung nodules, was greater, and treatment efficacy and survival were both reduced. For the evaluation of the tumor burden, lungs were resected, washed with saline, and fixed in Bouin’s fixative for 24 h. The number of nodules on the lung surface was counted. As observed with tumor volumes, the DOX group showed significant improvement over the control group; the number of lung nodules was 88 and 56, respectively, when 4T1 cells were used (Figure 5A(b)). However, in the mice with DOX resistant 4T1-mdr tumors, the number of nodules on the lung surface did not significantly decrease with free DOX treatment (44 nodules compared to 69 in the control group). In contrast, the DOX-loaded polyplexes group had reduced nodule numbers (23 with 4T1 and 11 with 4T1-mdr cells), as well as reduced nodule sizes, compared to the control or DOX groups. This could be due to the enhanced selectivity of polyplexes, which could both restrict the growth of primary tumors as well as kill metastatic cells in the circulation. Histology. After free DOX or encapsulated DOX treatment, a central necrotic area was observed in tumors as shown in Figure 6b. This central necrotic area was caused by the cell death triggered by DOX. The peripheral areas contained neutrophils, a sign of inflammation, and tumor cells. The tumor cells were typical of cancers, showing poor differentiation, large

Figure 5. (A) (a) Images of lungs fixed in Bouin’s fixative for analysis and counting of lung nodules in mice implanted with 1 × 106 cells in the 4th inguinal mammary fat pads. (b) Number of nodules on lung surfaces in mice orthotopically implanted with 4T1 and 4T1-mdr tumors. Data represents mean ± SD (of three replicates, n = 3), *p < 0.05, **p < 0.01. (B) Kaplan−Meier survival curves showing effect of DOX or DOX encapsulated in micelles or polyplexes on the survival. The BALB/c mice were either orthotopically implanted with 4T1 (a) or 4T1-mdr cells (c). Two groups received tail vein injection of 4T1 (b) or 4T1-mdr cells (d). 4186


Article


DOX cardiotoxicity. However, when DOX was encapsulated in polyplexes, little or no damage to cardiomyocytes was observed and the extracellular matrix structure was intact. This could be because of the FA and TPGS mediated selective tumor targeting, the lower drug release in blood circulation, and the avoidance of RES mediated uptake as a result of the presence of PF127 and CS in the polyplexes. DOX causes damage to cells through the formation of reactive intermediates (semiquinones), which react with molecular oxygen resulting in the formation of reactive oxygen species (ROS) that ultimately damage cellular structures. It has previously been shown that vitamin E has free radical quenching activity.43 It is hypothesized that damage to myocardial cells may have been avoided due to the presence of TPGS, which reduced myocardial damage by scavenging the ROS. In the present study, DOX treatment damaged the normal morphology of tissues; however, treatment with DOX encapsulated in polyplexes protected the normal morphology, which indicates the advantages of using polyplexes for DOX delivery. The H&E stained liver sections from the control group showed normal hepatocyte histology with a round to oval nucleus and an eosinophilic cytoplasm containing a number of organelles. However, the livers of mice treated with free DOX contained cells with pyknotic nuclei, as well as inflammatory cells, indicative of cell damage. Interestingly, the livers of mice treated with DOX-loaded polyplexes exhibited large neutrophilic infiltrates possibly because of the nonspecific capture of polyplexes in the liver by RES. However, the liver sections of the mice treated with polyplexes showed no damage to the cells, and their morphology was similar to that of the salinetreated control group. This protection could have been afforded by the following reasons: first, due to reduced drug release at physiological pH (in normal tissue) as shown by the in vitro release experiments. Second, the uptake of polyplexes in the liver was minimal because polyplexes had folic acid as a targeting ligand. In addition, the passive targeting to tumors also reduced the uptake of polyplexes in other organs including the liver, thus providing protection against the DOX-induced damage. Similarly, the spleen and kidney structures in mice treated with DOX-loaded polyplexes were preserved and closely resembled the histology of the control group, whereas in the spleen of mice treated with free DOX there was disruption of the typical red and white pulp structure. However, in mice treated with DOX-loaded polyplexes, the red and white pulp structure was retained, which also showed that polyplexes provided protection against DOX-induced damage to the normal tissues. The H&E lung sections (Figure 6c) of the control group indicated that nearly the whole lung was covered with tumor cells, whereas DOX treatment reduced the tumor burden. The groups treated with DOX-loaded polyplexes had limited areas of tumor growth, in both 4T1 and 4T1-mdr tumor models. This explains the longer survival times of the animals receiving DOX-loaded polyplexes. Encapsulation in Polyplexes Enhances in Vivo Uptake of DOX in Tumors. It was shown that the encapsulation of DOX in polyplexes enhanced its in vitro cellular uptake (Figure 3b,c). Similarly, the DOX levels in tumors increased with the use of polyplexes. The results of the HPLC quantification are shown in Figure 7a. It was found that the tumor accumulation of DOX was enhanced by more than 2-fold in 4T1 tumors

