Dual-Functional Dendritic Mesoporous Bioactive Glass Nanospheres

Subscriber access provided by NEW MEXICO STATE UNIV

Biological and Medical Applications of Materials and Interfaces

Dual-functional Dendritic Mesoporous Bioactive Glass Nanospheres for Calcium-Influx Mediated Specific Tumor-Suppression and Controlled Drug Delivery in vivo Baiyan Sui, Xin Liu, and Jiao Sun ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b05616 • Publication Date (Web): 27 Jun 2018 Downloaded from http://pubs.acs.org on July 1, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Dual-functional Dendritic Mesoporous Bioactive Glass Nanospheres for Calcium-Influx Mediated Specific Tumor-Suppression and Controlled Drug Delivery in vivo Baiyan Sui a, 1, Xin Liu a, 1 and Jiao Sun a, * a

Shanghai Biomaterials Research & Testing Center, Shanghai Key Laboratory of

Stomatology, Ninth People's Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200023, China 1

These authors contributed equally.

*

Corresponding Author: E-mail: [email protected]

Address: No. 427, Ju-men Road, Shanghai 200023, China. Tel.: +86 21 63034903; Fax: +86 21 63011643.

Abstract The development of nanomaterials for stable, controlled delivery of drugs and efficiently suppress tumor growth with desirable biosafety remains challenging in the nano-biomedical field. In this study, we prepared and optimized mesoporous bioactive glass (MBG) nanospheres to establish a functional drug delivery system, and analyzed the effect of the dendritic mesoporous structure on drug loading and release. We then utilized an in vitro model to examine the biological effects of dendritic MBG nanospheres on normal and tumor cells, and studied the molecular mechanism underlying specific tumor supression by MBG nanospheres. Finally, we investigated the combinational effect of MBG nanospheres and a cancer therapeutic drug with an

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

in vivo tumor xenograft model. Our results show that the dendritic MBG nanospheres have been successfully synthesized by optimizing calcium: silicon ratio. MBG nanospheres exhibit a dendritic mesoporous structure with large specific surface area, demonstrate high drug loading efficiency, and release drugs in a controlled fashion to effectively prolong drug half-life. Ca2+ in nanospheres activates transient receptor potential (TRP) channels and calcium-sensing receptor (CaSR) on tumor cells, mediates calcium influx, and directly regulates the Calpain-1-Bcl-2-Caspase-3 signaling pathway to specifically suppress tumor growth without affecting normal cells. In addition, dendritic MBG nanospheres synergize with cancer drugs to improve anti-tumor efficacy and reduce systemic toxicity. Dendritic MBG nanospheres with anti-tumor activity and controlled drug release have been successfully achieved and the underlying molecular mechanism was elucidated, paving the way for translational application.

Keywords: dendritic MBG nanospheres; calcium-influx; specific anti-tumor; controlled drug release; activation of TRP channels and CaSR

1. INTRODUCTION One of the key research areas in nanomedicine is to develop functional drug delivery systems. Nanoparticles can efficiently deliver drugs, and therefore nanoparticles with various photo-thermal properties have been developed for tumor treatment, such as Au nanoparticles and graphene oxide nanosheets

1-4


. However, due to their

Page 2 of 44

Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


undegradability, the long-term in vivo retention of these nanoparticles may impose biological risks, thereby limiting their application in the medical field. On the contrary, mesoporous bioactive glass (MBG) is a biodegradable carrier with a unique mesostructured and distinct physicochemical properties, including large specific surface area, and contains biologically active ion components such as calcium and silicon 5-8. Our previous research has shown that MBG nanospheres are safe in vivo 9. However, it remained unknown if MBG nanospheres could be used as a functional drug delivery system for cancer treatment, which directly depends on (1) the effect of MBG nanospheres on tumor cells, and (2) the drug loading and release efficiency of MBG nanospheres. Understanding this question will help us develop a functional drug delivery system based on MBG nanospheres for synergizing with chemotherapeutic drugs to improve anti-tumor efficacy and reduce toxicity. Recently, it becomes of increasing interest that inorganic nanomaterials may exert anti-tumor effects by releasing ions in the acidic tumor microenvironment. Zhang et al. showed that at pH 5.0, selenium-doped hydroxyapatite nanoparticles released large amounts of selenium, which effectively inhibited the growth of bone tumor in vivo10. Several groups have reported that calcium and silicon were released from MBG nanospheres during degradation, and the amount of released ions was increased under acidic condition 11-12. The release of calcium from MBG nanospheres may impact cytobiology. It has been shown that excess intracellular Ca2+ causes cell damage and apoptosis

