Dual-Function, Cationic, Peptide-Coated Nanodiamond Systems

Subscriber access provided by TUFTS UNIV

Article

Dual-Function, Cationic Peptide-Coated Nanodiamond Systems: Facilitating Nuclear-Targeting Delivery for Enhanced Gene Therapy Applications Hoi Man Leung, Miu Shan Chan, Ling Sum Liu, Sze Wing Wong, Tsz Wan Lo, Cia-Hin Lau, Chung Tin, and Pik Kwan Lo ACS Sustainable Chem. Eng., Just Accepted Manuscript • DOI: 10.1021/acssuschemeng.8b00446 • Publication Date (Web): 06 Jul 2018 Downloaded from http://pubs.acs.org on July 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sustainable Chemistry & Engineering

Dual-Function, Cationic Peptide-Coated Nanodiamond Systems: Facilitating NuclearTargeting Delivery for Enhanced Gene Therapy Applications Hoi Man Leung, a Miu Shan Chan, a Ling Sum Liu, a Sze Wing Wong, a Tsz Wan Lo, a Cia-Hin Lau, b Chung Tinb,d and Pik Kwan Loa,c* a

Department of Chemistry, bDepartment of Biomedical Engineering, City University of Hong

Kong, Tat Chee Avenue, Kowloon Tong, Hong Kong SAR, China. cKey Laboratory of Biochip Technology, Biotech and Health Care, Shenzhen Research Institute of City University of Hong Kong, Shenzhen 518057, China. dShenzhen Research Institute of City University of Hong Kong, Shenzhen 518057, China Email:[email protected] KEYWORDS Nanodiamond, nucleus targeting, antisense oligonucleotide, delivery, protein expression ABSTRACT Nuclear-targeting therapy is considered to be a promising strategy of disease treatment. So far, developing biocompatible and nucleus-permeable delivery systems remains a

ACS Paragon Plus Environment

1

ACS Sustainable Chemistry & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 37

great challenge. Here we report a nuclear-targeted delivery platform based on 30 nm nanodiamonds which were coated with dual-function, cationic peptides consisting of the human immounodeficiency virus TAT protein and a nuclear localization signal (NLS) peptide in aqueous media. As compared to uncoated NDs, cationic peptide-functionalized NDs was confirmed as a small, safe and efficient carrier which not only facilitates the enhanced cellular uptake and delivery of loaded cargos to the nucleus in a number of cell lines but also shows their advantages of low cytotoxicity and high affinity to antisense oligonucleotides. This peptide-based modification strategy does not contribute greatly to the size of the ND which is important in its use in constructing nuclear targeting vehicles. Compared with traditional gene silencing in cytoplasm, our findings suggest that the nuclear localization effect of ANA4625-TAT-NLS-NDs enhances the therapeutic efficacy of antisense oligonucleotide ANA4625 as evidenced by suppression of target bcl-2 and bcl-xL pre-mRNA/protein expression and the induction of cell apoptosis. The studies have also revealed that NDs can be used to mediate sustained release of antisense agents with preserved therapeutic activity as inhibition of target mRNA expression is in time- and dosedependent manner. This work not only demonstrates the design of a new nanodiamond-based platform for nuclear targeting but also provides significant insights on nuclear-targeting delivery of cell membrane impermeable therapeutic agents for enhanced disease treatment.

INTRODUCTION Nanomedicine has made significant advances due to the infusion of sophisticated nanomaterials in diagnostics and therapeutics. Understanding their dynamics in particular intracellular organelles remains largely an underexplored field. Targeted nuclear delivery is an increasingly important field of research because cell nucleus keeps genetic integrity and masters of cellular activities by gene


2

Page 3 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


regulation. The identification of potential active drugs, the detection and diagnoses of disease phenotype, and the disease treatment by different strategies such as antisense approaches could be enormously improved by the efficient delivery of therapeutic materials to the nucleus in living systems.1 The current challenge of gene therapy approaches is the low delivery efficiency of gene to the nucleus, particularly when non-viral gene vectors are used. This is a pivotal step to ensure eventual expression of the therapeutic gene agents. A novel strategy in the development of nuclear targeted delivery system involves the use of nanocarriers such as nanoparticles,2,3 gold nanorods,4 metallic nanoclusters,5 and quantum dots6 which conjugated with well-known nuclear localization signal (NLS) peptides to transport the therapeutic materials across the nuclear membrane into cell nucleus. However, these carriers have been challenged by their cytotoxicity, relatively low transfection efficiency, or photobleaching and photoblinking effects. To overcome these problems, a nanodiamond (ND)-based delivery system is significantly attractive to be a single platform for synchronous delivery and imaging because of its unique features such as functionalization versatility, chemical stability, minimal cytotoxicity, high affinity to biomolecules and biocompatibility.7–9 For successful theranosis, the efficient delivery of drug/gene and imaging components is important to provide adequate drug/gene concentration and imaging/tracking signals in the targeted disease site. The nitrogen-vacancy (NV) centers in ND are nonphotoblinking and non-photobleaching fluorophores with maximum fluorescence emission at ~ 700 nm and a reasonable lifetime of about 19 ns, which enables long-term in vivo particle tracking and in vitro fluorescence cell labelling/imaging.10,11 Studies have already indicated that NDs exhibited no immune response and no inflammatory indications in animal models and reported to be more biocompatible with neural cells than other carbon-based nanomaterials.12 Remarkably, making use of the single electronic spin associated with the negatively charged NV- centers, NDs


3


Page 4 of 37

can also be highly considered as magnetic imaging probes due to their sensitivity to magnetic/electrical field fluctuations and ability to emit bright red fluorescence after exciting with a green laser.13,14 These combined properties make ND superior than other materials for gene/drug delivery.15 A most common approach to empower the cellular uptake and cytosolic release of the ND is to coat its surface covalently or non-covalently with polymers such as polyethyleneimine (PEI),16 poly-[2-(dimethylamino)ethyl methacrylate],17 polyallylamine hydrochloride,18 polyethylene glycol (PEG), poly(oligo(ethylene glycol) methyl ether methacrylate),19 hyperbranched polyglycerol20 and N-alkylated poly (4-vinylpyridine) (NPVP).21 However, some of these hydrophilic polymers would introduce unavoidable cytotoxic effects and induce immune response, depending on their molecular sizes, degree of polymeric branching, etc.22,23 Recent studies have revealed the potential of NDs coated with these cationic polymers to deliver siRNAs,24 microRNAs25 or green fluorescence protein (GFP) plasmid DNAs26 into cell cytosol to either regulate GFP expression27 or suppress GFP/EWS-Fli1 genes with high efficiency as compared to using the standard lipofectamine transfecting agent in physiological conditions.24,18 Recently, we have demonstrated that conjugating folic acid molecules and mitochondrial localizing sequence (MLS) peptides to the PEGylated ND’s surface would facilitate the delivery of the loaded molecular drugs to the mitochondria of specific cancer cells.15 However, no studies show the versatile surface modification of ND to facilitate its nuclear-targeted delivery for enhanced disease therapy. Zhang’s and other groups have extensively explored the cell-penetrating characteristics of TAT peptide and the nuclear localization capability of nuclear localization signal (NLS) peptide in addition to their biomedical applications in gene therapy in the past ten years.28–30 Among cell-


4

Page 5 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


penetrating peptides (CCPs), the combination of the human immunodeficiency virus TAT protein with the SV40 large T protein NLS to form TAT-NLS could show enhanced transfection efficiency and gene expression level regulated by TAT-NLS-functionalized complexes. The excellent transfection capability of this heterodimeric TAT-NLS verified the effective nuclear accumulation of NLS peptide and efficient cellular uptake of TAT peptide for plasmid nucleic acids without increasing cytotoxicity.31 In our study, we modified the negatively-charged ND’s surface with cationic peptides which consist of TAT peptide (Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-AegPro-Pro-Gln) and NLS peptide (Pro-Lys-Lys-Lys-Arg-Lys-Val) (Scheme 1).32 With this dualfunction, cationic peptide electrostatically coated on ND surface, ND systems could be efficiently taken up by a variety of cells and specifically localized in the nucleus in both HeLa and MCF-7 cells as compared to uncoated NDs. Compared with traditional gene silencing in cytoplasm, our findings suggest that the nuclear localization effect of nanodiamond-based carriers enhances the therapeutic efficacy of loaded antisense oligonucleotide ANA4625 as evidenced by suppression of target bcl-2 and bcl-xL mRNA/protein expression and the induction of cell apoptosis. NDs can also be used to mediate sustained release of antisense agents with preserved therapeutic activity as inhibition of target mRNA expression was found to be in time- and dose-dependent manner. This facile modification strategy not only resolves the matters of enhanced cellular uptake and nuclear targeting capability but also furnishes the nanocarrier nuclear-targeted antisense delivery for efficient suppressing gene expression.

