Dual Delivery of HNF4Î± and Cisplatin by Mesoporous Silica

Subscriber access provided by UNIV OF LOUISIANA

Biological and Medical Applications of Materials and Interfaces

Dual Delivery of HNF4# and Cisplatin by Mesoporous Silica Nanoparticles Inhibits Cancer Pluripotency and Tumorigenicity in Hepatoma-derived CD133-expressing Stem Cells Ping-Hsing Tsai, Mong-Lien Wang, Jen-Hsuan Chang, Aliaksandr A. Yarmishyn, Phan Nguyen Nhi Nguyen, Wei Chen, Yueh Chien, Teh-Ia Huo, Chung-Yuan Mou, and Shih-Hwa Chiou ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b04474 • Publication Date (Web): 08 May 2019 Downloaded from http://pubs.acs.org on May 8, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Dual Delivery of HNF4α and Cisplatin by Mesoporous Silica Nanoparticles Inhibits Cancer Pluripotency and Tumorigenicity in Hepatoma-derived CD133-expressing Stem Cells Ping-Hsing Tsai1.2*, Mong-Lien Wang1,2,5*, Jen-Hsuan Chang3, Aliaksandr A. Yarmishyn1, Phan Nguyen Nhi Nguyen1, Wei Chen3, Yueh Chien1,2, Teh-Ia Huo1,2,4, Chung-Yuan Mou3#, Shih-Hwa Chiou1,2,4# 1Department

of Medical Research, Taipei Veterans General Hospital, 11221, Taipei, Taiwan. 2School

of Medicine, National Yang-Ming University, Taipei, Taiwan. 3Department of Chemistry, National Taiwan University, Taipei 106 Taiwan. 4Institute of Pharmacology, National Yang-Ming University, 11221, Taipei, Taiwan. 5School of Pharmaceutical Sciences, National Yang-Ming University, Taipei11221, Taipei, Taiwan.

*equal co-first author

Correspondence: Shih-Hwa Chiou, MD, PhD. Institute of Pharmacology, National Yang-Ming University & Department of Medical Research and Education, Taipei Veterans General Hospital; Taipei, Taiwan. e-mail: [email protected] Chung-Yuan Mou, PhD. 2Department of Chemistry, National Taiwan University, Taipei 106 Taiwan. e-mail: [email protected]

Running title: MSN Dual-delivery eradicate HCC cancer stem cells

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Hepatocellular carcinoma (HCC) is one of the most prevalent and deadly malignancies characterized by high rate of recurrence. Tumor recurrence is often attributed to the presence of a subpopulation of cells with stem cell properties, referred to as cancer stem cells (CSCs). Traditionally, cancer therapies target the entire bulk of tumor cells, however, they are poorly effective against CSCs, characterized by higher drug resistance. Therefore, the approaches targeting CSCs may be required in addition to conventional chemotherapy in order to prevent the tumor recurrence. In this study, we investigated the approach to target HCC by combining conventional chemotherapeutic drug cisplatin to target the bulk of tumor cells, and differentiation therapy by delivering the gene encoding HNF4α, an important regulator of hepatocyte differentiation, to target CSCs. We used Huh7 cell line as an in vitro model of HCC, which is characterized by high proportion of CD133-expressing CSCs. By using flow cytometry, we separated CD133+ and CD133- Huh7 cell subpopulations, and have shown that the former has highly pronounced in vivo tumorigenic capacity in contrast to the latter, which could not generate tumors in vivo. For the dual delivery of HNF4α-encoding plasmid and cisplatin, we used polyethyleneimine-modified mesoporous silica nanoparticles (PMSNs) as the nanocarriers. Here, we show that the treatment of CD133-expressing Huh7 cells with HNF4α-loaded PMSNs can suppress their proliferation rate, decrease the proportion of CSCs, the expression of stemness-associated genes and increase the expression of mature hepatocyte-associated genes. At the same time, the treatment of Huh7 with PMSNs loaded with both HNF4α-encoding plasmid and cisplatin could block them in S-phase of cell cycle and cause apoptosis. In addition, dually loaded PMSNs were the most efficient formulation in suppressing tumor growth in vivo. To summarize, in this study we tested the nanoparticle-based delivery system for both chemotherapy and gene-based therapy agents, which is of great potential for development of effective treatment of HCC.