13-14

, and one of the most effective approaches for treating

tumors is to induce tumor cell apoptosis. Therefore, it is conceivable that MBG



nanospheres may exert anti-tumor effects by releasing Ca2+. Efficient drug delivery requires high drug loading efficiency and well-controlled drug release. Currently available MBG nanospheres typically have small mesoporous with variable wormhole-like structures 11, 15, which limit their capacity of loading and delivering large-molecule drugs or proteins. Although addition of pore-swelling agents during synthesis resulted in mesoporous expansion 16, these agents may destroy the mesopore structure and as a result, may not be conducive to drug loading and release. Therefore, to improve drug delivery, it is critical to obtain larger and more uniform mesopore structure by optimizing the reactant ratio and surfactant for MBG synthesis. For example, it has been shown that the diameter of micelle increases as the alkyl chain of surfactant increases, resulting in larger mesopores 17-18. In addition, the ratio between reactants affects hydrolytic condensation, and therefore the mesoporous size and structure are tuned. However, few have tried to optimize the structure of MBG nanospheres by adjusting the reactant ratio. In the present study, we prepared a type of dendritic MBG nanospheres with large specific surface area and variable mesoporous channels by optimizing MBG structure through adjusting calcium content in the silica matrix system, and used mesoporous silica nanoparticles (MSNs) as the control. To understand the effect of the mesopore structure on drug loading and release, we studied drug loading capacity of dendritic MBG nanospheres, and plasma concentration and half-life of the loaded drug. We then examined the effect of MSN and dendritic MBG nanospheres on the viability of normal and tumor cells. By analyzing intracellular calcium level, the


Page 4 of 44

Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


expression of calcium channel genes and protein, and critical apoptotic protein, we revealed that dendritic MBG nanospheres exert inhibitory effects on tumor growth mediated by calcium influx. Finally, we confirmed the anti-tumor effect of dendritic MBG nanospheres with an in vivo tumor xenograft model. In summary, we successfully developed a new type of dendritic MBG nanospheres with large specific surface area, high drug loading efficiency and controlled drug release, and these nanospheres demonstrate strong anti-tumor effects.

2. EXPERIMENTAL SECTION 2.1. Chemicals and Reagents Polyvinylpyrrolidone (PVP, K30), cetyl pyridine bromide (CPB), tetraethyl orthosilicate (TEOS), calcium nitrate tetrahydrate, triethyl phosphate (TEP), (3-Aminopropyl) triethoxysilane (APTES) and fluorescein isothiocyanate isomer I were purchased from Sigma-Aldrich (St. Louis, MO). Modifed Eagle’s Medium (MEM), RPMI-1640 and phosphate buffer solution (PBS) were bought from HyClone Laboratories, Inc. (Logan, USA). Trypsin-EDTA (0.25%), bovine serum (FBS), and penicillin-streptomycin solution were bought from Gibco Laboratories (NY, USA). CCK-8 assay kit was bought from Beyotime Biotechnology (Shanghai, China). Annexin V-FITC/PI detection kit was purchased from BD Biosciences (San Diego, USA). RNeasy Mini Kit was bought from QIAGEN (Frankfurt, German). SYBR Premix EX Taq and PrimeScript 1st strand cDNA Synthesis Kit were both bought from Takara Bio Inc. (Japan). Quest™ Fluo-8 AM was get from AAT Bioquest Inc.



(USA). RIPA Lysis, Extraction Buffer and Halt™ Protease Inhibitor Cocktail were bought from Thermo fisher scientific (MA, USA). Bicinchoninic acid (BCA) protein assay was get from Pierce (Rockford, USA). Nitrocellulose (NC) membranes were acquired from Amersham Biosciences (Sweden). TRPC6, TRPM4, TRPM8, CaSR, Calpain-1, Bcl-2, cleaved Caspase-3, β-actin and horseradish peroxidase-conjugated anti-rabbit IgG/anti-rabbit/mouse IgG secondary antibody were purchased from Abcam (Cambridge, UK). ECL chemiluminescence reagent was get from Millipore (MA, USA). 2.2. Preparation MSN and MBG nanospheres with different reactant radio were separately prepared by a modified method 9, 19. In a typical synthesis procedure of MSN, 0.23 g of NaOH and 1.0 g of CPB in sequence were completely dissolved into 480 mL of ddH2O under vigorous stirring at 80 °C. After 1 hour, 5 mL of TEOS was added and stirred for 24 h, then the milk-white mixture was collected by centrifugation and washed for three times with ethanol. The final products were dried via vacuum freeze dryer (LABCONCO, USA) to obtain MSN. MBG nanospheres, including MBG 80S15Ca and MBG 70S25Ca represent the molar ratio of silica, calcium and phosphorus (Si: Ca: P) in the two compounds (80: 15: 5 and 70: 25: 5). Briefly, 0.23 g NaOH and 1.0 g of PVP were dissolved in 120 mL ddH2O. After stirring for 10 mins, 1.4 g CPB was dissolved to the solution and stirred continuously for one hour. Next, TEOS, calcium nitrate tetrahydrate and triethyl phosphate were added subsequently, and the preparation process to obtain two kinds of MBG was described as previously 9.