Scheme 1. Synthetic scheme of TAT-NLS-NDs and cargo-loaded TAT-NLS-NDs.


5


Page 6 of 37

EXPERIMENTAL SECTION Materials. Monocrystalline diamond powder with monocrystalline synthetic (MSY) 0-0.05 micro was purchased from Microdiamant. Sulfuric acid, nitric acid, perchloric acid, sodium hydroxide, hydrochloric acid, HEPES, bovine serum albumin, CelLytic M, glycine, 2-mercaptoethanol, sodium chloride, sodium dodecyl sulphate (SDS), Tween® 20 and 3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide (MTT) were used as purchased from Aldrich. ANA4625 was purchased from Integrated DNA Technologies. TAT cell-penetrating with nucleus signaling peptide was purchased from First Base. Fetal bovine serum (FBS), phosphate buffered saline (PBS), Dulbecco’s Modified Eagle Medium (DMEM), penicillin streptomycin solution, trypsin organelles trackers/markers and SuperScript® III First-Strand Synthesis SuperMix were purchased from Invitrogen. RNeasy Mini Kit was purchased from Qiagen. Fast SYBR TM Green Master Mix was purchased from Applied Biosystems. Pierce™ BCA Protein Assay Kit was brought from Thermo Scientific. Tris-(hydroxylmethyl)aminomethane was brought from J&K Chemical. Immobilon-PSQ polyvinylidene fluoride(PVDF) membrane with 0.2 µm pore size and anti-betaactin antibody (clone 4C2) were purchased from EMD Millipore. Bcl-2(124) mouse monoclonal antibody, Bcl-xL rabbit monoclonal antibody, anti-mouse IgG, HRP-linked antibody and antirabbit IgG, HRP-linked antibody were purchased from Cell Signaling Technology. Clarity Max™ Western ECL Substrate was obtained from Bio-rad. Instrument. The physical properties of raw ND and modified ND were characterized by Fourier Transform Infra-Red Spectrometer (PE spectrum 2000) and Dynamic Light Scattering Particle Size Analyzer (Malvem Zetasizer Nano ZS). Standard automated oligonucleotide solid-phase synthesis was performed on BioAutomation MerMade MM6 DNA synthesizer. UV-Visible spectrophotometry analysis was conducted by NanoDrop OneC spectrophotometer. Fluorescence


6

Page 7 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measurements were carried out by HORIBA Jobin YvonTM Fluormax-4 Spectrofluorometer. Confocal fluorescence experiment was conducted on Laser Confocal Scanning Microscope (Leica TCS SP5) with 63× magnification. Bio Tek Powerwave XS microplate reader was used for the MTT studies and quantification of proteins in Western Blot. BD FACSCantoTM II flow cytometer was used for fluorescence-activated cell sorting (FACS) studies. Synthesis of cDNA was conducted on Applied Biosystems SimpliAmp Thermal Cycler. Real-time PCR was performed on QuantStudio 3D Digital PCR System. Protein bands were visualized by Luminescent Image Analyzer LAS-4000 (Fujifilm). Synthesis of functionalized NDs. Carboxyl-NDs 50 mg of pristine nanodiamonds (NDs) were acidified by refluxing with a 1:1:1 (v/v) mixture of sulphuric acid, nitric acid and perchloric acid at 110 oC for 24 h. The acidified NDs were extracted by centrifugation, washed by deionized water for three times, and then refluxed with 0.1 M of NaOH at 110 oC for 24 h. In the final step, alkaline-treated NDs were heated with 0.1 M of HCl at 110 oC under reflux for 24 h. The carboxyl-NDs obtained were dissolved in 5 mL of water. The final concentration of carboxyl-NDs was 10 mg/mL. TAT-NLS-NDs 0.5 mg of carboxyl-NDs were added into 0.6 mg of TAT-NLS peptide solution (229 nmol) in HEPES (400 µL). The mixture was shaken for 1 h at room temperature. The resulting TAT-NLS-NDs were washed with water and extracted by centrifugation. The TAT-NLS-NDs were re-suspended in autoclaved water. TAT -NDs 0.5 mg of carboxyl-NDs were added into 0.6 mg of TAT peptide solution (370 nmol) in HEPES (400 µL). The mixture was shaken for 1 h at room temperature. The resulting TAT-NDs


7


Page 8 of 37

were washed with water and extracted by centrifugation. The TAT-NLS-NDs were re-suspended in autoclaved water.

Nucleic acid-TAT-NLS-NDs 50 µg of nucleic acid (4.01 nmol) was added into TAT-NLS-NDs with in HEPES (400 µL). The mixture was shaken for 1 h. The nucleic acid-coated nanodiamonds were washed with water and extracted by centrifugation. The final product was re-suspended in autoclaved water. The nucleic acid sequences are listed in Table 1. Nucleic acid sequences Sequence (5’  3’) ANA4625

CsTsGsAsGsAsCsTsTsTsAsAsTsAsAsAsAsGsGsCsAsTsCsCsCsAsGsCsCs TsCsCsGsTsT

DNA

CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT

DNA-Cy3

Cy3- CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT

DNA-Cy5

Cy5- CTGAGACTTTAATAAAAGGCATCCCAGCCTCCGTT

Table 1. Nucleic acid sequences. *Backbone of oligonucleotide modified to phosphorothiolate is labeled with ‘s’, underlined bases are methoxylethoxyl modified at 2’-α-position of ribose sugar. Confocal fluorescence microscopy imaging. Cells were seeded and cultured in glass bottom dishes for overnight. Samples were added and incubated for few hours. After being washing with buffers for 3 times, cell imaging was ready. For colocalization studies, 3 µL of 0.5 mM of the relevant tracker was added and incubated with cell samples for ~ 30 min. The λex of ND is 633 nm and the λem region is above 700 nm. The λex of hoescht is 405 nm and the λem region is from 430 to 470 nm. The λex of tracker is 488 nm and the λem region is from 550 to 600 nm.