Figure 6. (a) H&E stained histological sections of heart, kidneys, liver, and spleen of BALB/c mice in control, DOX, or DOX encapsulated in polyplexes. (b) H&E stained tumor sections treated with saline, DOX, or polyplexes encapsulating DOX. The saline group shows mostly viable cells with typical loose tumor vasculature. The groups treated with DOX and polyplexes show large necrotic areas with few viable cells. The necrotic zones are larger in sections from groups treated with DOX encapsulated in polyplexes. (c) H&E stained sections of lungs showing efficacy of treatment on the metastasis inhibition in BALB/c mice implanted with either 4T1 or 4T1-mdr cells.

nuclei, and comparably smaller cytoplasm.42 In the tumors treated with polyplexes, large necrotic areas were observed, which contained some viable but unhealthy cells that had vacuolated matrices. Treatment with DOX-loaded polyplexes caused more damage to the tumors as compared to free DOX treatment, indicating the improved efficacy. The large necrotic areas that arose after treatment with DOX-loaded polyplexes were caused by the enhanced antitumor activity of DOX brought about by the multiple synergistic factors previously discussed. The H&E stained vital organs sections are shown in Figure 6a. The hearts of the control group revealed normal cardiac cell structure with intact myocytes and little or no change in the extracellular matrix structure. H&E stained sections of myocardium from free DOX treated mice had altered myocardial structures indicative of DOX induced myocardial damage. The myocardial damage was seen as patchy interstitial fibrosis and vacuolated cardiomyocytes, which are hallmarks of 4187


Article


times attributable to micellar encapsulation. In addition, polyplexes show enhanced DOX release at acidic tumor pH and knockdown of mdr gene, which could have improved its uptake in tumors and resulted in enhanced therapeutic effects. Pharmacokinetics of DOX Encapsulated in Polyplexes. The DOX plasma profile after tail vein injection was similar to that in previous reports, showing a rapid drop in levels within the first few hours.46,47 As shown in Figure 7c, a similar trend was observed with DOX-loaded polyplexes; however, the levels steadied after the initial drop in concentration. The initial drop was perhaps due to rapid clearance and distribution of the released DOX into tissues, but the steady phase may be due to slow release of DOX from polyplexes. Furthermore, as shown in Table 1, analysis of the obtained data showed that DOX-loaded polyplexes improved t1/2 from Table 1. Pharmacokinetic Data Obtained from the Plasma Concentration vs. Time Curve after a Single I.V. Bolus Injection of DOX or Polyplexes (10 mg/kg)a parameter

DOX

polyplexes

t1/2 (h) AUC (mg·h·L−1) MRT (h) Cl (L·h−1·kg) Vss (L·kg−1)

25.4 2.5 31.6 1.5 50.4

46.1 7.8 67.5 0.5 34.2

a

The values were obtained by analysis of averaged data from three samples per time point.

