Research Article Cite This: ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Dual-Function, Cationic, Peptide-Coated Nanodiamond Systems: Facilitating Nuclear-Targeting Delivery for Enhanced Gene Therapy Applications Hoi Man Leung,† Miu Shan Chan,† Ling Sum Liu,† Sze Wing Wong,† Tsz Wan Lo,† Cia-Hin Lau,‡ Chung Tin,‡,∥ and Pik Kwan Lo*,†,§
Downloaded via KAOHSIUNG MEDICAL UNIV on October 15, 2018 at 15:33:31 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
†
Department of Chemistry, ‡Department of Biomedical Engineering, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong, Hong Kong SAR, China § Key Laboratory of Biochip Technology, Biotech and Health Care, Shenzhen Research Institute of City University of Hong Kong, Shenzhen 518057, China ∥ Shenzhen Research Institute of City University of Hong Kong, Shenzhen 518057, China S Supporting Information *
ABSTRACT: Nuclear-targeting therapy is considered to be a promising strategy of disease treatment. So far, developing biocompatible and nucleus-permeable delivery systems remains a great challenge. Here, we report a nuclear-targeted delivery platform based on 30 nm nanodiamonds (NDs) which were coated with dualfunction, cationic peptides consisting of the human immounodeficiency virus TAT protein and a nuclear localization signal (NLS) peptide in aqueous media. As compared to uncoated NDs, cationic peptide-functionalized NDs were confirmed as a small, safe, and efficient carrier which not only facilitates the enhanced cellular uptake and delivery of loaded cargos to the nucleus in a number of cell lines but also shows their advantages of low cytotoxicity and high affinity to antisense oligonucleotides. This peptide-based modification strategy does not contribute greatly to the size of the ND which is important in its use in constructing nuclear targeting vehicles. Compared with traditional gene silencing in cytoplasm, our findings suggest that the nuclear localization effect of ANA4625-TAT-NLS-NDs enhances the therapeutic efficacy of antisense oligonucleotide ANA4625 as evidenced by suppression of the targets bcl-2 and bcl-xL pre-mRNA/protein expressions and the induction of cell apoptosis. The studies have also revealed that NDs can be used to mediate sustained release of antisense agents with preserved therapeutic activity as inhibition of target mRNA expression in a time- and dose-dependent manner. This work not only demonstrates the design of a new nanodiamond-based platform for nuclear targeting but also provides significant insights on nuclear-targeting delivery of cell membrane impermeable therapeutic agents for enhanced disease treatment. KEYWORDS: Nanodiamond, Nucleus targeting, Antisense oligonucleotide, Delivery, Protein expression
■
INTRODUCTION
expression of the therapeutic gene agents. A novel strategy in the development of a nuclear-targeted delivery system involves the use of nanocarriers such as nanoparticles,2,3 gold nanorods,4 metallic nanoclusters,5 and quantum dots6 which conjugated with well-known nuclear localization signal (NLS) peptides to transport the therapeutic materials across the nuclear membrane into the cell nucleus. However, these carriers have been challenged by their cytotoxicity, relatively low transfection efficiency, or photobleaching and photoblinking effects. To overcome these problems, a nanodiamond (ND)-based delivery system is significantly attractive to be a single platform for synchronous delivery and imaging because
Nanomedicine has made significant advances due to the infusion of sophisticated nanomaterials in diagnostics and therapeutics. Understanding their dynamics, in particular, intracellular organelles, remains largely an underexplored field. Targeted nuclear delivery is an increasingly important field of research because the cell nucleus keeps genetic integrity and masters of cellular activities by gene regulation. The identification of potential active drugs, the detection and diagnoses of disease phenotype, and the disease treatment by different strategies such as antisense approaches could be enormously improved by the efficient delivery of therapeutic materials to the nucleus in living systems.1 The current challenge of gene therapy approaches is the low delivery efficiency of the gene to the nucleus, particularly when nonviral gene vectors are used. This is a pivotal step to ensure eventual © 2018 American Chemical Society