8

Page 9 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cell culture. MCF-7 breast adenocarcinoma cells were routinely cultured in DMEM supplemented with 10 % of FBS and 1 % of penicillin with streptomycin. The cells were incubated in a humidified 5 % CO2 atmosphere at 37 oC. When cells grow up to about 95 % confluence, they were then treated with a standard trypsin-based technique and re-seeded in confocal imaging dishes of concentration about 4 × 104 cell L-1. Samples were added to cells with ~70 % confluence and then incubated for additional 12 h. Fourier transform infrared (FTIR). Functional groups on the surface of modified-NDs were characterized by Fourier Transform Infrared Spectroscopy (FTIR) studies. Dried functionalized NDs were well mixed with KBr powder to form a KBr pellet containing 0.2 - 1 % of ND sample. Signal from a pure KBr pellet was subtracted as a background. Dynamic light scanning (DLS). Size distributions and zeta potential values of functionalized NDs were analyzed by DLS. Each ND sample was suspended in water at a concentration of 50 µg/mL. Solution containing NDs was detected by Zetasizer. Refractive index of carbon (2.42) was chosen as a reference to calculate the size distribution of NDs in terms of intensity. UV-Visible spectrophotometry analysis of adsorption of TAT-NLS on carboxyl-ND. The amount of TAT-NLS peptide adsorbed on the surface of carboxyl-ND was determined by absorbance at 205 nm which is the absorption wavelength of peptide bond. 3.12, 6.25, 12.5, 25, 50, 100, 150, 200 μg of TAT-NLS peptide was added respectively into carboxyl-ND with a fixed amount of 500 μg. Nanoparticles were remove by centrifugation. The absorption of unbound peptide after the reaction was analyzed by NanoDrop OneC Spectrophometer. The amount of peptide in the residue was calculated according to the calibration curve of standard TAT-NLS peptide solution. The maximum of TAT-NLS peptide adsorbed on carboxyl-ND was determined to be about 6 μg per 100 μg of carboxyl-ND.


9


Page 10 of 37

Fluorescence studies of DNA coated TAT-NLS-NDs. In order to determine the approximate amount of DNA4625 coated on the surface of TAT-NLS-NDs, fluorescence experiment was performed. Different amounts of DNA 4625 linked with fluorescent molecule, Cy3, (ranged from 82.5 ng to 2640 ng) were added to react with TAT-NLS-NDs with a fixed amount of 100 μg. Nanoparticles were remove by centrifugation. The fluorescent intensity of each solution residue was measured by Spectrofluometer. The amount of oligonucleotide remained was calculated from the standard calibration curve. The maximum amount of DNA4625-Cy3 coated on the surface of 100 μg of TAT-NLS-NDs was calculated to be ~ 1600 ng. Flow cytometry. 1 × 105 Hela, MCF-7, HepG2, KB and bEnd3 cells were seeded on 6-well plates and cultured overnight, and then incubated with corresponding samples for 12 h. After washing with PBS for few times, cells were analyzed by flow cytometer. The Cy5 fluorescence signal was excited at wavelength of 488 nm and collected from 543 to 627 nm. MTT assay. 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay was used to compare the cytotoxicity of DNA-coated NDs with naked DNA, TAT-NLS-NDs and carboxyl-NDs. 2.5 × 104 cells were seeded in 24 wells plate and cultured overnight in 37 oC incubator with 5% CO2 overnight, and then incubated with corresponding samples for 24 h. Cells were then incubated with fresh medium containing 0.5 mg/mL MTT for 2 h at 37 °C for the cytotoxicity assay. After incubation, the medium was removed and the solution of DMSO and ethanol (1:1) was added. The absorbance at 570 nm was measured using a microplate reader. Bcl-2 and bcl-xL mRNA expression. Total RNA was isolated from cells by the use of the RNeasy Mini Kit. RNA extracted was converted to cDNA by the use of SuperScript® III First-Strand Synthesis SuperMix. Real-time amplification was performed according to SsoAdvanced™ Universal SYBR® Green Supermix protocol. Relative quantification of gene expression using


10

Page 11 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Gapdh as an internal standard and the comparative threshold cycle (CT) method. For bcl-2 and bclxL pre-mRNA studies, the corresponding DNA primer pair sequences of the targets bcl-2 and bclxL were designed with the forward primer in exon 2 and reversed primer in exon 3 using Basic Local Alignment Search Tool (BLAST). The sequences of bcl-2 primer pair are 5’CATGTGTGTGGAGAGCGTCA-3’ (FR) and 5’- GCAGGCATGTTGACTTCACTTG-3’ (RP) while the sequences of bcl-xL primer pair are 5’- AGTCGGATCGCAGCTTGGA-3’ (FR) and 5’AGGAACCAGCGGTTGAAGC-3’ (RP). For bcl-2 and bcl-xL matured mRNA studies the sequences of two bcl-2 primers are 5’-CATGTGTGTGGTGAGCGTCAA-3’ (FR) and 5’GCCGGTTCAGGTACTCAGTCA-3’(RP). While the sequences of bcl-xL, primers are 5’TCCTTGTCTACGCTTTCCACG-3’ (FR) and 5’-GGTCGCATTGTGGCCTTT-3’ (RP). Analysis of relative gene expression was performed by QuantStudio 3D Digital PCR System. Relative data were presented in comparison with untreated control sample. The RT-PCR products were characterized by gel electrophoresis. 5 ng of each sample was loaded onto a 10 % polyacrylamide gel, the lengths of DNA were compared to the standard DNA ladder. In the premRNA studies, the expected length of the DNA products of bcl-2 is 268 bp, and bcl-xL is 155 bp. Western blot analysis. Proteins were extracted from cultured cells by CelLytic M and the quantification was performed by BCA protein assay with the use of microplate reader. 35 μg of cell lysate was separated by 12% SDS-PAGE gel. The proteins were transferred to polyvinylidene fluoride (PVDF) membrane, and the blots were blocked in 3% BSA (bovine serum albumin) with Tris-buffered saline supplemented with 0.1% Tween® 20 (TBST) for 1 h. Then, they were incubated with Bcl-2 mouse monoclonal antibody/ Bcl-xL rabbit monoclonal antibody with the dilution of 1:1000 in TBST containing 5% BSA at 4oC overnight. For detection of primary antibodies, the blots were incubated with anti-mouse IgG, HRP-linked antibody/ ant-rabbit IgG,


11


Page 12 of 37

HRP-linked antibody with the dilution of 1:1000 in TBST containing 5% BSA at room temperature for 1 h. The blots were stripped and reprobed with beta-actin antibody as the loading control. Visualization of immunocomplexes were performed by enhanced chemiluminescence with the use of ECL kit. The luminescent bands were detected by Luminescent Image Analyzer. RESULTS AND DISCUSSION To develop a multifunctional ND system, a non-covalent approach is used to immobilize cationic peptides onto negatively-charged NDs via electrostatic interaction in aqueous medium. This is a clean approach to modify the surface chemistry of the ND as no heavy metals or transitional metals are involved in the entire synthetic process. Firstly, the commercially available NDs were cleaned with strong acid mixture H2SO4-HNO3-HClO4 (1:1:1,vol/vol/vol) and then oxidized to become carboxyl-NDs. The Fourier Transform Infrared spectroscopy (FTIR) spectrum of the oxidized NDs exhibits O-H stretching vibration at 3429 cm-1 and the corresponding C=O stretching vibration of the carboxyl group at 1779 cm-1 (Figure 1A). The peptide-functionalized NDs (TAT-NLS-NDs) are formed by mixing cationic TAT-NLS peptides to the negatively charged coated NDs in HEPES buffer (pH 7.4). DLS studies were conducted to determine the average size and surface potential of modified NDs (Table 2). The oxidized ND in deionized water forms particle size of ~ 28.52 ± 1.1 nm with narrow size distribution, showing its good dispersity. As compared to PEI and NPVP coating, immobilization of TAT-NLS peptides onto the oxidized NDs just slightly increased the average cluster size of 63.78 ± 13.8 nm, indicating that peptide immobilization does not make NDs prone to serious aggregation.18,21,26 In addition, TAT-NLS-ND revealed a more positive zeta potential (+42 mV) than carboxyl-NDs (-31.6 mV) did, due to the coating of cationic peptides. The polydispersity indices (PDI) of carboxyl ND, TAT-NLS-ND and DNA-TAT-NLS-ND from DLS studies are found to be 0.191 ± 0.026, 0.303 ± 0.080 and 0.335 ± 0.076 respectively (Table