Keywords: Mesoporous silica nanoparticles, hepatocellular carcinoma, Huh7, differentiation therapy, gene delivery, HNF4α, CD133.


Page 2 of 28

Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction Hepatocellular carcinoma (HCC) is the sixth most common cancer worldwide and the third leading cause of cancer-related deaths.1 HCC is characterized by high genetic and phenotypic heterogeneity, multifocal occurrence, high metastatic proclivity, and high rate of recurrence, all these factors contribute to poor prognosis. The most effective treatment for HCC is liver transplantation, however, it is highly limited by the poor availability of donors. Other treatment approaches such as partial surgical resection, radiofrequency ablation, and chemotherapy are less effective due to metastatic spread and multifocal tumor occurrence. Therefore, there is an urgent need to improve the efficacy of systemic therapy approaches. Traditionally, the most common approach to target cancer is based on the clonal evolution model of carcinogenesis, also known as stochastic model. According to this model, a tumor originates from normal somatic cells, which progressively accumulate genetic mutations allowing the bulk of cancer cells to gain cancer hallmarks such as unrestrained proliferation, resistance to apoptosis, ability to metastasize and develop drug resistance. In such a model, any cell in the tumor population may have tumorigenic potential. The discovery of stem cell-like cells in tumors led to the proposal of cancer stem cell model, also known as hierarchical model of carcinogenesis. According to this model, tumor is organized in a hierarchical population of cells, which are not equipotent in their tumorigenic capacity. At the apex of such hierarchy are cancer stem cells (CSCs), which are able to self-renew and differentiate, and thus are responsible for tumor growth and spread. On the other hand, the bulk of the tumor cells is composed of the differentiated cancer cells, the progeny of CSCs, which have little or none tumorigenic potential. Whereas traditional therapeutic approaches aim to eliminate the bulk of tumor, they often leave out CSCs, generally characterized by higher drug resistance, which eventually leads to tumor relapse. Therefore, therapeutic methods based on hierarchical model specifically target CSCs, and thus have higher potential to prevent tumor recurrence.2,3 There are several strategies of targeting CSCs, including “destemming”, overcoming multidrug resistance, and targeting the CSC niche. The most direct approach is “destemming” CSCs by manipulating the pathways which would lead to differentiation and block of self-renewal.3 Lineage-specific transcription factors often serve as crucial regulators directing the process of cell differentiation and cell fate commitment, therefore, are of great potential for highly specific gene-based approaches for differentiation therapy. One of the most promising targets for



differentiation therapy of HCC is hepatocyte nuclear factor 4 alpha (HNF4α), which is a transcription factor responsible for the maintenance of the differentiated state and functional activity of hepatocytes.4,5 The expression of HNF4α has been shown to be impaired in HCC, its low levels were associated with poor differentiation, high metastatic potential, metabolic defects, and correlated with poor outcome in HCC patients.6,7 Recent years witnessed rapid growth of application of nanotechnology in biomedicine, particularly in the development of nanostructured materials for delivery of drugs and genes. Mesoporous silica nanoparticles (MSNs) represent a new generation of such materials and possess a number of properties that make them an excellent tool for drug and gene delivery.8 These features include ordered porous structure, tunable particle size, large pore volume and surface area, good biocompatibility.8 Targeting cancer by using nanoparticles for delivery of therapeutic agents into tumor cells is a promising therapeutic approach. The defective vasculature and lymphatic drainage allow preferential extravasation and accumulation of nanosized carriers in the tumors as compared to the normal tissues, the phenomenon known as enhanced permeability and retention (EPR) effect.9 Several parameters of MSNs such as pore size and environment, can be finely adjusted for carriage of specific anticancer chemicals. For example, MSNs were designed to effectively deliver hydrophobic anticancer agents, which may drastically improve the effectiveness of intravenous administration of such drugs, which is normally seriously hampered by their hydrophobicity.10 In addition, loading into MSNs can significantly enhance cytotoxicity of otherwise less potent anticancer drugs, as was shown in the case of cisplatin and its less potent derivative.11 Besides delivery of chemical drugs, MSNs can also be used as a carrier of the nucleic acids for gene transfection. Since the surface of MSNs is negatively charged, which hampers efficient binding of the negatively charged nucleic acids, chemical modification is usually required to introduce positive charge on the surface of MSNs. One of such modifications is coating with polyethyleneimine (PEI), a positively charged polymer that allows efficient binding of the nucleic acids such as DNA constructs and siRNAs, and thus enhances their uptake by the cells.12 Importantly, modified MSNs allow more efficient approach in targeting cancer cells by combined delivery of chemical drugs and nucleic acids.13 Therefore, in this study we investigated the approach to target HCC by combining conventional chemotherapeutic drug cisplatin to target the bulk of tumor cells, and differentiation therapy by delivering the gene encoding HNF4α using PMSNs as delivery