Page 6 of 44

Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.3. Characterization The morphology and element composition characteristic bands of as-prepared MSN and MBG nanospheres were observed and analyzed by high-resolution transmission electron microscopy (TEM, JEM-2100, JEOL) and energy dispersive spectrometer (EDS, Falion 60S, EDAX). The size of three nanospheres was measured by Nano Measure software. Brunauer-Emmett-Teller (BET) and Barrett-Joyner-Halenda (BJH) (ASAP 2020M+C, Micromeritics) analyses were used to determine the specific surface area, mesoporous volume and mesoporous size distribution of MSN and MBG nanospheres by N2 adsorption-desorption isotherms. 2.4. Construction of Drug Loading System Firstly, doxorubicin hydrochloride (DOX) was dissolved ultrasonically in PBS with the concentrations of 1 mg/mL. 10 mL Dox-PBS solution was mixed with 1.25, 2.5 and 10 mg of the dendritic MBG nanospheres (Si: Ca: P=80: 15: 5) with shaking away from light at room temperature for 24 h, respectively. Then, Dox-MBG nanospheres were collected after centrifugation at the rate of 8000 rpm for 20 min and gently washed by distilled water for three times. The collected washing solutions and supernatant were measured at 480 nm by a Thermo Scientific Microplate Reader (Multiskan™ GO, USA). For comparison, the loading of DOX in MSNs was also determined. The Dox loading efficiency and loading content were calculated by using the following equations: Weight of drug in MBG ×100% (1) Initial weight of Dox Weight of drug in MBG Loading content(%)= ×100% (2) Weight of drug loaded Dox-MBG Loading efficiency(%)=



2.5. Pharmacokinetics Female BALB/c mice at weight of 18-20g were bought from SLACCAS Laboratory Animal Co, Ltd. (Shanghai, China). The animal experimental studied were approved according to the Independent Ethics Committee of Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine. 0.8 mL blood was drawn from eyes of tumor-free healthy BALB/c mice after treatment of Dox-MBG nanospheres, Dox-MSN and Dox (Dox dose:5 mg/kg) for 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48 and 72 h (15 mice per each time point). The blood was mixed with 2 mL extraction solvent (chloroform: methanol=4:1) by vortex. The mixture was centrifuged at 4000 rpm for 15 min. Chloroform phase was entirely taken and dried by nitrogen flow, and was re-dissolved with 100 µL methyl alcohol, then was centrifuged at 10000 rpm for 5 min. Dox concentration in the supernatant was detected by ultra-performance liquid chromatography-tandem mass spectrometry(UPLC-MS/MS, Agilent, USA) under the conditions listed below: an Eclipse XDB-C18 column (150 mm×4.6 mm, 5.0 µm) with mobile phase acetonitrile/water 50:50, injection volume 20µL under the flow rate 1.0 mL/min, column temperature 30 ℃, detection wave length 480 nm. Pharmacokinetic parameters were analyzed using Phoenix WinNonlin 6.4 software: HL Lambda z=half-time, Cmax=calculated maximum plasma concentration, and AUClast=area under the concentration time curve 20. 2.6. Cell Culture The experimental protocols were approved by the Animal Care and Medical Ethics Committee of Ninth People’s Hospital affiliated to School of Medicine, Shanghai Jiao


Page 8 of 44

Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Tong University. Human hepatocellular carcinoma cells (HepG2), human normal liver cells (LO2) were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). HepG2 and LO2 cells were respectively maintained in MEM and RPMI-1640 at 37 °C with 5 % CO2. The culture solutions were supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco), 100 U/mL penicillin and 100ug/mL streptomycin. 2.7. Cell Viability HepG2 and LO2 cells were separately seeded at a density of 6 ×103 cells/well in 96-well plates and cultured for 24 h. Then, the medium in the wells was respectively replaced with the serial dilutions of fresh medium containing MSN and dendritic MBG nanospheres (50-400 µg/mL). The cell viability was measured at 24 and 48 h as described previously 9. 2.8. Annexin V-FITC/PI Apoptosis Assay Normal, apoptosis and necrosis in tumor and normal cells were identified using the Annexin V-FITC/PI detection kit. HepG2 and LO2 cells were separately seeded in 6-well plates at a density of 6 ×105 cells/well and cultured for 24 h. Then, the cells were exposed to 400 µg/mL of MSN and dendritic MBG nanospheres for 48 h, washed thrice with cold PBS and harvested. The cell pellet was resuspended and incubated with 5 µL of Annexin V-FITC for 15 mins in dark and stained with 1 µL of PI. Then, the 800 µL diluted samples that contained at least 104 cells were analyzed by a Guava easyCyte ﬂow cytometer (Millipore, USA), and the data were performed and analyzed via InCyte software (Millipore, USA).