25 to 46 h. MRT also increased, whereas clearance was reduced, which resulted in an improved AUC. It could be suggested that the improved MRT of DOX-loaded polyplexes was due to reduced clearance by avoiding RES uptake. This reduced uptake could be because the polyplexes contain PF127 and TPGS, which have poly(ethylene oxide) and polyethylene glycol in their structures, both of which could reduce the interaction with RES and avoid detection by the immune system. Although the PEG segments of chitosan were covered by CS shell, CS itself is hydrophilic and CS coating has been shown to evade the RES.48 Furthermore, another study by Ishak et al.49 reported the shielding effects of chitosan shell on nanocarriers. They found that the presence of chitosan improved the surface hydrophilicity of nanoparticles and that chitosan-coated nanoparticles showed lesser RES uptake than the negatively charged polysorbate 80-coated nanoparticles. They suggested that chitosan-coated nanoparticles evaded phagocytosis and had prolonged blood circulation due to its positive charge and hydrophilicity. Therefore, in our opinion the polyplexes could withstand the RES mediated clearance. Besides, the possibility of presence of some PF127 and TPGS molecules on the surface of polyplexes cannot be ruled out. We would like to emphasize that the whole point of using TPGS and PF127 was not only to provide RES evasion but also to use their beneficial and synergistic effects to enhance the cytotoxicity of doxorubicin; therefore, the conclusions drawn were not solely based on avoiding the RES clearance. It is noteworthy that the polyplexes had considerable efficacy in reducing the tumor size and metastasis, which also indicates the efficacy of polyplexes. It was also observed that DOX plasma levels from DOXloaded polyplexes were higher compared to those from free DOX treatment, this could be due to the lower clearance and

Figure 7. (a) DOX concentration in 4T1 or 4T1-mdr tumors 24 h after tail vein injection of either free DOX or DOX encapsulated in micelles or polyplexes (10 mg/kg). Data represents mean ± SD (of six samples obtained from different animals, n = 6), *p < 0.05, **p < 0.01, and ***p < 0.001. (b) Optical images of in vivo and ex vivo DOX uptake in tumors. (c) Plasma concentration time plots of free DOX or DOX encapsulated in polyplexes after a single I.V. administration of DOX (10 mg/kg).

treated with DOX-loaded micelles or polyplexes. Administration of free DOX resulted in 8.22 μg/g of DOX in tumor tissues, which was increased to 22.6 and 24 μg/g of tumor tissues in groups treated with DOX-loaded micelles or polyplexes, respectively. The difference between micelle or polyplexes uptake was insignificant in the 4T1 tumors. However, the DOX accumulation in 4T1-mdr tumors was significantly greater with DOX-loaded polyplexes than with DOX-loaded micelles. With polyplexes delivery, DOX tumor levels increased by more than 3-fold over that for DOX-loaded micelles or 12-fold over that for free DOX solution. The DOX content in groups treated with free DOX, DOX-loaded micelles, or DOX-loaded polyplexes were 1.45, 5.24, and 18.1 μg/g of tumor tissues, respectively. In vivo and ex vivo optical imaging also showed improved DOX accumulation in 4T1-mdr tumors when delivered by polyplexes as compared to free DOX (Figure 7b). This was perhaps because of the reduction of MDR due to mdr-1 gene suppression, which led to improved DOX uptake and accumulation in the tumors. The micelles in general improved the uptake and accumulation of DOX in tumors due to the FA44 and TPGS mediated selective uptake,23 the improved retention by EPR effect,45 and the prolonged blood circulation 4188