Received: January 28, 2018 Revised: June 6, 2018 Published: July 6, 2018 9671
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering Scheme 1. Synthetic Scheme of TAT-NLS-NDs and Cargo-Loaded TAT-NLS-NDs
to form TAT-NLS could show enhanced transfection efficiency and gene expression level regulated by TAT-NLS-functionalized complexes. The excellent transfection capability of this heterodimeric TAT-NLS verified the effective nuclear accumulation of NLS peptides and efficient cellular uptake of TAT peptides for plasmid nucleic acids without increasing cytotoxicity.31 In our study, we modified the negatively charged ND’s surface with cationic peptides which consist of a TAT peptide (Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-AegPro-Pro-Gln) and NLS peptide (Pro-Lys-Lys-Lys-Arg-Lys-Val) (Scheme 1).32 With this dual-function, cationic peptide electrostatically coated on the ND surface, ND systems could be efficiently taken up by a variety of cells and specifically localized in the nucleus in both HeLa and MCF-7 cells as compared to uncoated NDs. Compared with traditional gene silencing in cytoplasm, our findings suggest that the nuclear localization effect of nanodiamond-based carriers enhances the therapeutic efficacy of loaded antisense oligonucleotide ANA4625 as evidenced by suppression of target bcl-2 and bcl-xL mRNA/protein expressions and the induction of cell apoptosis. NDs can also be used to mediate sustained release of antisense agents with preserved therapeutic activity, as inhibition of target mRNA expression was found to be in a time- and dose-dependent manner. This facile modification strategy not only resolves the matters of enhanced cellular uptake and nuclear-targeting capability but also furnishes the nanocarrier nuclear-targeted antisense delivery for efficiently suppressing gene expression.
of its unique features such as functionalization versatility, chemical stability, minimal cytotoxicity, high affinity to biomolecules, and biocompatibility.7−9 For successful theranosis, the efficient delivery of drug/gene and imaging components is important to provide adequate drug/gene concentration and imaging/tracking signals in the targeted disease site. The nitrogen-vacancy (NV) centers in ND are nonphotoblinking and nonphotobleaching fluorophores with maximum fluorescence emission at ∼700 nm and a reasonable lifetime of about 19 ns, which enables long-term in vivo particle tracking and in vitro fluorescence cell labeling/imaging.10,11 Studies have already indicated that NDs exhibited no immune response and no inflammatory indications in animal models and are reported to be more biocompatible with neural cells than other carbon-based nanomaterials.12 Remarkably, by making use of the single electronic spin associated with the negatively charged NV− centers, NDs can also be highly considered as magnetic imaging probes due to their sensitivity to magnetic/electrical field fluctuations and ability to emit bright red fluorescence after exciting with a green laser.13,14 These combined properties make ND superior to other materials for gene/drug delivery.15 A most common approach to empower the cellular uptake and cytosolic release of the ND is to coat its surface covalently or noncovalently with polymers such as polyethylenimine (PEI),16 poly-[2-(dimethylamino)ethyl methacrylate],17 poly(allylamine hydrochloride),18 polyethylene glycol (PEG), poly(oligo(ethylene glycol) methyl ether methacrylate),19 hyperbranched polyglycerol,20 and N-alkylated poly(4-vinylpyridine) (NPVP).21 However, some of these hydrophilic polymers would introduce unavoidable cytotoxic effects and induce immune response, depending on their molecular sizes, degree of polymeric branching, etc.22,23 