Page 10 of 44

2.9. Measurement of Extracellular and Intracellular Calcium HepG2 and LO2 cells were exposed to 400 µg/mL of dendritic MBG nanospheres in a 6-well plate for 24 and 48 h, respectively. The calcium ions in the medium were measured by an Agilent inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent, USA). The cells were collected and washed with PBS three times, incubated with the calcium sensitive dye Quest™ Fluo-8 AM (5 µmol/L final concentration) for 30 mins. The intercellular calcium level was determined as described previously 21. 2.10. Real-time PCR analysis HepG2 and LO2 cells were individually seeded at a density of 6 ×105 cells per well in a 6-well plate, for 24 h. Then, the cells were exposed to 400 µg/mL of the dendritic MBG nanospheres for 48 h. The total RNA extraction, reverse-transcription and Real-time PCR assay were performed according to the previous study

21-22

. The

primer sequences are shown in Table 1. GAPDH was utilized as a housekeeping gene to normalize results. Table 1. Primers Used for Real Time RT-PCR

Target gene

Forward primer sequence (5’-3’)

Reverse primer sequence (5’-3’)

TRPC6

CGGCTACTACCCCTGCTTC

CTTGTGGAGCGATCACTAAACA

TRPM4

GCACGACGTTCATAGTTGACT

CTTCTCCGTGGTGTGTGCAT

TRPM8

CAGAAGGAATGACACTCTGGAC

TCACCAAGTCGCTTTCACTGT

CaSR

CAATTCGGCAAAACTCTGCTG

GACTCCGGCCTTGATTTGAGA


Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GAPDH

GGAGCGAGATCCCTCCAAAAT

GGCTGTTGTCATACTTCTCATGG

2.11. Western blot analysis HepG2 and LO2 cells were individually treated by the dendritic MBG nanospheres (400 µg/mL) for 48 h, then washed thrice with cold PBS, and lysed in cold RIPA Buffer containing Halt™ Protease Inhibitor Cocktail for 10 mins. The follow-up process, including determination of protein concentration, gel electrophoresis, antibody incubation and chemiluminescence, were performed as described previously 23

. Therein, the NC membranes that electrophoretic transferred was incubated with

TRPC6 (1:1000), TRPM4(1:100), TRPM8(1:1000), CaSR(1:500), Calpain-1 (1:1000), Bcl-2 (1:2000), cleaved Caspase-3 (1:1000), and β-actin (1: 5000) respectively. The results of protein expression were quantified by using ImageJ software (NIH, USA). 2.12. Intracellular Location and Apoptosis of Dendritic MBG nanospheres To observe the cellular localization and apoptosis of the nanospheres, HepG2 and LO2 cells were respectively exposed to 400 µg/mL of nanospheres for 48 h. Then, the two kinds of cells were washed thrice with cold PBS and fixed in 2.5% glutaraldehyde for 24h. The cells were gathered and pelleted by the scraper, underwent a standard laboratory procedure 9, and observed by TEM. 2.13. Calcium ions and Dox Release from Dox-MBG nanospheres The morphology of Dox-MBG nanospheres were observed by TEM (JEM-2100, JEOL). The release of calcium ions and Dox from Dox-MBG nanospheres were measured in three different buffer solutions (pH 7.4, pH 6.5 and pH 5.5). Briefly, 10



mg of Dox-MBG nanospheres were dispersed into 2 mL solutions, then transferred into a dialysis bag (molecular weight: 10 kDa) and dialyzed against 38 mL of the different pH buffer, and shook continuously at 37 °C under a rate of 150 rpm. 10 mL sample was withdrawn at predetermined time points and an equivalent fresh medium was added. The amount of released DOX was determined using a microplate reader at 480 nm. The concentrations of calcium in the supernatants were determined using ICP-OES. 2.14. Cytotoxicity and Intracellular Location of Dox-MBG nanospheres The cytotoxic effect of Dox-MBG nanospheres was estimated by measuring the viability of HepG2 cells after the incubation of nanospheres with graded concentrations (50-400 µg/mL). Dox was used as a control. Furthermore, to confirm the intracellular location of Dox-MBG nanospheres, dendritic MBG nanospheres were labelled by FITC. Briefly, APTES in 20 mL EtOH (1:5, v/v) was stirred for 1 h at room temperature, then 20mg dendritic MBG nanospheres were added into the solution and stirred continuously at 60 ℃ for 6 h. Washed by 3 times, the dendritic MBG nanospheres and 0.1 mM FITC were mixed in EtOH, reacted at room temperature in dark for 1 h, and dendritic MBG nanospheres with fluorescence labeling were obtained by the centrifugation and freeze drying. After loading with Dox, FITC labelled Dox-MBG nanospheres (400 µg/mL) were exposed to HepG2 cells for 48h, and the intercellular location of Dox-MBG nanospheres were observed by using a Cell Imaging Multi-Mode Reader (Cytation 3, BioTek Instruments, USA). 2.14. In vivo antitumor efficacy