Article


PEG-PE−Based Micellar Nanopreparations Targeted with TumorSpecific Landscape Phage Fusion Protein Enhance Apoptosis and Efficiently Reduce Tumors. Mol. Cancer Ther. 2014, 13, 2864−2875. (6) Diao, Y.-Y.; Li, H.-Y.; Fu, Y.-H.; Han, M.; Hu, Y.-L.; Jiang, H.-L.; Tsutsumi, Y.; Wei, Q.-C.; Chen, D.-W.; Gao, J.-Q. Doxorubicin-loaded PEG-PCL copolymer micelles enhance cytotoxicity and intracellular accumulation of doxorubicin in adriamycin-resistant tumor cells. Int. J. Nanomed. 2011, 6, 1955−62. (7) Danhier, F.; Kouhé, T. T. B.; Duhem, N.; Ucakar, B.; Staub, A.; Draoui, N.; Feron, O.; Préat, V. Vitamin E-based micelles enhance the anticancer activity of doxorubicin. Int. J. Pharm. 2014, 476, 9−15. (8) Mura, S.; Nicolas, J.; Couvreur, P. Stimuli-responsive nanocarriers for drug delivery. Nat. Mater. 2013, 12, 991−1003. (9) Wu, J.; Sailor, M. J. Chitosan Hydrogel-Capped Porous SiO2 as a pH Responsive Nano-Valve for Triggered Release of Insulin. Adv. Funct. Mater. 2009, 19, 733−741. (10) Deng, Z.; Yan, F.; Jin, Q.; Li, F.; Wu, J.; Liu, X.; Zheng, H. Reversal of multidrug resistance phenotype in human breast cancer cells using doxorubicin-liposome−microbubble complexes assisted by ultrasound. J. Controlled Release 2014, 174, 109−116. (11) Pan, L.; Liu, J.; He, Q.; Wang, L.; Shi, J. Overcoming multidrug resistance of cancer cells by direct intranuclear drug delivery using TAT-conjugated mesoporous silica nanoparticles. Biomaterials 2013, 34, 2719−2730. (12) Qiu, L.; Qiao, M.; Chen, Q.; Tian, C.; Long, M.; Wang, M.; Li, Z.; Hu, W.; Li, G.; Cheng, L. Enhanced effect of pH-sensitive mixed copolymer micelles for overcoming multidrug resistance of doxorubicin. Biomaterials 2014, 35, 9877−9887. (13) Butt, A. M.; Amin, M. C. I. M.; Katas, H. Synergistic effect of pH-responsive folate-functionalized poloxamer 407-TPGS-mixed micelles on targeted delivery of anticancer drugs. Int. J. Nanomed. 2015, 10, 1321−1334. (14) Conde, J.; Jesús, M.; Baptista, P. V. Nanomaterials for reversion of multidrug resistance in cancer: a new hope for an old idea? Front. Pharmacol. 2013, 4, 134. (15) Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking down barriers: advances in siRNA delivery. Nat. Rev. Drug Discovery 2009, 8, 129−138. (16) Mao, S.; Sun, W.; Kissel, T. Chitosan-based formulations for delivery of DNA and siRNA. Adv. Drug Delivery Rev. 2010, 62, 12−27. (17) Al-Abd, A. M.; Lee, S. H.; Kim, S. H.; Cha, J.-H.; Park, T. G.; Lee, S. J.; Kuh, H.-J. Penetration and efficacy of VEGF siRNA using polyelectrolyte complex micelles in a human solid tumor model invitro. J. Controlled Release 2009, 137, 130−135. (18) Wang, Y.; Fang, J.; Cheng, D.; Wang, Y.; Shuai, X. A pHsensitive micelle for codelivery of siRNA and doxorubicin to hepatoma cells. Polymer 2014, 55, 3217−3226. (19) Susa, M.; Iyer, A. K.; Liu, X.; Choy, E.; Hornicek, F. J.; Mankin, H.; Milane, L.; Amiji, M. M.; Duan, Z. Inhibition of ABCB1 (MDR1) expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma. PLoS One 2010, 5, e10764. (20) Xiong, X.-B.; Lavasanifar, A. Traceable Multifunctional Micellar Nanocarriers for Cancer-Targeted Co-delivery of MDR-1 siRNA and Doxorubicin. ACS Nano 2011, 5, 5202−5213. (21) Saraswathy, M.; Gong, S. Recent developments in the codelivery of siRNA and small molecule anticancer drugs for cancer treatment. Mater. Today 2014, 17, 298−306. (22) Nguyen, H. N.; Hoang, T. M. N.; Mai, T. T. T.; Nguyen, T. Q. T.; Do, H. D.; Pham, T. H.; Nguyen, T. L.; Ha, P. T. Enhanced cellular uptake and cytotoxicity of folate decorated doxorubicin loaded PLATPGS nanoparticles. Adv. Nat. Sci.: Nanosci. Nanotechnol. 2015, 6, 025005. (23) Zhang, J.; Tao, W.; Chen, Y.; Chang, D.; Wang, T.; Zhang, X.; Mei, L.; Zeng, X.; Huang, L. Doxorubicin-loaded star-shaped copolymer PLGA-vitamin E TPGS nanoparticles for lung cancer therapy. J. Mater. Sci.: Mater. Med. 2015, 26, 165. (24) Popat, A.; Liu, J.; Lu, G. Q.; Qiao, S. Z. A pH-responsive drug delivery system based on chitosan coated mesoporous silica nanoparticles. J. Mater. Chem. 2012, 22, 11173−11178.