12

Page 13 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2). These results indicate that the modified NDs exhibited intermediate, moderately polydisperse distribution and their size distribution did not change much even the TAT-NLS-NDs were further coated with DNA 4625. The physicochemical property of TAT-NLS-NDs was examined using FTIR. The successful coating of NDs with TAT-NLS was confirmed by the presence of peptide bond. The FTIR spectrum of TAT-NLS-NDs shows C=O stretching vibration of the amide I at 1721 cm-1 and C–N stretching vibration and N–H bending of the amide II at 1598 cm-1. Compared to carboxyl-NDs, TAT-NLS-NDs exhibit new peaks at 2851 cm-1, 2870 cm-1, 2923 cm-1 and 2966 cm-1, which correspond to IR-active signals of the substitutes of amino acids from symmetric CH2 stretching, symmetric CH3 stretching, asymmetric CH2 stretching and asymmetric CH3 stretching respectively. The co-existence of TAT-NLS and loaded cargo such as nucleic acids on the surface of ND was accomplished by mixing negatively-charged, Cy5-labeled DNA4625 to TAT-NLSNDs in HEPES buffer at pH 7.4, resulting in DNA-coated TAT-NLS-NDs. DLS studies also revealed a relatively high negative value of zeta potential in DNA-coated TAT-NLS-NDs than that of TAT-NLS-NDs in deionized water. Indirect methods in terms of measuring the UV-Vis absorbance of unbound peptide at 205 nm which is the absorption wavelength of peptide bond and measuring the Cy3 fluorescence intensity of unbound nucleic acids at 550 nm were used to determine the amount of peptide and nucleic acid cargo coated on ND. We found that maximum 1.6 µg and 6 µg of fluorophore-labeled nucleic acid and peptide were successfully loaded onto 100 µg NDs via electrostatic interactions, meaning the ratio of nucleic acid to peptide on modified NDs is found to be ~ 1:3.75 (Figures 1B-C). In contrast, the maximum amount of Cy-labeled DNA4625 loaded on 100 ng TAT-ND was determined to be ~ 0.5 µg, which is much lower than that on TATNLS-NDs (Figure 1D). This difference may possibly attribute to the higher positive surface charge of TAT-NLS enhance the ability of TAT-NLS-NDs to condense or immobilize negatively-charged


13


Page 14 of 37

substances tightly. Additionally, DLS results of TAT-NDs in deionized water showed a relatively large particles of 372.3 ± 31.7 nm with polydispersity features (Table 2). These aggregated particles would not favor for passing through the nuclear pore and getting into the nucleus in living cells. To further investigate the amount of DNA desorbed after several times of washing onto the purified DNA-Cy5-TAT-NLS-NDs, the fluorescence intensity of Cy5-labeled DNA in the residue solution was measured and compared. In Figure 1E, a substantial fluorescence signal of purified DNA-Cy5-TAT-NLS-NDs was obtained at 567 nm, confirming the successful coating of Cy5labeled DNA after washing off the unbound DNAs. Subsequently, there are no significant Cy5 fluorescence signals in the residue observed after washing the purified DNA-Cy5-TAT-NLS-NDs for five times (e.g from 1nd to 5th washing). These results strongly suggested that intensive washing procedure did not give rise to noticeable desorption which is possibly due to the high positive surface charge of TAT-NLS-NDs to facilitate immobilization of negatively-charged substances. The fact that TAT-NLS does not contribute greatly to the size of the ND which is important in its use in constructing nuclear targeting vehicles as the diameter of the nuclear pore complex is around 20 -70 nm depending on the cell types. Collectively, these results indicated that facile surface modification of ND with short, cationic TAT-NLS peptide is highly achievable.


14

Page 15 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 (A) FTIR spectra of raw NDs, carboxyl-NDs and TAT-NLS-NDs. (B) The amount of TAT-NLS adsorbed on carboxyl-NDs is plotted against the total amount of TAT-NLS added. The amount of Cy3-labeled DNA4625 adsorbed on (C) TAT-NLS-NDs and (D) TAT-NDs is plotted against the total amount of Cy3-labeled DNA4625 added. Error bars indicated the standard


15


Page 16 of 37

deviation of at least three measurements. (E) The fluorescence intensity of Cy5 from the purified DNA-Cy5-TAT-NLS-NDs after several washings.

Sample

Size [nm]

Zeta potential [mV]

PDI

Carboxyl-ND

28.52 ± 1.1

- 31.6 ± 14.6

0.191 ± 0.026

TAT-NLS-ND

63.78 ± 13.8

+ 42.5 ± 11.0

0.191 ± 0.026

TAT-ND

372.3 ± 31.7

+22.5 ± 1.6

0.634 ±0.106

DNA-TAT-NLS-ND

282.6 ± 34.2

- 33.4 ± 1.2

0.335 ± 0.076

Table 2 A summary table of DLS data of the modified NDs in terms of their size intensity, zeta potential and PDI in water.

To evaluate the cellular uptake efficiency of peptide-functionalized NDs, flow cytometry analysis in different cell lines was performed. By monitoring and comparing the Cy5 fluorescence signal of the loaded DNA4625 on TAT-NLS-ND and carboxyl-NDs, we found that the TAT-NLSND system can be taken up more efficiently by a number of cell lines including HeLa, MCF-7, KB, HepG2 and bEnd3 and the loaded Cy5-labeled DNA4625 were delivered into the cells by TAT-NLS-ND more efficiently than by carboxyl-ND system (Figure 2A). To further confirm the mean fluorescence signal obtained in Figure 2A being from Cy5 fluorophores and eliminate the possibility of getting misleading fluorescence signals from ND itself in these flow cytometry studies, we performed additional control experiments. MCF-7 cells treated with a number of samples including carboxyl-NDs, TAT-NLS-NDs, DNA4625-TAT-NLS-NDs, DNA4625-Cy5TAT-NLS-NDs and DNA4625-Cy5 itself for flow cytometry analysis (Figure 2B). Only those samples consisting of Cy5-labeled DNA 4625 were being recorded which means that only the Cy5


16

Page 17 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorophore is being tracked and the observed fluorescence signals are not coming from ND. Additionally, comparing to the DNA4625-Cy5 itself, the cellular uptake of loaded Cy5-labeled DNA4625 could be dramatically enhanced in the presence of NDs as the carriers. To determine the amount of internalization of loaded payloads, the fluorescence signal of the Cy-labeled DNA 4625 which were loaded on the TAT-NLS-ND’ surface in the residue of the tissue culture plate was measured as a function of incubation time. By comparing with the fluorescence signal of loaded 800 ng Cy-labeled DNA 4625, we found that ~ 500 ng of DNA 4625 was taken up by cells after 3 h incubation. No further uptake was observed even up to 24 h incubation (Figure 2C). MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay was used to determine the viability of different cell lines as a function of ND concentrations (Figure 2D). MTT results revealed that TAT-NLS-NDs (without cargo loading) exhibited low cytotoxicity to a number of cell lines even up to a concentration of 100 µg/mL, confirming their biocompability.


17


Page 18 of 37

Figure 2 (A) The normalized mean fluorescence signals of Cy5 in different cells after incubating with DNA-Cy5-TAT-NLS-NDs and Cy5-labeled ND. (B) The normalized mean fluorescence signals of Cy5 in MCF-7 cells after incubating with a number of different samples as negative controls. Excitation was at 640 nm while collection was from 656-684 nm. (C) A plot of the amount of Cy-labeled DNA4625 uptake in MCF-7 cells as a function of incubation time. (D) Cell viability studies of TAT-NLS-NDs as a function of concentration of ND in different cell lines.