Page 4 of 28

Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


vehicles. We used Huh7 cell line, characterized by high proportion of CSCs, as in vitro model of HCC. We clearly demonstrated that dual delivery of cisplatin and HNF4α reduced tumorigenic capacity of Huh7 cells. 2. Material and methods 2.1. Cell culture The stable clones of CD133- and CD133+ Huh7 cells were cultured in DMEM culture medium (Gibco, New York, USA) containing 10% fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin under standard culturing conditions (37°C, 95% humidified air, 5% CO2). After every three days, the culture medium was removed and replaced with fresh medium. 2.2. Cell sorting and flow cytometry analysis One million Huh7 cells were labeled with anti-human CD133/2-PE antibody (Miltenyi Biotec, Auburn, CA). CD133+ and CD133- populations were sorted using a BD FACSCalibur (BD Biosciences, Falcon Lakes, NJ). Analysis was performed using FCS Express 4 Flow Cytometrysoftware (De Novo Software, USA). Positive and negative gates were determined using immunoglobulin G (IgG)-stained and unstained controls. 2.3. Plasmid construction and preparation Human HNF4A gene was cloned into pCMV-SPORT6 vector (Addgene) and the construct was confirmed by direct sequencing. The plasmid was amplified in DH5α E. coli cells, purified using PureLink HiPure Plasmid Maxiprep Kit (Thermo Fisher Scientific, Waltham, MA). 2.4. Quantitative real time PCR (qRT-PCR) Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. 1 μg of total RNA was reverse transcribed into cDNA using SuperScript III Reverse Transcriptase kit (Thermo Fisher Scientific). The amplification was performed in a total volume of 20 μl containing 0.5 mM of each primer, 4 mM MgCl2, 10 μl of SYBR Green Master Mix (Applied Biosystems, Foster City, CA) and 1 μl of 1:10 diluted cDNA, and the quantification was performed on 7900HT Fast Real-Time PCR System (Applied Biosystems). The primer sequences are shown in Table 1. GAPDH housekeeping gene was amplified as a reference standard in each experiment. Table 1 Primer sequences used for qRT-PCR.



Gene CD133 (PROM1) beta-catenin (CTNNB1) BMI1 LIN28B c-Myc (MYC) KLF4 SOX2 NANOG TCF4 Vimentin (VIM) SLUG (SNAI2) E-cadherin (CDH1) TWIST (TWIST1) WNT5A GS (GLUL) APOC3 CYP1A2 G6PC PEPCK (PCK1) BLVRA ALDOB APOA1 GYS2 HPD GAPDH

Forward primer (5’ to 3’) TTCTTGACCGACTGAGACCCA CATCTACACAGTTTGATGCTGCT CCACCTGATGTGTGTGCTTTG GCAGAAGATCACTCCGTTCCA GGCTCCTGGCAAAAGGTCA CGGACATCAACGACGTGAG ATCAGGAGTTGTCAAGGCAGAG TTTGTGGGCCTGAAGAAAACT CCGCTCCATTACCAAGAGCT GCAATCTTTCAGACAGGATGTTGAC ATTCAGGACAGCCCTGATTCTTC AGGAGGAGTTGGGTTCTG GTCCGCAGTCTTACGAGGAG ATTCTTGGTGGTCGCTAGGTA AAGAGTTGCCTGAGTGGAATTTC CCGCCAAGGATGCACTGAG CTGGGCACTTCGACCCTTAC ACTGGCTCAACCTCGTCTTTA GCCATCATGCCGTAGCATC CCTACAATGTTGGTCTCCCAGA GGCAGTTCCGAGAAATCCTCT CCCTGGGATCGAGTGAAGGA GTGGAACAGTGTGAACCTGTAA GAAACACGGTGACGGAGTGAA ACATGTGTAAGCTGCGGCC