prolonged circulation times brought by encapsulation in polyplexes. Furthermore, the polyplexes were coated in CS and siRNA, which were bound together by the electrostatic interactions. It has been shown that CS reduces RES mediated uptake, which could also account for the prolonged blood circulation time48 and enhanced cytotoxicity. Chitosan used in this study was not water-soluble, which poses significant challenge in use in the preparation of drug delivery carriers. However, this limitation can be overcome by use of water-soluble chitosan, which is currently being explored. Furthermore, we used doxorubicin in this study as the model drug. The future studies should consider using other drugs for the delivery to tumors.

■

CONCLUSIONS The current data suggests that CS-coated PF127-TPGS mixed micelle based DOX delivery is beneficial, and improved therapeutic effects can be achieved with dual targeting by incorporating RNA interference (RNAi) approach. The pHresponsive release of DOX from polyplexes improved its therapeutic efficacy. The DOX-loaded polyplexes showed enhanced in vivo antitumor efficacy and prolonged blood circulation times. It could be suggested that CS-coated mixed micellar polyplexes have potential as systems for simultaneous delivery of siRNA and DOX. Nonetheless, further detailed studies on the molecular basis of the mechanisms of enhanced tumor uptake and retention are still required.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +603 9289 7690. Fax: +603 2698 3271. E-mail: [email protected] or [email protected]. Present Addresses ∥

(A.M.B.) Department of Pharmacy, The University of Lahore, Gujrat Campus, Adjacent Chenab Bridge, 50700 Gujrat, Pakistan. # (P.K.) Department of Pharmaceutical Technology, School of Pharmacy, The International Medical University, Jalan Jalil Perkasa 19, Kuala Lumpur 57000, Malaysia. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was carried out with support from research grant (GUP-SK-07-23-045), from the Universiti Kebangsaan, Malaysia, and from Science Fund (02-01-02-SF0738), from Ministry of Science, Technology and Innovation (MOSTI), Malaysia.

■

REFERENCES

(1) Cabral, H.; Kataoka, K. Progress of drug-loaded polymeric micelles into clinical studies. J. Controlled Release 2014, 190, 465−476. (2) Li, X.; Yu, Y.; Ji, Q.; Qiu, L. Targeted delivery of anticancer drugs by aptamer AS1411 mediated Pluronic F127/cyclodextrin-linked polymer composite micelles. Nanomedicine 2015, 11, 175−184. (3) Basak, R.; Bandyopadhyay, R. Encapsulation of Hydrophobic Drugs in Pluronic F127 Micelles: Effects of Drug Hydrophobicity, Solution Temperature, and pH. Langmuir 2013, 29, 4350−4356. (4) Pitto-Barry, A.; Barry, N. P. Pluronic® block-copolymers in medicine: from chemical and biological versatility to rationalisation and clinical advances. Polym. Chem. 2014, 5, 3291−3297. (5) Wang, T.; Yang, S.; Mei, L. A.; Parmar, C. K.; Gillespie, J. W.; Praveen, K. P.; Petrenko, V. A.; Torchilin, V. P. Paclitaxel-Loaded 4189