Page 12 of 44

Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Antitumor efficacy of the dendritic MBG drug delivery system was analyzed against of xenograft tumor animal model. The tumor animal model was generated through the subcutaneous injection of 1.8 × 106 S180 cells into the right shoulder of female BALB/c mice. After 7 days, the tumor volume approximately reached 80-100 mm3. The 36 tumor-bearing BALB/c mice were randomly divided into 6 groups, intravenously injected with saline, MSN, MBG, Dox-MSN, Dox-MBG and Dox every 2 days within 14 days, respectively. The mice were weighted, and the length (a) and width (b) of tumor were measured by a caliper every 2 day. The volume of tumor (V) was calculated as follow: ab V = (3) 2 Relative tumor growth ratio (G) was calculated as follows: G(%) =

V × 100% (4) V

, where V and V0 are the tumor volume on day 14 and on day 0, respectively. The percentage of the tumor growth inhibition (TGIR) was calculated according to the following equation: TGIR(%) = 1 −

G × 100% (5) G

2.15. Immunohistochemistry, TUNEL and Histology analysis At the end of treatment, the tumor and major organs including heart, liver, lung and kidney were harvested and histopathology tests were performed according to standard laboratory procedures 9. The tumors sections were immunohistochemically stained and labelled using the cleaved caspase-3 antibodies and streptavidin biotin kit (Dako,



Denmark). The sections were observed under an optical microscope (Leica, German). Apoptotic cells in tumor tissues were detected with the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) staining using an apoptotic cell detection kit. Sections were evaluated by using fluorescence microscopy (Leica, German). Caspase-3 IHC and total TUNEL-positive were quantified via NIH ImageJ software according to previous papers 24 2.16. Data analysis The data are expressed as means ± SD. All statistical analyses were carried out using SPSS 20.0 software, and statistical significant differences (p-value＜0.05) were analyzed using the t-test and one-way ANOVA followed by Tukey's HSD post hoc test among the various groups.

3. RESULTS AND DISCUSSION Multi-functional nanomaterials for drug delivery have been an area of intensive ongoing research in biomedicine. MBG nanospheres can potentially serve as a dual-function drug delivery system with efficient tumor inhibition and controlled drug release, because they have large specific surface area and release Ca2+ via their unique mesoporous structure and response to microenvironment. The dual-function of MBG is a of significant meaning to improve anti-tumor efficacy and limit side effects. In the present study, we developed the dendritic MBG nanospheres with radial pore canals. These nanospheres inhibit tumor cell growth and induce tumor cell apoptosis mediated by calcium flux in vitro, and demonstrate excellent anti-tumor effects with


Page 14 of 44

Page 15 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


minimal toxicity in vivo. 3.1. Development of dendritic MBG nanospheres 3.1.1 Preparation and characterization of dendritic MBG nanospheres To apply MBG nanospheres as a drug delivery system as expected, we considered to optimize their structure to overcome the limitation of fixed mesopores. The mixing ratio of raw materials, which may directly affect the content of silicate oligomers, rate of hydrolytic condensation, particle size and stacking structure of nanospheres

25-28

,

plays an important role in determining the structure of MBG nanospheres. For this purpose, we adjusted the ratio of silica to calcium to obtain nanospheres of three different diameters, and the diameter of nanospheres becomes larger with decreasing silicon: calcium ratio (Figure 1A-F). The introduced calcium replaces silicon and is incorporated into the pore wall, resulting in thickening of the pore wall 29. This may explain why increasing calcium content led to larger nanospheres.

Figure 1. Characterization of three nanospheres. TEM images of MSN (A), MBG 80S15Ca (B) and MBG 70S25Ca (C); EDS analysis of MSN (D), MBG 80S15Ca (E)



and MBG 70S25Ca (F). Inset: the size distribution histogram, about 120 nanospheres (MSN and MBG 80S15Ca respectively) and 50 nanospheres of MBG 70S25Ca were measured to obtain the histogram.

Interestingly, among the three groups, only nanospheres in the MBG 80S15Ca group exhibit obvious multi-generational hierarchical dendritic structure: inner mesoporous exhibit hexagonal channels and external mesoporous show radial channels (Figure 1B), while the mesoporous structure of nanospheres in both MSN and MBG 70S25Ca groups only shows a single hexagonal channel (Figure 1A and C). Further N2 absorption/desorption test showed a typical IV-type hysteresis loop in all three groups (Figure 2A-C), but only the MBG 80S15Ca group exhibits two peaks in the pore diameter distribution profile (Figure 2E), suggesting two types of mesoporous mainly differing in size co-exist in these nanospheres, consistent with the observation under TEM that the size of mesoporous are radially increasing from the center to the surface (Figure 1B). The dendritic mesoporous structure of MBG 80S15Ca increases the mean pore diameter and volume, which are larger than these of the other two groups (Table 2).


Page 16 of 44

Page 17 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Nitrogen adsorption-desorption isotherms of MSN (A), MBG 80S15Ca (B) and MBG 70S25Ca (C); pore size distribution of MSN (D), MBG 80S15Ca (E) and MBG 70S25Ca (F); synthesis process of schematic diagram for MBG 80S15Ca (dendritic MBG) nanospheres (G).