Recent studies have revealed the potential of NDs coated with these cationic polymers to deliver siRNAs,24 microRNAs,25 or green fluorescence protein (GFP) plasmid DNAs26 into cell cytosol to either regulate GFP expression27 or suppress GFP/EWSFli1 genes with high efficiency as compared to using the standard lipofectamine transfecting agent in physiological conditions.24,18 Recently, we have demonstrated that conjugating folic acid molecules and mitochondrial localizing sequence (MLS) peptides to the PEGylated ND’s surface would facilitate the delivery of the loaded molecular drugs to the mitochondria of specific cancer cells.15 However, no studies show the versatile surface modification of ND to facilitate its nuclear-targeted delivery for enhanced disease therapy. Zhang’s and other groups have extensively explored the cellpenetrating characteristics of TAT peptide and the nuclear localization capability of nuclear localization signal (NLS) peptide in addition to their biomedical applications in gene therapy in the past 10 years.28−30 Among cell-penetrating peptides (CCPs), the combination of the human immunodeficiency virus TAT protein with the SV40 large T protein NLS
■
EXPERIMENTAL SECTION
Materials. Monocrystalline diamond powder with monocrystalline synthetic (MSY) 0−0.05 micro was purchased from Microdiamant. Sulfuric acid, nitric acid, perchloric acid, sodium hydroxide, hydrochloric acid, HEPES, bovine serum albumin, CelLytic M, glycine, 2-mercaptoethanol, sodium chloride, sodium dodecyl sulfate (SDS), Tween 20, and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were used as purchased from Aldrich. ANA4625 was purchased from Integrated DNA Technologies. TAT cell-penetrating with a nucleus-signaling peptide was purchased from First Base. Fetal bovine serum (FBS), phosphate buffered saline (PBS), Dulbecco’s Modified Eagle Medium (DMEM), penicillin streptomycin solution, trypsin organelles trackers/markers, and SuperScript III First-Strand Synthesis SuperMix were purchased from Invitrogen. RNeasy Mini Kit was purchased from Qiagen. Fast SYBR TM Green Master Mix was purchased from Applied Biosystems. Pierce BCA Protein Assay Kit was bought from Thermo Scientific. Tris(hydroxylmethyl)aminomethane was bought from J&K Chemical. Immobilon-PSQ polyvinylidene fluoride (PVDF) membranes with 0.2 μm pore size and an antibeta-actin antibody (clone 4C2) were purchased from EMD Millipore. Bcl-2(124) mouse monoclonal antibody, Bcl-xL rabbit monoclonal antibody, antimouse IgG HRP-linked antibody, and antirabbit IgG HRP-linked antibody were purchased from Cell Signaling Technology. Clarity Max Western ECL substrate was obtained from Biorad. Instrument. The physical properties of raw ND and modified ND were characterized by a Fourier transform infra-red spectrometer (PE 9672
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering Table 1. Nucleic Acid Sequencesa Sequence (5′ → 3′) ANA4625 DNA DNA-Cy3 DNA-Cy5
CsTsGsAsGsAsCsTsTsTsAsAsTsAsAsAsAsGsGsCsAsTsCsCsCsAsGsCsCsTsCsCsGsTsT CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT Cy3-CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT Cy5-CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT
Backbone of oligonucleotide modified to phosphorothiolate is labeled with “s”; underlined bases are methoxylethoxyl modified at the 2′-αposition of ribose sugar.
a
Fourier Transform Infrared (FTIR). Functional groups on the surface of modified NDs were characterized by Fourier transform infrared spectroscopy (FTIR) studies. Dried functionalized NDs were well mixed with KBr powder to form a KBr pellet containing 0.2%− 1% of the ND sample. The signal from a pure KBr pellet was subtracted as a background. Dynamic Light Scanning (DLS). Size distributions and zeta potential values of functionalized NDs were analyzed by DLS. Each ND sample was suspended in water at a concentration of 50 μg/mL. A solution containing NDs was detected by a Zetasizer. A refractive index of carbon (2.42) was chosen as a reference to calculate the size distribution of NDs in terms of