Reverse primer (5’ to 3’) TCATGTTCTCCAACGCCTCTT GCAGTTTTGTCAGTTCAGGGA TTCAGTAGTGGTCTGGTCTTGT CATGCGCACATTGAACCACT CTGCGTAGTTGTGCTGATGT GACGCCTTCAGCACGAACT AGAGGCAAACTGGAATCAGGA AGGGCTGTCCTGAATAAGCAG ATCGTCTTCCCCTCTTTGGC GATTTCCTCTTCGTGGAGTTTCTTC TTTTTGCGACACTCTTCTCTGC GGAGTGGAGTCTGGAAGG GCTTGAGGGTCTGAATCTTGCT CGCCTTCTCCGATGTACTGC AGCTTGTTAGGGTCCTTACGG CTCCAGTAGTCTTTCAGGGAACT TCTCATCGCTACTCTCAGGGA CGGAAGTGTTGCTGTAGTAGTCA AGCCTCAGTTCCATCACAGAT AGTAACCAGTTGCCTTTTGGATT CTCCTTGGTCTAACTTGATTCCC CTGGGACACATAGTCTCTGCC AGGACTTCCTTCTATCAGCCAT CTCCCGCATGATTTTGGCG GTTGTGCATAGTCGCTGCTTG

2.5. Western blotting The cell lysates were separated by 10% SDS-PAGE and then transferred electrophoretically to polyvinylidene difluoride (PVDF) membrane, which was then blocked in Tris-buffered saline (TBS) containing 0.1% Tween 20 and 5% nonfat milk for 1 h. The PVDF membrane was incubated with primary antibodies against HNF4α (Cell Signaling Technology; 1:1000 dilution), CD133 (Cell Signaling Technology; 1:1000 dilution), ABCG2 (Abcam; 1:1000), and β-tubulin (Cell Signaling Technology; 1:10000) overnight at 4°C. The PVDF membranes were extensively washed to remove unbound primary antibodies and then incubated with secondary immunoglobulin G antibody (Cell Signaling Technology; 1:5000) for 1 h at room temperature. Protein bands were visualized with the enhanced chemiluminescence substrate kit (Amersham Pharmacia Biotech, UK) according to the manufacturer’s protocol. 2.6. Synthesis of PMSNs 0.58 g of hexadecyltrimethylammonium bromide (C16TAB) was dissolved in 300 mL of 1.02 M aqueous ammonia solution, and 5 mL of 0.22 M tetraethyl orthosilicate (TEOS)/ethanol solution was added with stirring and incubated for 1 h at 40°C. Then, 5 mL of 0.88 M TEOS/Ethanol solution was added dropwise with vigorous stirring and left to react for 1 h and aged statically at 40°C for another 24 h to complete the silica condensation. The synthesized product was collected by centrifugation and washed with 95% ethanol three


Page 6 of 28

Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


times. The surfactant was extracted by NH4NO3/ethanol solution at 60°C for 1 h. The surfactant removal process was repeated twice. After the removal of surfactant, 200 mg of the product was dispersed in a mixture of 80 mL of H2O and 400 μL of NH4OH, then 10 mL of 0.22M 3-(trihydroxysilyl)propyl methylphosphonate (THPMP) solution was added with stirring at 40°C and left to react for 4 h to produce negatively charged MSNs (NMSNs). NMSNs were collected by centrifugation and washed with ethanol. 1 mg of NMSNs was mixed with 1.8 μL 2K polyethyleneimine (2K PEI) for 5 min with vigorous shaking, and the resultant PEI-adsorbed (PMSNs) were collected by centrifugation. 2.7. Drug and plasmid loading onto nanoparticles (PMSN-cisplatin, PMSN-HNF4α) Cisplatin was loaded onto NMSNs prior to surface adsorption with PEI. 2 mg of NMSNs were dispersed in 600 μL of 1 mM cisplatin in DMSO solution. The mixture was stirred at 4°C for 12 h and then mixed with PEI to produce PMSN-cisplatin (PMSN-cis). 1 μg of HNF4α-encoding plasmid was mixed with PMSNs or PMSN-cis in DMEM and incubated at 4°C for 24 h to produce PMSN-HNF4α or PMSN-HNF4α-cis, respectively. 2.8. Characterization of nanoparticles Transmission electron microscopy (TEM) images were taken on a JEOL JSM-1200EX II (JEOL, Tokyo, Japan) operating at 120 kV, and the samples were deposited on carbon-coated copper grids. The hydrodynamic size measurement was performed using dynamic light scattering (DLS) on a Zetasizer Nano ZS (Malvern Panalytical, Malvern, UK). The pH-dependent zeta potential was determined by measuring the electrophoretic mobility and then applying the Henry equation on a Zetasizer Nano ZS (Malvern Panalytical). 2.9. Gel retardation assay 1 μg of HNF4α-encoding plasmid was mixed with PMSNs in H2O at different weight ratios and incubated for 30 min. The PMSN-bound and free plasmid were visualized by 1% agarose gel electrophoresis (110 V for 30 min) and staining with ethidium bromide. 2.10