Subsequently, the intracellular localization of modified NDs was investigated via confocal fluorescence studies. The NV− centers in NDs emit red light with maximum fluorescence emission at ~ 700 nm when they are excited by visible light sources e.g. 633 nm laser. After treating cells


18

Page 19 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with TAT-NLS-NDs coated with Cy3-labeled DNA4625 for 24 h, NDs showed efficient cellular uptake and most of them were localized in the nucleus as the ND signals (red) overlapped with nucleus staining, Hoechst (blue) in HeLa and MCF-7 cells. More importantly, we also observed the Cy3 fluorophore signal inside the nucleus in which it completely overlapped with the fluorescence signals of ND and Hoechst (Figures 3A-B). Indeed, with the help of this TAT-NLSND platform, the loaded cargos could also be delivered to the nucleus in living cells. However, the majority of TAT-NDs randomly distributed in the cytoplasm and did not show nucleartargeting ability after cellular uptake in HeLa and MCF-7 cells (Figures 3C-E). Additionally, the uncoated carboxyl-NDs were seldomly taken up by MCF-7 and HeLa cells (Figures 3F-G) which is in good agreement with the results obtained in Figure 2A. These results simply demonstrated that the capability of TAT-NLS-ND systems as efficient nuclear-targeted transporters for negatively-charged cargos such as siRNA, miRNA, plasmid DNA, etc. However, the amount of NDs entering the nucleus is still low because the size distribution of ND is a bit wide (polydispersity index < 1). Thus, only the smaller size of TAT-NLS-NDs could effectively passed through the pore of nucleus membrane and entered the nucleus without any aggregation problem. Together with the flow cytometry, fluorescence colocalization experiments and MTT studies, TAT-NLS-ND was further confirmed as a safe, simple, efficient carrier which not only facilitates the enhanced cellular uptake as compared to carboxyl-NDs but also confers nucleus targeting property in a number of cell lines. Our findings are in good agreement with previous studies which indicated by combining cell penetrating peptide TAT with NLS peptide helps to not only greatly promote effective uptake of macromolecules across the cell membrane by binding itself to cell surface receptors but also bind to importin β and translocate to the nucleus.33,34 This surface modification strategy would offer an alternative positively-charged peptide-functionalized ND


19


Page 20 of 37

platform for physical absorption of negatively-charged cargo for delivery applications as well. This is the first example of ND-mediated delivery of cargos to the nucleus by means of passive diffusion through the nuclear pore complex.


20

Page 21 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



21


Page 22 of 37

Figure 3 Confocal fluorescence images of DNA4625-Cy3-TAT-NLS-NDs in (A) MCF-7 and (B) HeLa cells staining with Hoechst. Confocal fluorescence images of DNA4625-TAT-NDs in MCF7 cells staining with (C) lyso-tracker, (D) mito-tracker and (E) endo-tracker. Confocal fluorescence images of carboxyl-NDs in (F) MCF-7 and (G) HeLa cells. Scale bar is 10 μm.

Gene therapy has emerged as one of the most common approaches to treat a large variety of diseases such as cancer, infectious diseases, respiratory diseases and neurodegenerative disorders which are initiated by abnormal gene expression.35 It could offer a powerful mechanism to control gene expression in eukaryotic cells by introducing foreign genetic materials to suppressing or enhancing the expression of a gene at transcriptional or translational levels. RNA interference (RNAi) holds a great promise in the field of small interfering RNA (siRNA)-based therapeutics.36 These doubled-stranded siRNA molecules typically play an important role in cleaving of complementary mRNA. However, the severe enzymatic degradations of siRNA before reaching the nucleus in living system together with its poor intracellular uptake resulted in a limited applications for their clinical uses.37–39 So far, nanodiamond-mediated delivery of molecular therapeutic drugs,40–43 protein,44,45 siRNA46 or miRNA25 to the cytoplasm has been widely reported. Recent years, significant progress on the development of a series of chemically modified nucleic acid analogues and mimics with increased target affinity and resistance to nucleases has been explored.47 For example, Stahel and his co-workers designed a novel bispecific antisense nucleic acid 4625 (ANA4625) which is 20-mer with a 2’-O-methyoxy-ethoxy (MOE)-modified phosphorothioate backbone for bcl-2 and bcl-xL gene knockdown in lung carcinoma cells.48 However, this MOE-modified antisense oligonucleotide exhibited very limited cellular uptake effect without the standard lipofectamine transfecting treatment, which is known to have serious


22

Page 23 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cytotoxic effects by virtue of the high surface charge.49 The efficient delivery of therapeutic antisense oligonucleotides into designed sites in tumor cells remains the biggest barrier in antisense-based therapy against cancer. Additionally, researches have reported that antisense oligonucleotides (ASOs) can function both in the cytoplasm and nucleus to target the matured mRNA and pre-mRNA respectively.50 By using this nuclear-targeted delivery vector, it is believed that their therapeutic efficacy can be highly ameliorated. In this study, ANA 4625 just chosen as an example of payload to demonstrate the nuclear-targeting delivery of TAT-NLS-NDs. ANA 4625 was immobilized on the peptide-functionalized ND carriers by mixing two of them in aqueous media. The kinetic release of the ANA 4625 coated onto TAT-NLS-NDs in PBS buffer solution at 37 °C was also examined. The fluorescence intensity of released Cy5-labeled ANA 4625 in the buffer solution was measured as a function of time. The original amount of Cy5-labeled ANA 4625 immobilized onto TAT-NLS-NDs was also determined and taken as a reference. In figure 4A, we found that about 32 % of ANA 4625 was released in the first 3 h and it was gradually released as the incubation time is increased up to 12 h. About 88 % of ANA 4625 was released after 24 h. We then treated MCF-7 human breast adenocarcinoma cells expressing high level of both bcl-2 and bcl-xL with ANA4625-coated TAT-NLS-NDs and ANA 4625 with/without lipofectamine respectively. Real-time PCR analyses of the reverse transcripts were conducted. Even though ANA 4625 used in this study is not for correction of pre-mRNA splicing, it does increase the chance to down-regulate its target pre-mRNA in the nucleus. In Figure 4B,ANA 4625 alone (without lipofectamine treatment) does not have significant inhibition effect on bcl-2 and bcl-xL pre-mRNA expression while a positive control of ANA 4625 does in the presence of transfecting agent. As compared to lipofectamine treamtment, the antisense activity of ANA 4625 exhibited much stronger inhibition effects on both target bcl-2 and bcl-xL pre-mRNA when


23


Page 24 of 37

antisense oligonucleotide was transported by TAT-NLS-ND carriers. To verify the molecular size of the designed resultant RNAs, denaturing PAGE gel analysis of the RT-PCR products was performed (Figure 4C). In untreated MCF-7 cells (lane 1 for bcl-2 and lane 5 for bcl-xL), we confirmed that PT-PCR resultant products corresponding to the expected size of bcl-2 (268 bp) and bcl-xL (155 bp) DNAs were amplified accordingly. Additionally, the amount of the resultant bcl-2 (lane 2) and bcl-xL (lane 6) DNA products in the presence of carriers indeed reduced as compared to the untreated cell (lane 1 and 5) and positive control samples (lane 4 and 8). These results are the most direct evidence for regulation of pre-mRNA of bcl-2 and bcl-xL by the ASO. These observations are possibly attributed to the nuclear-targeting delivery which would largely change the destination of the majority antisense oligonucleotides from cytoplasm to the nucleus. As such, ANA 4625 could ultimately hybridize to the target pre-mRNA to form a complex in the nucleus in order to hinder the mRNA translation process in the cytoplasm. We also quantified the bcl-2 and bcl-xL pre-mRNA levels as a function of concentration and incubation time. Figure 4D shows the bcl-2 and bcl-xL pre-mRNA levels after treatment with ANA4625-TAT-NLS-NDs for 12 h at ND dosage of 3.75-60 µg/mL. It is of noted that increasing the dose of ANA4625-TATNLS-NDs enhanced down-regulation activity in a large extent for bcl-2 pre-mRNA but not for bclxL pre-mRNAs. Nearly 83.2 ± 1.6 % and 91.7 ± 2.7% of bcl-2 pre-mRNA inhibition could be obtained at a dose of 30 and 60 µg/mL respectively. We also quantified the bcl-2 and bcl-xL premRNA levels as a function of time at dosage of 30 µg/mL. As shown in Figure 4E, bcl-2 and bclxL pre-mRNA levels were reduced down to ~82.3 ±2.3 % and 55.0 ± 4.1 % after 6 h, and down to ~83.1 ± 1.6 % and 63.2 ± 0.56 % after 12 h incubation at dosage of 30 µg/mL ANA4625-TATNLS-NDs respectively. These results indicated that inhibition of bcl-2 and bcl-xL pre-mRNA expression is in time- and dose-dependent manner. Similar suppression effects were resulted in the