intensity. UV−Visible Spectrophotometry Analysis of Adsorption of TAT-NLS on Carboxyl-ND. The amount of TAT-NLS peptide adsorbed on the surface of carboxyl-ND was determined by absorbance at 205 nm which is the absorption wavelength of a peptide bond. Here, 3.12, 6.25, 12.5, 25, 50, 100, 150, and 200 μg of TAT-NLS peptide were added, consecutively, into carboxyl-ND with a fixed amount of 500 μg. Nanoparticles were remove by centrifugation. The absorption of the unbound peptide after the reaction was analyzed by a NanoDrop OneC spectrophometer. The amount of peptide in the residue was calculated according to the calibration curve of a standard TAT-NLS peptide solution. The maximum of TAT-NLS peptide adsorbed on carboxyl-ND was determined to be about 6 μg per 100 μg of carboxyl-ND. Fluorescence Studies of DNA-Coated TAT-NLS-NDs. In order to determine the approximate amount of DNA4625 coated on the surface of TAT-NLS-NDs, a fluorescence experiment was performed. Different amounts of DNA 4625 linked with fluorescent molecule Cy3 (ranging from 82.5 to 2640 ng) were added to react with TATNLS-NDs with a fixed amount of 100 μg. Nanoparticles were remove by centrifugation. The fluorescent intensity of each solution residue was measured by a spectrofluometer. The amount of oligonucleotide remaining was calculated from the standard calibration curve. The maximum amount of DNA4625-Cy3 coated on the surface of 100 μg of TAT-NLS-NDs was calculated to be ∼1600 ng. Flow Cytometry. Here, 1 ×105 Hela, MCF-7, HepG2, KB, and bEnd3 cells were seeded on six-well plates and cultured overnight and then incubated with corresponding samples for 12 h. After washing with PBS a few times, cells were analyzed by a flow cytometer. The Cy5 fluorescence signal was excited at a wavelength of 488 nm and collected from 543 to 627 nm. MTT Assay. A 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay was used to compare the cytotoxicity of DNA-coated NDs with naked DNA, TAT-NLS-NDs, and carboxylNDs. Here, 2.5 × 104 cells were seeded in 24-well plates and cultured overnight in a 37 °C incubator with 5% CO2 and then incubated with corresponding samples for 24 h. Cells were then incubated with fresh medium containing 0.5 mg/mL of MTT for 2 h at 37 °C for the cytotoxicity assay. After incubation, the medium was removed, and the solution of DMSO and ethanol (1:1) was added. The absorbance at 570 nm was measured using a microplate reader. bcl-2 and bcl-xL mRNA Expressions. Total RNA was isolated from cells by the use of the RNeasy Mini Kit. RNA extracted was converted to cDNA by the use of SuperScript III First-Strand Synthesis SuperMix. Real-time amplification was performed according to SsoAdvanced Universal SYBR Green Supermix protocol. Relative quantification of gene expression was determined using Gapdh as an internal standard and the comparative threshold cycle (CT) method.
spectrum 2000) and dynamic light scattering particle size analyzer (Malvem Zetasizer Nano ZS). Standard automated oligonucleotide solid-phase synthesis was performed on a BioAutomation MerMade MM6 DNA synthesizer. UV−visible spectrophotometry analysis was conducted by a NanoDrop OneC spectrophotometer. Fluorescence measurements were carried out by a HORIBA Jobin Yvon Fluormax-4 spectrofluorometer. A confocal fluorescence experiment was conducted on a laser confocal scanning microscope (Leica TCS SP5) with 63× magnification. A Bio Tek Powerwave XS microplate reader was used for the MTT studies and quantification of proteins in a western blot. A BD FACSCantoTM II flow cytometer was used for fluorescence-activated cell sorting (FACS) studies. Synthesis of cDNA was conducted on an Applied Biosystems SimpliAmp thermal cycler. Real-time PCR was performed on a QuantStudio 3D Digital PCR system. Protein bands were visualized by a luminescent image analyzer LAS-4000 (Fujifilm). Synthesis of Functionalized NDs. Carboxyl-NDs. A total of 50 mg of pristine nanodiamonds (NDs) were acidified by refluxing with a 1:1:1 (v/v) mixture of sulfuric acid, nitric acid, and perchloric acid at 110 °C