. TUNEL assay

Cell apoptosis was analyzed by TUNEL assay. In Situ Cell Death Detection Kit, Fluorescein (Roche) was used to detect DNA fragmentation according to the manufacturer’s instructions. Briefly, cells were fixed in 4% paraformaldehyde and permeabilized with 1% Triton X-100 in 0.1% sodium citrate for 5 min on ice. Then, the cells were washed twice with PBS, and resuspended in TUNEL reaction mixture, which was prepared according to the instructions prior to use and incubated for 60 min at 37°C in the dark. Mean cell fluorescence of 10,000 cells and percentage of TUNEL-positive cells were assessed by flow cytometry for each experiment treatment. For TUNEL staining, glass



slides with seeded cells were dried and fixed in 4% paraformaldehyde and permeabilized with 1% Triton X-100 in 0.1% sodium citrate for 5 min on ice. After washing with PBS, DAPI (Life Technologies) was added and slides were incubated at 37°C for 60 minutes. The slides were sealed with coverslips, and the images of positive fluorescence showing DNA fragmentation were observed under a fluorescence microscope. 2.11. Cell cycle profiling 2×105 Cells were seeded in 6-well plates and cultured for 24 h at 37°C. The harvested cells were washed with ice-cold PBS and fixed with cold 70% (vol/vol) ethanol at 4°C overnight. Then cells were resuspended in PBS buffer with final concentration of 20 μg/mL RNase A and 20 μg/mL propidium iodide at 37°C for 30 min in the dark. The cell cycle profiles were determined using flow cytometry and analyzed using BD CellQuest Pro software. All of the samples were assayed in triplicate. 2.12. Soft agar colony formation assay 2×106 cells were seeded in 6-well plates and cultured for 24 h at 37°C. The cells were treated with PMSNs for 48 h, harvested using 0.25% trypsin and resuspended in 10% FBS DMEM to a single-cell suspension of 1×106 cells/mL. The bottom layer (1% low-melt agarose) was prepared by mixing 1:12× DMEM supplemented with 20% FBS and 2.0% low-melt agarose. The top layer (0.6% low-melt agarose) was prepared by mixing 1:1 20% FBS DMEM and 1.2% low-melt agarose. 0.2 mL of cell suspension was added to the top layer and after incubating for ~4 weeks at 37°C under 5% CO2 in a humidified incubator, the colonies were stained with crystal violet and counted. 2.13. Animal experiment This study was approved by Taipei Veterans General Hospital Animal Committee, and the principles of Laboratory Animal Care were followed. Only male NOD SCID mice were used in this transplantation studies. Huh7 cells were suspended in PBS (1 × 107 cells/mL) and 1 × 105 cells were subcutaneously implanted into 3- to 4-week-old NOD SCID mice. Ten days after the cell transplantation, the mice with tumors of similar size were selected for PMSN treatment. Various types of PMSNs were prepared with the following formulation: 180 μg cisplatin + 1 μg pHNF4a + 2 mg PMSN for each injection; and were locally injected into the tumor site and the tumor size was measured by external palpation every two or three days. At day 24, the mice were sacrificed for measuring the tumor size and cross section examination. 2.14. ELISA Hepatic protein release by Huh7 cells was measured by ELISA analysis of supernatants after PMSN treatment. ELISAs were performed using antibodies against human albumin


Page 8 of 28

Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(LS-B3900-50, LifeSpan BioSciences) or alpha-fetoprotein (orb357839, Biorbyt). Sample concentrations were calculated from a titration curve calibrated against recombinant standards serially diluted on each measurement. 2.15. Statistical analysis The quantifiable data are presented as the means from at least three biological replicates with standard deviation error bars. The data were compared using Student’s t-test, with p

Dual Delivery of HNF4Î± and Cisplatin by Mesoporous Silica

Recommend Documents