Article

Molecular Pharmaceutics (25) Ji, J.; Wu, D.; Liu, L.; Chen, J.; Xu, Y. Preparation, characterization, and in vitro release of folic acid-conjugated chitosan nanoparticles loaded with methotrexate for targeted delivery. Polym. Bull. 2012, 68, 1707−1720. (26) Yoo, H. S.; Park, T. G. Folate receptor targeted biodegradable polymeric doxorubicin micelles. J. Controlled Release 2004, 96, 273−83. (27) Cholkar, K.; Hariharan, S.; Gunda, S.; Mitra, A. Optimization of Dexamethasone Mixed Nanomicellar Formulation. AAPS PharmSciTech 2014, 15, 1454−1467. (28) Butt, A. M.; Amin, M. C. I. M.; Katas, H.; Sarisuta, N.; Witoonsaridsilp, W.; Benjakul, R. In vitro characterization of pluronic F127 and D-α-tocopheryl polyethylene glycol 1000 succinate mixed micelles as nanocarriers for targeted anticancer-drug delivery. J. Nanomater. 2012, 2012, 112. (29) Wei, W.; Lv, P.-P.; Chen, X.-M.; Yue, Z.-G.; Fu, Q.; Liu, S.-Y.; Yue, H.; Ma, G.-H. Codelivery of mTERT siRNA and paclitaxel by chitosan-based nanoparticles promoted synergistic tumor suppression. Biomaterials 2013, 34, 3912−3923. (30) Amjad, M. W.; Amin, M. C. I. M.; Katas, H.; Butt, A. M.; Kesharwani, P.; Iyer, A. K. In Vivo Antitumor Activity of FolateConjugated Cholic Acid-Polyethylenimine Micelles for the Codelivery of Doxorubicin and siRNA to Colorectal Adenocarcinomas. Mol. Pharmaceutics 2015, 12, 4247−4258. (31) Deng, X.; Cao, M.; Zhang, J.; Hu, K.; Yin, Z.; Zhou, Z.; Xiao, X.; Yang, Y.; Sheng, W.; Wu, Y.; Zeng, Y. Hyaluronic acid-chitosan nanoparticles for co-delivery of MiR-34a and doxorubicin in therapy against triple negative breast cancer. Biomaterials 2014, 35, 4333− 4344. (32) Zhang, Y.; Huo, M.; Zhou, J.; Xie, S. PKSolver: An add-in program for pharmacokinetic and pharmacodynamic data analysis in Microsoft Excel. Comput. Methods Programs Biomed. 2010, 99, 306− 314. (33) Wan, A.; Sun, Y.; Li, H. Characterization of folate-graft-chitosan as a scaffold for nitric oxide release. Int. J. Biol. Macromol. 2008, 43, 415−421. (34) Chul Cho, K.; Hoon Jeong, J.; Jung Chung, H.; Joe, C. O.; Wan Kim, S.; Gwan Park, T. Folate receptor-mediated intracellular delivery of recombinant caspase-3 for inducing apoptosis. J. Controlled Release 2005, 108, 121−31. (35) Giacomelli, C.; Borsali, R., Disordered Phase and SelfOrganization of Block Copolymer Systems. In Soft Matter Characterization; Borsali, R.; Pecora, R., Eds.; Springer: Dordrecht, Netherlands, 2008; pp 133−189. (36) Morton, S. W.; Zhao, X.; Quadir, M. A.; Hammond, P. T. FRET-enabled Biological Characterization of Polymeric Micelles. Biomaterials 2014, 35, 3489−3496. (37) Kanasty, R. L.; Whitehead, K. A.; Vegas, A. J.; Anderson, D. G. Action and reaction: the biological response to siRNA and its delivery vehicles. Mol. Ther. 2012, 20, 513−24. (38) Bartlett, D. W.; Davis, M. E. Insights into the kinetics of siRNAmediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res. 2006, 34, 322−333. (39) Neophytou, C. M.; Constantinou, C.; Papageorgis, P.; Constantinou, A. I. D-alpha-tocopheryl polyethylene glycol succinate (TPGS) induces cell cycle arrest and apoptosis selectively in Survivinoverexpressing breast cancer cells. Biochem. Pharmacol. 2014, 89, 31− 42. (40) Vernon, A. E.; Bakewell, S. J.; Chodosh, L. A. Deciphering the molecular basis of breast cancer metastasis with mouse models. Rev. Endocr. Metab. Disord. 2007, 8, 199−213. (41) Eckhardt, B. L.; Francis, P. A.; Parker, B. S.; Anderson, R. L. Strategies for the discovery and development of therapies for metastatic breast cancer. Nat. Rev. Drug Discovery 2012, 11, 479−497. (42) Tao, K.; Fang, M.; Alroy, J.; Sahagian, G. G. Imagable 4T1 model for the study of late stage breast cancer. BMC Cancer 2008, 8, 228. (43) Traber, M. G.; Atkinson, J. Vitamin E, antioxidant and nothing more. Free Radical Biol. Med. 2007, 43, 4−15.