24

Page 25 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


target matured mRNAs (Figure S1). These results have indicated that NDs can be used to mediate sustained release of antisense agents with preserved therapeutic activity. Additionally, western blot analysis was used to investigate the desired protein expression. As shown in Figure 4F, 48 h after the treatment of ANA4625-TAT-NLS-NDs, it showed the inhibition effect and reduced bcl-2 and bcl-xL protein levels to 41 % and 47 % of their untreated controls respectively. In overall, the inhibition extent of bcl-2 mRNA expression is much stronger than that of bcl-xL mRNA expression, which is in good agreement with the results of the inhibition of their mRNA levels. These results are highly attributed to the three mismatches of ANA 4625 to bcl-xL mRNA. It is of note that the sequence of ANA 4625 is fully complementary to a region of homology consisting of nucleotide 605-624 of the bcl-2 mRNA but is partially complementary to the region of homology nucleotide 687-706 of the bcl-xL mRNA.48


25


Page 26 of 37


26

Page 27 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 (A) The kinetic release of Cy5-labeled ANA 4625 which is coated onto TAT-NLS-NDs in PBS buffer solution at 37 °C as a function of time. (B) Bcl-2 and bcl-xL pre-mRNA levels in MCF-7 cells after treatment with 30 µg/mL ANA4625-TAT-NLS-NDs and ANA4625 (with/without transfection) for 12 h. (C) Denaturing PAGE analysis of the resultant RT-PCR products. Lanes 1 and 5: Control; lanes 2 and 6: ANA4625-TAT-NLS-NDs; lanes 3 and 7:ANA4625 without transfection; lanes 4 and 8: ANA4625 with transfection. Bcl-2 and bcl-xL mRNA levels in MCF-7 cells (D) after treatment with different doses of ANA4625-TAT-NLSNDs and (E) after treatment with 30 µg/mL ANA4625-TAT-NLS-NDs at different time points. (F) Western blot analysis of bcl-2 and bcl-xL expression in MCF-7 cells after treatment with or without ANA4625-TAT-NLS-NDs. Protein expression was assessed 48 h after treatments. Results were reprobed for β-actin to confirm equal protein loading. The percentage of protein expression was quantified using ImageJ software in scanned films and corrected for β-actin loading. (G) Cell viability studies of MCF-7 cells in the presence of different samples after incubating for overnight. ND’s concentration is considered and three measurements are recorded in all experiments.

Recent studies indicated that overexpression of the anti-apoptoic proteins such as bcl-2 and bclxL are significantly involved in the development of numerous tumors.51 The inhibition of these two targets should increase apoptosis such that the cell viability should be decreased. To validate this effect, MTT assay was performed. As shown in Figure 4G, no significant cell death was observed in the cell samples treated with TAT-NLS-ND or carboxyl-NDs, indicating very low cellular cytotoxicity of ND carriers. ANA4625 loaded on TAT-NLS-ND carriers exhibited high cytotoxicity in MCF-7 cells possibly due to the strong apoptosis effects vis the induction of capase3-like protease activity and nuclear condensation and fragmentation, as compared with untreated


27


Page 28 of 37

cell samples.48,52 On the other hand, ANA4625 only facilitates cell death in the presence of lipofectamine because of low cellular uptake of non-transfected ANA4625. These results confirmed that antisense oligonucleotide 4625 can be effectively delivered by the ND carriers to the nucleus of tumor cells and can efficiently induce cell death through suppressing bcl-2 and bclxL gene expression.

CONCLUSIONS In summary, we have developed a nuclear-targeted delivery platform based on nanodiamonds, which can be used for gene silencing in cancer cells. Dual-function, cationic peptides which consist of TAT and NLS were electrostatically immobilized on the ND surface. As compared to uncoated NDs, cationic peptide-functionalized NDs was confirmed as a safe, simple, efficient carrier which not only facilitates the enhanced cellular uptake and delivery of cargos to the nucleus in a number of cell lines but also shows their advantages of low cytotoxicity and high affinity to nucleic acid cargos. This is the first example of ND-mediated delivery of cargos to the nucleus by means of passive diffusion through the nuclear pore complex. Recent studies indicated that overexpression of the anti-apoptoic proteins such as bcl-2 and bcl-xL are significantly involved in the development of numerous tumors. Compared with traditional gene silencing in cytoplasm, the antisense activity of ANA 4625 exhibited much stronger effects on both target bcl-2 and bcl-xL in MCF-7 cells when antisense agents were transported by this nuclear-targeted ND-based carrier. The enhanced therapeutic efficacy of antisense oligonucleotide is highly attributed to the change of the destination of the majority therapeutic materials from cytoplasm to the nucleus. This is the first example of NDs showing the nuclear-targeted delivery of ASO indeed increased the chance to


28

Page 29 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


down-regulate its target pre-mRNA in the nucleus for enhanced disease therapy. Thus, we believe our work would result in a great impact in the field of biomedical sciences. ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publication website. Results of suppression of the Bcl-2 and Bcl-xL matured mRNAs in MCF-7 cells after ND treatment.

AUTHOR INFORMATION Corresponding Author *Email: [email protected]. Tel: +852 34427840 Notes The authors declare no competing financial interest. ACKNOWLEDGMENT This work was supported by National Science Foundation of China (NSFC 21778043, 31671103, 21574109), Health and Medical Fund (HMRF 05160336, 03141076), Hong Kong Research Grants Council (21300314 and 11213717) and City University of Hong Kong (CityU 7004456, 9680104, 7004398, 7004655 and 7004604).

REFERENCES (1)

Kole, R.; Sazani, P. Antisense effects in the cell nucleus: modification of splicing. Curr. Opin. Mol. Ther. 2001, 3 (3), 229–234, PMID 11497345.

(2)

Tkachenko, A. G.; Xie, H.; Coleman, D.; Glomm, W.; Ryan, J.; Anderson, M. F.; Franzen,


29


Page 30 of 37

S.; Feldheim, D. L. Multifunctional Gold Nanoparticle−Peptide Complexes for Nuclear Targeting. J. Am. Chem. Soc. 2003, 125 (16), 4700–4701, DOI 10.1021/ja0296935. (3)

Li, N.; Yang, H.; Yu, Z.; Li, Y.; Pan, W.; Wang, H.; Tang, B. Nuclear-targeted siRNA delivery for long-term gene silencing. Chem. Sci. 2017, 8 (4), 2816–2822, DOI 10.1039/C6SC04293G.

(4)

Oyelere, A. K.; Chen, P. C.; Huang, X.; El-Sayed, I. H.; El-Sayed, M. A. Peptide-conjugated gold nanorods for nuclear targeting. Bioconjug. Chem. 2007, 18 (5), 1490–1497, DOI 10.1021/bc070132i.

(5)

Wang, Y.; Chen, J.; Irudayaraj, J. Nuclear targeting dynamics of gold nanoclusters for enhanced therapy of HER2+ breast cancer. ACS Nano 2011, 5 (12), 9718–9725, DOI 10.1021/nn2032177.

(6)

Chen, F.; Gerion, D. Fluorescent CdSe/ZnS nanocrystal-peptide conjugates for long-term, nontoxic imaging and nuclear targeting in living cells. Nano Lett. 2004, 4 (10), 1827–1832, DOI 10.1021/nl049170q.