Table 2. Structural parameters of different nanospheres

Sample

SBET (m2/g)

VP (cm3/g)

DP (nm)

MSN

939.60

0.89

2.57

MBG 80S15Ca

593.77

1.07

4.88



MBG 70S25Ca

52.67

0.11

Page 18 of 44

4.60

3.1.2 Mechanism underlying the formation of dendritic MBG nanospheres The possible mechanisms underlying the formation of dendritic MBG nanospheres may related with the micro-emulsion system, hydrolysis of surfactant and TEOS and self-assembly polymerization

30-31

, we hypothesize that is: spherical micelles are

formed via non-covalent bonds between hydrophilic and hydrophobic groups in CPB, and silicate oligomers with partially hydrolyzed TEOS bind to the hydrophilic heads on the surface of CPB micelles, and then become nano-seeds after polymerization and curing in the entire reaction system; CPB and silicate that have not been polymerized or cured lie in parallel in the hydrophilic area at the interface, and shear stress caused by constant stirring results in the bending of the curvature interface, leading to the formation of nano-branches with a funnel-like structure; finally, nano-seeds that are moving randomly in the water phase collide with nano-branches, which further surround and co-assemble with nano-seeds to form dendritic nanospheres (Figure 2G). Either increasing (MSN group) or decreasing (MBG 70S25Ca) the content of silica breaks the balance between surfactant and silicate oligomers in the reaction mixture, leading to insufficient synthesis of nano-branches with mesoporous of a uniform size. Dendritic mesopores in MBG 80S15Ca nanospheres have large specific surface area and pore size, which are critical for improving drug loading capacity and bioactivity of MBG nanospheres.


Page 19 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.2. Development and characterization of dendritic MBG nanosphere drug delivery system (DDS) 3.2.1 Drug loading properties of dendritic MBG nanosphere DDS To explore the improvement of drug loading properties on MBG nanospheres with dendritic mesoporous structure, we chose Dox to construct DDS and compared the drug loading efficiency and content of dendritic MBG nanospheres vs. MSNs. We found that, with increasing ratio of Dox to MBG, drug loading content increases from 10.34 ± 0.17% to 43.00 ± 0.11%, and dendritic MBG nanospheres show higher drug loading efficiency and content than MSNs (Figure 3A and B, P < 0.05). The drug loading capacity of inorganic nanomaterials is mainly determined by specific surface area and mesopore size

32

. Although the specific surface area of MSNs in our study

has reached 939.6 m2/g, the mesopores are structurally fixed and small (2.57nm) and therefore limit the drug loading capacity. By contrast, the mesopores in dendritic MBG nanospheres are radically increasing in size, and the average pore size is 4.88 nm in diameter and larger than that of MSNs. The radial mesoporous structure of MBG nanospheres may improve drug encapsulation and therefore increase drug loading efficiency and content.

Figure 3. Drug loading properties of dendritic MBG nanospheres. Drug-loading efficiency (A) and the loading content (B) of Dox-MSN and Dox-MBG nanospheres;



Page 20 of 44

plasma concentration of Dox after intravenous administration with free Dox, Dox-MSN and Dox-MBG nanospheres (C).

3.2.2 In vivo pharmacokinetics Next, we measured plasma concentration of Dox delivered by dendritic MBG nanospheres. As shown in Figure 3C and Table 3, plasma Dox concentration in mice treated with Dox-dendritic MBG (Dox-MBG) nanospheres decreases at a much slower rate than in Dox-free and Dox-MSN groups for 72 hours. Compared with the other two groups, the Dox-MBG group shows longer half-life and higher peak plasma concentration of Dox, and larger area under the curve. Such superior bioavailability of Dox delivered by dendritic MBG nanospheres may be attributable to (1) the unique mesopore structure that protects drugs from degradation under physiological conditions

33

and allows slow release of drugs from inner mesopores in radial

arrangements, and (2) drug chelation to Ca2+ in dendritic MBG nanospheres, which may decrease the initial burst effect to prolong drug release

34

. Our data show that

dendritic MBG nanospheres have superior drug loading efficiency and release drug in a controlled fashion in vivo.