for 24 h. The acidified NDs were extracted by centrifugation, washed by deionized water three times, and then refluxed with 0.1 M of NaOH at 110 °C for 24 h. In the final step, alkaline-treated NDs were heated with 0.1 M of HCl at 110 °C under reflux for 24 h. The carboxyl-NDs obtained were dissolved in 5 mL of water. The final concentration of carboxyl-NDs was 10 mg/mL. TAT-NLS-NDs. A total of 0.5 mg of carboxyl-NDs were added into 0.6 mg of TAT-NLS peptide solution (229 nmol) in HEPES (400 μL). The mixture was shaken for 1 h at room temperature. The resulting TAT-NLS-NDs were washed with water and extracted by centrifugation. The TAT-NLS-NDs were resuspended in autoclaved water. TAT -NDs. A total of 0.5 mg of carboxyl-NDs were added into 0.6 mg of TAT peptide solution (370 nmol) in HEPES (400 μL). The mixture was shaken for 1 h at room temperature. The resulting TATNDs were washed with water and extracted by centrifugation. The TAT-NLS-NDs were resuspended in autoclaved water. Nucleic acid-TAT-NLS-NDs. A total of 50 μg of nucleic acid (4.01 nmol) was added into TAT-NLS-NDs with in HEPES (400 μL). The mixture was shaken for 1 h. The nucleic acid-coated nanodiamonds were washed with water and extracted by centrifugation. The final product was resuspended in autoclaved water. The nucleic acid sequences are listed in Table 1. Nucleic acid sequences. Confocal Fluorescence Microscopy Imaging. Cells were seeded and cultured in glass-bottomed dishes for overnight. Samples were added and incubated for a few hours. After being washed with buffers three times, cell imaging was ready. For colocalization studies, 3 μL of 0.5 mM of the relevant tracker was added and incubated with cell samples for ∼30 min. The λex of ND is 633 nm, and the λem region is above 700 nm. The λex of hoescht is 405 nm, and the λem region is from 430 to 470 nm. The λex of the tracker is 488 nm, and the λem region is from 550 to 600 nm. Cell Culture. MCF-7 breast adenocarcinoma cells were routinely cultured in DMEM supplemented with 10% of FBS and 1% of penicillin with streptomycin. The cells were incubated in a humidified 5% CO2 atmosphere at 37 °C. When cells grow to about 95% confluence, they were then treated with a standard trypsin-based technique and reseeded in confocal imaging dishes of concentrations about 4 × 104 cell L−1. Samples were added to cells with ∼70% confluence and then incubated for an additional 12 h. 9673
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering
Figure 1. (A) FTIR spectra of raw NDs, carboxyl-NDs, and TAT-NLS-NDs. (B) Amount of TAT-NLS adsorbed on carboxyl-NDs is plotted against the total amount of TAT-NLS added. The amounts of Cy3-labeled DNA4625 adsorbed on (C) TAT-NLS-NDs and (D) TAT-NDs are plotted against the total amount of Cy3-labeled DNA4625 added. Error bars indicate the standard deviation of at least three measurements. (E) Fluorescence intensity of Cy5 from the purified DNA-Cy5-TAT-NLS-NDs after several washings. Western Blot Analysis. Proteins were extracted from cultured cells by CelLytic M, and the quantification was performed by BCA protein assay with the use of a microplate reader. Here, 35 μg of cell lysate was separated by 12% SDS-PAGE gel. The proteins were transferred to a polyvinylidene fluoride (PVDF) membrane, and the blots were blocked in 3% BSA (bovine serum albumin) with Trisbuffered saline supplemented with 0.1% Tween 20 (TBST) for 1 h. Then, they were incubated with a Bcl-2 mouse monoclonal antibody/ Bcl-xL rabbit monoclonal antibody with the dilution of 1:1000 in TBST containing 5% BSA at 4 °C overnight. For detection of primary antibodies, the blots were incubated with antimouse IgG HRP-linked antibody/antirabbit IgG HRP-linked antibody with the dilution of 1:1000 in TBST containing 5% BSA at room temperature for 1 h. The blots were stripped and reprobed with a beta-actin antibody as the loading control. Visualization of immunocomplexes were performed by enhanced chemiluminescence with the use of an ECL kit. The luminescent bands were detected by a Luminescent image analyzer.