(44) Lu, J.; Zhao, W.; Huang, Y.; Liu, H.; Marquez, R.; Gibbs, R. B.; Li, J.; Venkataramanan, R.; Xu, L.; Li, S. Targeted Delivery of Doxorubicin by Folic Acid-Decorated Dual Functional Nanocarrier. Mol. Pharmaceutics 2014, 11, 4164−4178. (45) Fang, J.; Nakamura, H.; Maeda, H. The EPR effect: unique features of tumor blood vessels for drug delivery, factors involved, and limitations and augmentation of the effect. Adv. Drug Delivery Rev. 2011, 63, 136−151. (46) Gaillard, P. J.; Appeldoorn, C. C.; Dorland, R.; van Kregten, J.; Manca, F.; Vugts, D. J.; Windhorst, B.; van Dongen, G. A.; de Vries, H. E.; Maussang, D. Pharmacokinetics, brain delivery, and efficacy in brain tumor-bearing mice of glutathione pegylated liposomal doxorubicin (2B3−101). PLoS One 2014, 9, e82331. (47) Kaminskas, L. M.; McLeod, V. M.; Kelly, B. D.; Sberna, G.; Boyd, B. J.; Williamson, M.; Owen, D. J.; Porter, C. J. A comparison of changes to doxorubicin pharmacokinetics, antitumor activity, and toxicity mediated by PEGylated dendrimer and PEGylated liposome drug delivery systems. Nanomedicine 2012, 8, 103−111. (48) Sarmento, B.; Mazzaglia, D.; Bonferoni, M. C.; Neto, A. P.; do Céu Monteiro, M.; Seabra, V. Effect of chitosan coating in overcoming the phagocytosis of insulin loaded solid lipid nanoparticles by mononuclear phagocyte system. Carbohydr. Polym. 2011, 84, 919− 925. (49) Ishak, R. A.; Awad, G. A.; Zaki, N. M.; El-Shamy Ael, H.; Mortada, N. D. A comparative study of chitosan shielding effect on nano-carriers hydrophilicity and biodistribution. Carbohydr. Polym. 2013, 94, 669−76.

4190


Doxorubicin and siRNA Codelivery via Chitosan-Coated pH

Recommend Documents