Table 3. Pharmacokinetic parameters after intravenously administration of free Dox, Dox-MSN and Dox-MBG nanospheres. (*p＜0.05 vs. Dox) Parameter

Dox

Dox-MSN

Dox-MBG

HL Lambda z (h)

15.82±3.33

20.10±5.21*

30.57±5.52*


Page 21 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cmax (µg/mL)

6.92±1.40

AUClast (µg.h/mL) 13.79±0.76

16.25±7.64*

58.73±4.77*

17.06±2.85*

74.06±4.67*

3.3. Specific inhibitory effects of dendritic MBG nanospheres on tumor cells and underlying mechanisms 3.3.1 Specific inhibiting effect on tumor cells To understand the feasibility and safety of using dendritic MBG nanospheres as a functional drug delivery for oncotherapy, we tested their effects on both tumor and normal cells. Ideally, dendritic MBG nanospheres should be capable of suppressing tumor cell growth but cause minimal damage to normal cells. To this end, we treated both human normal (LO2) and tumor (HepG2) cells with MSNs (the control) and dendritic MBG nanospheres, and evaluated viability and apoptosis of both cells under the same experimental condition. Our research found that dendritic MBG nanospheres efficiently reduce HepG2 cell viability to 77.37% (Figure 4B) and increase the apoptosis rate to 20.26% without necrosis (Figure 4I), but do not significantly affect LO2 viability and apoptosis. By contrast, MSNs induce necrosis of both normal and tumor cells (Figure 4A and I), which may be due to their large specific surface area (significantly larger than that of dendritic MBG nanospheres, Table 2). High specific surface area increases surface activities, leading to the generation of reactive oxygen species and subsequent damage to cells. This hypothesis is based on previous reports that oxidative stress induced by MSNs with high specific surface area causes cell death 35.



Figure 4. Cytotoxic and apoptotic effect of two nanospheres on different cells. Cell viability of LO2 and HepG2 cells after exposure to MSN (A) and dendritic MBG (B) at a wide range of concentrations; representative dot plots of Annexin V-FITC/PI staining of LO2 and HepG2 cells untreated (C & F), treated with MSN (D & G) and dendritic MBG (E & H); Apoptosis and necrosis ratios obtained from Annexin V-FITC/PI double staining (I).

3.3.2 Calcium influx induced by dendritic MBG nanospheres We next asked why dendritic MBG nanospheres selectively induce tumor cell apoptosis without affecting normal cells. MBG nanospheres contain bioactive ingredient calcium (Figure 1E), and Ca2+ plays an important role in regulating cellular growth and apoptosis as a second messenger

36-37

. We measured extracellular and

intracellular calcium levels of both cell lines treated with dendritic MBG nanospheres


Page 22 of 44

Page 23 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by ICP and flow cytometry. Our results showed that although dendritic MBG nanospheres increase the extracellular calcium level of both cell lines (Figure 5A and B，P < 0.05), intracellular Ca2+ level is elevated only in tumor cells but not in normal cells (Figure 5C-E), suggesting that only tumor cells respond to excess extracellular calcium. Intracellular calcium concentration is associated with different phases of the cell cycle progression, and interfering with Ca2+ signaling often disrupts progression of the cell cycle

38-39

. Excess cytoplasmic calcium disrupts intracellular Ca2+

homeostasis and causes cell death, and this phenomenon was reported in Huang et al.’s study on 20 nm ZnO nanoparticles

14

. Therefore, cell apoptosis induced by

dendritic MBG nanospheres observed in Figure 4I may be mediated by excess intracellular calcium.



Figure 5. The activation of calcium influx involved in tumor cells exposed to dendritic MBG nanospheres. Extracellular calcium ion concentration of LO2 (A) and HepG2 (B); representative original fluorescent graphs (C) of intracellular calcium level of LO2 (a-d) and HepG2 (e-h): control (a, c, e, g), dendritic MBG (b, d, f, h); mean fluorescent density of intracellular calcium level of LO2 (D) and HepG2 (E); TRPC6, TRPM4, TRPM8 and CaSR mRNA expression of LO2 (F) and Hep G2 cells (G); representative expression profile of proteins for TRPC6, TRPM4, TRPM8 and CaSR (H); the relative density of the bands normalized to β-actin by gray value analysis (I). *P < 0.05.


Page 24 of 44

Page 25 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.3.3 Signaling pathways activated by dendritic MBG nanospheres to mediate calcium influx into tumor cells We then aimed to understand why excess calcium in the extracellular environment only induces calcium influx into tumor cells, but not normal cells. It has been reported that calcium channel and calcium-sensing receptor (CaSR) mediate calcium influx 40. Transient receptor potential (TRP) channels are a group of cation channels primarily located on the plasma membrane, and TRP channels can detect a wide variety of stimuli and transport Ca2+ and other cations

41-42

. CaSR is a G protein-coupled

receptor that senses extracellular Ca2+ levels, and after binding to Ca2+, activates the pathway involving phospholipase C (PLC)/IP3 and mitogen activated protein kinase (MAPK) to increase intracellular Ca2+ concentration

43-45

. To test if TRP channel and

CaSR are involved in the different responses of LO2 and HepG2 cells to dendritic MBG nanospheres, we examined the expression of CaSR and two major TRP channel subfamilies TRPC and TRPM, and found that the expression of TRP channels and CaSR on both gene and protein level is specifically up-regulated in HepG2 cells after exposure to dendritic MBG nanospheres, but not in LO2 cells (Figure 5F-I, P＜0.05). Despite the lack of direct evidence, we speculate that the different responses may be related to the different physiology of normal vs. tumor cells: normal cells shut down the calcium channel to protect against damage caused by calcium influx in a high-calcium extracellular environment, while tumor cells, due to their more vigorous metabolism, activate the calcium channel to induce calcium influx, which results in apoptosis. These results revealed the critical pathway underlying specific tumor



Page 26 of 44

suppression by dendritic MBG nanospheres: dendritic MBG nanospheres release Ca2+, establish a high-calcium extracellular environment, and selectively activate TRP channels and CaSR on tumor cell plasma membrane, which leads to Ca2+ influx and apoptosis.