For bcl-2 and bcl-xL pre-mRNA studies, the corresponding DNA primer pair sequences of the targets bcl-2 and bcl-xL were designed with the forward primer in exon 2 and reversed primer in exon 3 using the Basic Local Alignment Search Tool (BLAST). The sequences of the bcl-2 primer pair are 5′-CATGTGTGTGGAGAGCGTCA-3′ (FR) and 5′-GCAGGCATGTTGACTTCACTTG-3′ (RP), while the sequences of the bcl-xL primer pair are 5′-AGTCGGATCGCAGCTTGGA-3′ (FR) and 5′-AGGAACCAGCGGTTGAAGC3′ (RP). For bcl-2 and bcl-xL matured mRNA studies, the sequences of two bcl-2 primers are 5′-CATGTGTGTGGTGAGCGTCAA-3′ (FR) and 5′-GCCGGTTCAGGTACTCAGTCA-3′(RP), while the sequences of bcl-xL, primers are 5′-TCCTTGTCTACGCTTTCCACG-3′ (FR) and 5′-GGTCGCATTGTGGCCTTT3′ (RP). Analysis of relative gene expression was performed by the QuantStudio 3D Digital PCR System. Relative data were presented in comparison with an untreated control sample. The RT-PCR products were characterized by gel electrophoresis. Here 5 ng of each sample was loaded onto a 10% polyacrylamide gel, and the lengths of DNA were compared to the standard DNA ladder. In the pre-mRNA studies, the expected length of the DNA products of bcl-2 is 268 bp and bcl-xL is 155 bp.
■
RESULTS AND DISCUSSION To develop a multifunctional ND system, a noncovalent approach is used to immobilize cationic peptides onto negatively charged NDs via electrostatic interaction in aqueous 9674
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering
Table 2. Summary of DLS Data of Modified NDs in Terms of Their Size Intensity, Zeta Potential, and PDI in Water Sample Carboxyl-ND TAT-NLS-ND TAT-ND DNA-TAT-NLS-ND
Size [nm] 28.52 63.78 372.3 282.6
± ± ± ±
Zeta potential [mV] −31.6 +42.5 +22.5 −33.4
1.1 13.8 31.7 34.2
± ± ± ±
14.6 11.0 1.6 1.2
PDI 0.191 0.191 0.634 0.335
± ± ± ±
0.026 0.026 0.106 0.076
Figure 2. (A) Normalized mean fluorescence signals of Cy5 in different cells after incubating with DNA-Cy5-TAT-NLS-NDs and Cy5-labeled ND. (B) Normalized mean fluorescence signals of Cy5 in MCF-7 cells after incubating with a number of different samples as negative controls. Excitation was at 640 nm while collection was from 656 to 684 nm. (C) Plot of the amount of Cy-labeled DNA4625 uptake in MCF-7 cells as a function of incubation time. (D) Cell viability studies of TAT-NLS-NDs as a function of concentration of ND in different cell lines.
NLS-ND revealed a more positive zeta potential (+42 mV) than carboxyl-NDs (−31.6 mV) did, due to the coating of cationic peptides. The polydispersity indices (PDI) of carboxyl ND, TAT-NLS-ND, and DNA-TAT-NLS-ND from DLS studies are found to be 0.191 ± 0.026, 0.303 ± 0.080, and 0.335 ± 0.076, respectively (Table 2). These results indicate that the modified NDs exhibited intermediate, moderately polydisperse distribution, and their size distribution did not change much even when the TAT-NLS-NDs were further coated with DNA 4625. The physicochemical property of TAT-NLS-NDs was examined using FTIR. The successful coating of NDs with TAT-NLS was confirmed by the presence of a peptide bond. The FTIR spectrum of TAT-NLS-NDs shows CO stretching vibration of the amide I at 1721 cm−1 and a C−N stretching vibration and N−H bending of the amide II at 1598 cm−1. Compared to carboxyl-NDs, TATNLS-NDs exhibit new peaks at 2851, 2870, 2923, and 2966 cm−1, which correspond to IR-active signals of the substitutes of amino acids from symmetric CH2 stretching, symmetric CH3 stretching, asymmetric CH2 stretching, and asymmetric CH3 stretching, respectively. The coexistence of TAT-NLS and