(7)

Wang, D.; Tong, Y.; Li, Y.; Tian, Z.; Cao, R.; Yang, B. PEGylated nanodiamond for chemotherapeutic drug delivery. Diam. Relat. Mater. 2013, 36, 26–34, DOI 10.1016/j.diamond.2013.04.002.

(8)

Schrand, A. M.; Huang, H.; Carlson, C.; Schlager, J. J.; Ōsawa, E.; Hussain, S. M.; Dai, L. Are Diamond Nanoparticles Cytotoxic? J. Phys. Chem. B 2007, 111 (1), 2–7, DOI 10.1021/jp066387v.

(9)

Bumb, A.; Sarkar, S. K.; Billington, N.; Brechbiel, M. W.; Neuman, K. C. Silica encapsulation of fluorescent nanodiamonds for colloidal stability and facile surface functionalization. J. Am. Chem. Soc. 2013, 135 (21), 7815–7818, DOI 10.1021/ja4016815.


30

Page 31 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(10) Kuo, Y.; Hsu, T.-Y.; Wu, Y.-C.; Hsu, J.-H.; Chang, H.-C. Fluorescence lifetime imaging microscopy of nanodiamonds in vivo; Hasan, Z. U., Hemmer, P. R., Lee, H., Santori, C. M., Eds.; 2013; p 863503, DOI 10.1117/12.2004494. (11) Yu, S.-J.; Kang, M.-W.; Chang, H.-C.; Chen, K.-M.; Yu, Y.-C. Bright Fluorescent Nanodiamonds: No Photobleaching and Low Cytotoxicity. J. Am. Chem. Soc. 2005, 127 (50), 17604–17605, DOI 10.1021/ja0567081. (12) Yuan, Y.; Chen, Y.; Liu, J. H.; Wang, H.; Liu, Y. Biodistribution and fate of nanodiamonds in vivo. Diam. Relat. Mater. 2009, 18 (1), 95–100, DOI 10.1016/j.diamond.2008.10.031. (13) Sushkov, A. O.; Chisholm, N.; Lovchinsky, I.; Kubo, M.; Lo, P. K.; Bennett, S. D.; Hunger, D.; Akimov, A.; Walsworth, R. L.; Park, H.; et al. All-optical sensing of a single-molecule electron spin. Nano Lett. 2014, 14 (11), 6443–6448, DOI 10.1021/nl502988n. (14) Kucsko, G.; Maurer, P. C.; Yao, N. Y.; Kubo, M.; Noh, H. J.; Lo, P. K.; Park, H.; Lukin, M. D. Nanometre-scale thermometry in a living cell. Nature 2013, 500 (7460), 54–58, DOI 10.1038/nature12373. (15) Chan, M. S.; Liu, L. S.; Leung, H. M.; Lo, P. K. Cancer-Cell-Specific MitochondriaTargeted Drug Delivery by Dual-Ligand-Functionalized Nanodiamonds Circumvent Drug Resistance.

ACS

Appl.

Mater. Interfaces

2017,

9

(13),

11780–11789,

DOI

10.1021/acsami.6b15954. (16) Kim, H.; Man, H. Bin; Saha, B.; Kopacz, A. M.; Lee, O.; Schatz, G. C.; Ho, D.; Liu, W. K. Multiscale Simulation as a Framework for the Enhanced Design of NanodiamondPolyethylenimine-Based Gene Delivery. J. Phys. Chem. Lett. 2012, 3 (24), 3791–3797, DOI 10.1021/jz301756e. (17) Zhang, P.; Yang, J.; Li, W.; Wang, W.; Liu, C.; Griffith, M.; Liu, W. Cationic polymer


31


Page 32 of 37

brush grafted-nanodiamond via atom transfer radical polymerization for enhanced gene delivery and bioimaging. J. Mater. Chem. 2011, 21 (21), 7755, DOI 10.1039/c1jm10813a. (18) Alhaddad, A.; Adam, M. P.; Botsoa, J.; Dantelle, G.; Perruchas, S.; Gacoin, T.; Mansuy, C.; Lavielle, S.; Malvy, C.; Treussart, F.; et al. Nanodiamond as a vector for siRNA delivery to Ewing sarcoma cells. Small 2011, 7 (21), 3087–3095, DOI 10.1002/smll.201101193. (19) Huynh, V. T.; Pearson, S.; Noy, J.-M.; Abboud, A.; Utama, R. H.; Lu, H.; Stenzel, M. H. Nanodiamonds with Surface Grafted Polymer Chains as Vehicles for Cell Imaging and Cisplatin Delivery: Enhancement of Cell Toxicity by POEGMEMA Coating. ACS Macro Lett. 2013, 2 (3), 246–250, DOI 10.1021/mz4000199. (20) Zhao, L.; Xu, Y. H.; Akasaka, T.; Abe, S.; Komatsu, N.; Watari, F.; Chen, X. Polyglycerolcoated nanodiamond as a macrophage-evading platform for selective drug delivery in cancer cells. Biomaterials 2014, 35 (20), 5393–5406, DOI 10.1016/j.biomaterials. 2014.03.041. (21) Cao, W.; Peng, X.; Chen, X.; Wang, X.; Jin, F.; Li, Q.; Chen, H.; Jiang, C.; Ye, Z.; Xing, X. Facile synthesis of cationic polymer functionalized nanodiamond with high dispersity and antibacterial activity. J. Mater. Sci. 2017, 52 (4), 1856–1867, DOI 10.1007/s10853016-0475-6. (22) Moghimi, S. M.; Symonds, P.; Murray, J. C.; Hunter, A. C.; Debska, G.; Szewczyk, A. A two-stage poly(ethylenimine)-mediated cytotoxicity: implications for gene transfer/therapy. Mol. Ther. 2005, 11 (6), 990–995, DOI 10.1016/j.ymthe.2005.02.010. (23) Ishida, T.; Wang, X.; Shimizu, T.; Nawata, K.; Kiwada, H. PEGylated liposomes elicit an anti-PEG IgM response in a T cell-independent manner. J. Control. Release 2007, 122 (3), 349–355, DOI 10.1016/j.jconrel.2007.05.015.


32

Page 33 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(24) Chen, M.; Zhang, X. Q.; Man, H. B.; Lam, R.; Chow, E. K.; Ho, D. Nanodiamond vectors functionalized with polyethylenimine for siRNA delivery. J. Phys. Chem. Lett. 2010, 1 (21), 3167–3171, DOI 10.1021/jz1013278. (25) Deng, X.; Yin, Z.; Lu, J.; Xia, Y.; Shao, L.; Hu, Q.; Zhou, Z.; Zhang, F.; Zhou, S.; Wu, Y.; et al. Two-Step Assembling of Near-Infrared “OFF-ON” Fluorescent Nanohybrids for Synchronous Tumor Imaging and MicroRNA Modulation-Based Therapy. ACS Appl. Mater. Interfaces 2017, 9 (4), 3294–3305, DOI 10.1021/acsami.6b11438. (26) Zhang, X. Q.; Chen, M.; Lam, R.; Xu, X.; Osawa, E.; Ho, D. Polymer-functionalized nanodiamond platforms as vehicles for gene delivery. ACS Nano 2009, 3 (9), 2609–2616, DOI 10.1021/nn900865g. (27) Chu, Z.; Miu, K.; Lung, P.; Zhang, S.; Zhao, S.; Chang, H.-C.; Lin, G.; Li, Q. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery. Sci. Rep. 2015, 5 (1), 11661, DOI 10.1038/srep11661. (28) Doh, K.-O. Validation of Heterodimeric TAT-NLS Peptide as a Gene Delivery Enhancer. J. Microbiol. Biotechnol. 2015, 25 (6), 788–794, PMID 25588561. (29) Yi, W.-J.; Yang, J.; Li, C.; Wang, H.-Y.; Liu, C.-W.; Tao, L.; Cheng, S.-X.; Zhuo, R.-X.; Zhang, X.-Z. Enhanced Nuclear Import and Transfection Efficiency of TAT Peptide-Based Gene Delivery Systems Modified by Additional Nuclear Localization Signals. Bioconjug. Chem. 2012, 23 (1), 125–134, DOI 10.1021/bc2005472. (30) Hoyer, J.; Neundorf, I. Peptide vectors for the nonviral delivery of nucleic acids. Acc. Chem. Res. 2012, 45 (7), 1048–1056, DOI 10.1021/ar2002304. (31) Guo, X.; Chu, X.; Li, W.; Pan, Q.; You, H. Chondrogenic effect of precartilaginous stem cells following NLS-TAT cell penetrating peptide-assisted transfection of eukaryotic