medium. This is a clean approach to modify the surface chemistry of the ND as no heavy metals or transitional metals are involved in the entire synthetic process. First, the commercially available NDs were cleaned with a strong acid mixture H2SO4−HNO3−HClO4 (1:1:1,vol/vol/vol) and then oxidized to become carboxyl-NDs. The Fourier transform infrared spectroscopy (FTIR) spectrum of the oxidized NDs exhibits an O−H stretching vibration at 3429 cm−1 and the corresponding CO stretching vibration of the carboxyl group at 1779 cm−1 (Figure 1A). The peptide-functionalized NDs (TAT-NLS-NDs) are formed by mixing cationic TATNLS peptides to the negatively charged coated NDs in HEPES buffer (pH 7.4). DLS studies were conducted to determine the average size and surface potential of modified NDs (Table 2). The oxidized ND in deionized water forms a particle size of ∼28.52 ± 1.1 nm with narrow size distribution, showing its good dispersity. As compared to PEI and NPVP coating, immobilization of TAT-NLS peptides onto the oxidized NDs just slightly increased the average cluster size of 63.78 ± 13.8 nm, indicating that peptide immobilization does not make NDs prone to serious aggregation.18,21,26 In addition, TAT9675
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering
Figure 3. Confocal fluorescence images of DNA4625-Cy3-TAT-NLS-NDs in (A) MCF-7 and (B) HeLa cells staining with Hoechst. Confocal fluorescence images of DNA4625-TAT-NDs in MCF-7 cells staining with (C) lyso-tracker, (D) mito-tracker, and (E) endotracker. Confocal fluorescence images of carboxyl-NDs in (F) MCF-7 and (G) HeLa cells. Scale bar is 10 μm.
and measuring the Cy3 fluorescence intensity of unbound nucleic acids at 550 nm were used to determine the amount of peptide and nucleic acid cargo coated on ND. We found that a maximum 1.6 and 6 μg of fluorophore-labeled nucleic acid and peptide, respectively, were successfully loaded onto 100 μg NDs via electrostatic interactions, meaning the ratio of nucleic acid to peptide on modified NDs is found to be ∼1:3.75 (Figure 1B,C). In contrast, the maximum amount of Cylabeled DNA4625 loaded on 100 ng of TAT-ND was
loaded cargo such as nucleic acids on the surface of ND was accomplished by mixing negatively charged, Cy5-labeled DNA4625 to TAT-NLS-NDs in HEPES buffer at pH 7.4, resulting in DNA-coated TAT-NLS-NDs. DLS studies also revealed a relatively high negative value of the zeta potential in DNA-coated TAT-NLS-NDs compared to that of TAT-NLSNDs in deionized water. Indirect methods in terms of measuring the UV−vis absorbance of an unbound peptide at 205 nm which is the absorption wavelength of a peptide bond 9676
DOI: 10.1021/acssuschemeng.8b00446 ACS Sustainable Chem. Eng. 2018, 6, 9671−9681
Research Article
ACS Sustainable Chemistry & Engineering determined to be ∼0.5 μg, which is much lower than that on TAT-NLS-NDs (Figure 1D). This difference may possibly attribute to the higher positive surface charge of TAT-NLS enhancing the ability of TAT-NLS-NDs to condense or immobilize negatively charged substances tightly. Additionally, DLS results of TAT-NDs in deionized water showed a relatively large particle size of 372.3 ± 31.7 nm with polydispersity features (Table 2). These aggregated particles would not favor passing through the nuclear pore and getting into the nucleus in living cells. To further investigate the amount of DNA desorbed after several times of washing onto the purified DNA-Cy5-TAT-NLS-NDs, the fluorescence intensity of Cy5-labeled DNA in the residue solution was measured and compared. In Figure 1E, a substantial fluorescence signal of purified DNA-Cy5-TAT-NLS-NDs was obtained at 567 nm, confirming the successful coating of Cy5labeled DNA after washing off the unbound DNAs. Subsequently, there are no significant Cy5 fluorescence signals in the residue observed after washing the purified DNA-Cy5TAT-NLS-NDs five times (e.g., from the first to the fifth washing). These results strongly suggested that an intensive washing procedure did not give rise to noticeable desorption which is possibly due to the high positive surface charge of TAT-NLS-NDs to facilitate immobilization of negatively charged substances. The fact that TAT-NLS does not contribute greatly to the size of the ND which is important in its use in constructing nuclear-targeting vehicles as the diameter of the nuclear pore complex is around 20−70 nm depending on the cell types. Collectively, these results indicated that facile surface modification of ND with a short, cationic TAT-NLS peptide is highly achievable. To evaluate the cellular uptake efficiency of peptidefunctionalized NDs, flow cytometry analysis in different cell lines was performed. By monitoring and comparing the Cy5 fluorescence signal of the loaded DNA4625 on TAT-NLS-ND and carboxyl-NDs, we found that the TAT-NLS-ND system can be taken up more efficiently by a number of cell lines including HeLa, MCF-7, KB, HepG2, and bEnd3, and the loaded Cy5-labeled DNA4625 were delivered into the cells by TAT-NLS-ND more efficiently than by the carboxyl-ND system (Figure 2A). To further confirm the mean fluorescence signal obtained in Figure 2A being from Cy5 fluorophores and eliminate the possibility of getting misleading fluorescence signals from ND itself in these flow cytometry studies, we performed additional control experiments. MCF-7 cells were treated with a number of samples including carboxyl-NDs, TAT-NLS-NDs, DNA4625-TAT-NLS-NDs, DNA4625-Cy5TAT-NLS-NDs, and DNA4625-Cy5 itself for flow cytometry analysis (Figure 2B). Only those samples consisting of Cy5labeled DNA 4625 were being recorded which means that only the Cy5 fluorophore is being tracked, and the observed fluorescence signals are not coming from ND. Additionally, comparing to the DNA4625-Cy5 itself, the cellular uptake of loaded Cy5-labeled DNA4625 could be dramatically enhanced in the presence of NDs as the carrier. To determine the amount of internalization of loaded payloads, the fluorescence signal of the Cy-labeled DNA 4625 which was loaded on the TAT-NLS-ND′ surface in the residue of the tissue culture plate was measured as a function of incubation time. By comparing with the fluorescence signal of loaded 800 ng of Cy-labeled DNA 4625, we found that ∼500 ng of DNA 4625 was taken up by cells after 3 h incubation. No further uptake was observed even up to 24 h incubation (Figure 2C). MTT (3-[4,5-
dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay was used to determine the viability of different cell lines as a function of ND concentrations (Figure 2D). MTT results revealed that TAT-NLS-NDs (without cargo loading) exhibited low cytotoxicity to a number of cell lines even up to a concentration of 100 μg/mL, confirming their biocompability. Subsequently, the intracellular localization of modified NDs was investigated via confocal fluorescence studies. The NV− centers in NDs emit red light with maximum fluorescence emission at ∼700 nm when they are excited by visible light sources, e.g., 633 nm laser. After treating cells with TAT-NLSNDs coated with Cy3-labeled DNA4625 for 24 h, NDs showed efficient cellular uptake, and most of them were localized in the nucleus as the ND signals (red) overlapped with nucleus staining, Hoechst (blue) in HeLa and MCF-7 cells. More importantly, we also observed the Cy3 fluorophore signal inside the nucleus in which it completely overlapped with the fluorescence signals of ND and Hoechst (Figure 3A,B). Indeed, with the help of this TAT-NLS-ND platform, the loaded cargos could also be delivered to the nucleus in living cells. However, the majority of TAT-NDs randomly distributed in the cytoplasm and did not show nuclear-targeting ability after cellular uptake in HeLa and MCF-7 cells (Figure 3C−E). Additionally, the uncoated carboxyl-NDs were seldomly taken up by MCF-7 and HeLa cells (Figure 3F−G) which is in good agreement with the results obtained in Figure 2A. These results simply demonstrated the capability of TATNLS-ND systems as efficient nuclear-targeted transporters for negatively charged cargos such as siRNA, miRNA, plasmid DNA, etc. However, the amount of NDs entering the nucleus is still low because the size distribution of ND is a bit wide (polydispersity index