33


Page 34 of 37

hTGFβ3. J. Cell. Biochem. 2013, 114 (11), 2588–2594, DOI 10.1002/jcb.24606. (32) Eguchi, A.; Furusawa, H.; Yamamoto, A.; Akuta, T.; Hasegawa, M.; Okahata, Y.; Nakanishi, M. Optimization of nuclear localization signal for nuclear transport of DNAencapsulating

particles.

J.

Control.

Release

2005,

104

(3),

507–519,

DOI

10.1016/j.jconrel.2005.02.019. (33) Yang, S.; Coles, D. J.; Esposito, A.; Mitchell, D. J.; Toth, I.; Minchin, R. F. Cellular uptake of self-assembled cationic peptide-DNA complexes: Multifunctional role of the enhancer chloroquine.

J.

Control.

Release

2009,

135

(2),

159–165,

DOI

10.1016/j.jconrel.2008.12.015. (34) Zhao, M.; Weissleder, R. Intracellular cargo delivery using tat peptide and derivatives. Med. Res. Rev. 2004, 24 (1), 1–12, DOI 10.1002/med.10056. (35) Naldini, L. Gene therapy returns to centre stage. Nature 2015, 526 (7573), 351–360, DOI 10.1038/nature15818. (36) Matzke, M. RNA: Guiding Gene Silencing. Science (80-. ). 2001, 293 (5532), 1080–1083, DOI 10.1126/science.1063051. (37) Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking down barriers: advances in siRNA delivery. Nat. Rev. Drug Discov. 2009, 8 (2), 129–138, DOI 10.1038/nrd2742. (38)

Nguyen, J.; Szoka, F. C. Nucleic Acid Delivery: The Missing Pieces of the Puzzle? Acc.

Chem. Res. 2012, 45 (7), 1153–1162, DOI 10.1021/ar3000162. (39) Soutschek, J.; Akinc, A.; Bramlage, B.; Charisse, K.; Constien, R.; Donoghue, M.; Elbashir, S.; Geick, A.; Hadwiger, P.; Harborth, J.; et al. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 2004, 432 (7014), 173–178, DOI 10.1038/nature03121.


34

Page 35 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(40) Li, Y. Q.; Zhou, X. P.; Wang, D. X.; Yang, B. S.; Yang, P. Nanodiamond mediated delivery of chemotherapeutic drugs. J. Mater. Chem. 2011, 21 (41), 16406–16412, DOI 10.1039/C1JM10926J. (41) Zhang, X. Q.; Lam, R.; Xu, X.; Chow, E. K.; Kim, H. J.; Ho, D. Multimodal nanodiamond drug delivery carriers for selective targeting, imaging, and enhanced chemotherapeutic efficacy. Adv. Mater. 2011, 23 (41), 4770–4775, DOI 10.1002/adma.201102263. (42) Wang, Z.; Tian, Z.; Dong, Y.; Li, L.; Tian, L.; Li, Y.; Yang, B. Nanodiamond-conjugated transferrin as chemotherapeutic drug delivery. Diam. Relat. Mater. 2015, 58, 84–93, DOI 10.1016/j.diamond.2015.06.008. (43) Li, J.; Zhu, Y.; Li, W.; Zhang, X.; Peng, Y.; Huang, Q. Nanodiamonds as intracellular transporters of chemotherapeutic drug. Biomaterials 2010, 31 (32), 8410–8418, DOI 10.1016/j.biomaterials.2010.07.058. (44) Shimkunas, R. A.; Robinson, E.; Lam, R.; Lu, S.; Xu, X.; Zhang, X. Q.; Huang, H.; Osawa, E.; Ho, D. Nanodiamond-insulin complexes as pH-dependent protein delivery vehicles. Biomaterials 2009, 30 (29), 5720–5728, DOI 10.1016/j.biomaterials.2009.07.004. (45) Hu, X.; Li, X.; Yin, M.; Li, P.; Huang, P.; Wang, L.; Jiang, Y.; Wang, H.; Chen, N.; Fan, C.; et al. Nanodiamonds Mediate Oral Delivery of Proteins for Stem Cell Activation and Intestinal Remodeling in Drosophila. ACS Appl. Mater. Interfaces 2017, 9 (22), 1857518583, DOI 10.1021/acsami.7b04788. (46) Martin, R.; Alvaro, M.; Herance, J. R.; Garcia, H. Fenton-Treated Functionalized Diamond Nanoparticles as Gene Delivery System. ACS Nano 2010, 4 (1), 65–74, DOI 10.1021/nn901616c. (47) Morihiro, K.; Kasahara, Y.; Obika, S. Biological applications of xeno nucleic acids. Mol.


35


Page 36 of 37

BioSyst. 2017, 13 (2), 235–245, DOI 10.1039/c6mb00538a. (48) Zangemeister-wittke, U.; Leech, S. H.; Olie, R. A.; Cells, T.; Zangemeister-wittke, U.; Olie, R. A.; Simo, A. P.; Martin, P.; Hall, J.; Nalin, C. M.; et al. A Novel Bispecific Antisense Oligonucleotide Inhibiting Both bcl-2 and bcl-xL Expression Efficiently Induces Apoptosis in Tumor Cells. Clin. Cancer Res. 2000, 6 (June), 2547–2555, PMID 10873111. (49) Lv, H.; Zhang, S.; Wang, B.; Cui, S.; Yan, J. Toxicity of cationic lipids and cationic polymers in gene delivery. J. Control. Release 2006, 114 (1), 100–109, DOI 10.1016/j.jconrel.2006.04.014. (50) CROOKE, S. T. Molecular Mechanisms of Antisense Drugs: RNase H. Antisense Nucleic Acid Drug Dev. 1998, 8 (2), 133–134, DOI 10.1089/oli.1.1998.8.133. (51) Thomas, S.; Quinn, B. A.; Das, S. K.; Dash, R.; Emdad, L.; Dasgupta, S.; Wang, X.-Y.; Dent, P.; Reed, J. C.; Pellecchia, M.; et al. Targeting the Bcl-2 family for cancer therapy. Expert Opin. Ther. Targets 2013, 17 (1), 61–75, DOI 10.1517/14728222.2013.733001. (52) Gautschi, O.; Tschopp, S.; Olie, R. A.; Leech, S. H.; Simoes-Wust, A. P.; Ziegler, A.; Baumann, B.; Odermatt, B.; Hall, J.; Stahel, R. A.; et al. Activity of a Novel bcl-2/bcl-xLBispecific Antisense Oligonucleotide Against Tumors of Diverse Histologic Origins. JNCI J. Natl. Cancer Inst. 2001, 93 (6), 463–471, DOI 10.1093/jnci/93.6.463.

SYNOPSIS A novel design of dual-function, cationic peptides-coated nanodiamond as smart nanocarriers for nuclear delivery of therapeutic agents to suppress the target pre-mRNA expression for potential gene therapy.


36

Page 37 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC


37

Dual-Function, Cationic, Peptide-Coated Nanodiamond Systems

Recommend Documents