3.3.4 Calcium influx-apoptosis signaling pathway activated by dendritic MBG nanospheres in tumor cells To understand if excessive intracellular Ca2+ directly induces tumor cell apoptosis, we examined the Ca2+ influx-cell apoptosis signaling pathway. Calpain-1 is a Ca2+-dependent cysteine protease, and activated Calpain-1 acts as a cleavage enzyme and participates in apoptosis mediated by Caspase-3, a key regulator of apoptosis 46-47. Bcl-2 is a substrate of Calpain-1, and plays a key role in maintaining cellular homeostasis and repressing apoptosis

46, 48

. Western blot results showed that, in

contrast to unchanged expression in LO2 cells, the expression of Calpain-1 and cleaved Caspase-3 is elevated in HepG2 cells, and the expression of pro Caspase-3 and Bcl-2 is decreased (Figure 6A and B, P＜0.05). TEM microscopy also revealed that only HepG2 cells exhibit apoptosis body, nuclear fragmentation, and loss of nucleus (Figure 6D and E), which are typical changes during apoptosis. These results further confirmed dendritic MBG nanospheres specifically induce apoptosis of tumor cells. Taken together, the molecular mechanism underlying tumor cell apoptosis induced by dendritic MBG nanospheres could be explained as follows: calcium overload in tumor cells upregulates Calpain-1, which cleaves Bcl-2


46

, disrupts

Page 27 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


intracellular Ca2+ homeostasis, and finally activates Caspase-3 to induce irreversible apoptosis.

Figure 6. Apoptosis signaling pathway in tumor cells exposed to dendritic MBG nanospheres. Representative images of western blot analysis for Calpain-1, Bcl-2, pro Caspase-3 and Cleaved Caspase-3 (A); the relative density of the bands normalized to β-actin by gray value analysis (B); TEM micrographs of LO2 (C) and HepG2 (D, E) exposed to dendritic MBG nanospheres. The red arrows denote the apoptotic body and the blue arrow denote the dissolved nucleus. *P < 0.05.

3.3.5 Calcium and Dox Controlled Release from DDS Having established that dendritic MBG nanospheres could induce apoptosis in tumor cells by specifically regulating TRP channel and CaSR activities, we further questioned that whether the MBG nanospheres could control the release of Ca2+/ Dox



and inhibit the growth of tumor cells after drug loading. To mimic the unique acidic environment in tumor tissue/cell in vivo, the release of Ca2+ and Dox from dendritic MBG nanospheres was analyzed in various pH buffer solutions, and the intracellular location of the Dox-MBG nanospheres and its effect on tumor cell viability were also detected. Our data showed MBG nanospheres loaded with Dox maintained the dendritic mesoporous structure (Figure 7A), and the release of Ca2+ and Dox were pH dependent and increased with the decrease of pH (Figure 7B and C), suggesting that the dendritic MBG nanospheres have an excellent capacity of pH responsive drug release. It might be due to that the loaded drugs could chelate Ca ions in the MBG pore wall as discussed above

7, 34

, and the pore walls structure of the dendritic MBG

nanospheres were relatively thin and highly susceptible to acid degradation, which lead to the dissolution of calcium ions on the pore walls and the accelerated release of the chelating drugs. Moreover, our fluorescence microscopy images further revealed that Dox-MBG nanospheres could effectively enter into the cell and located in the cytoplasm, resulting in cell fragmentation (Figure 7E). Meanwhile, the cell viability of tumor cells decreased with the increase of Dox-MBG concentration and exposure time (Figure 7F). Our data indicated that Dox-MBG nanospheres not only had a good performance for drug-controlled release, but also could kill the tumor cells continuously.


Page 28 of 44

Page 29 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Release curve, intracellular location and cytotoxicity of Dox-MBG nanospheres. TEM images of Dox-MBG (A); the release of Ca2+ (B) and Dox (C) from Dox-MBG nanospheres at different pH values; fluorescence images of HepG2 cells untreated (D) and treated with Dox-MBG (E); the cytotoxicity of Dox-MBG nanospheres on HepG2 (F). *P < 0.05.

3.4. In vivo anti-tumor effects of dendritic MBG nanospheres 3.4.1 Inhibitory effects of dendritic MBG nanospheres on tumor growth Based on the above data, we then developed a mouse tumor xenograft model to simulate short-term chemotherapy for studying the effect of Dox-MBG on tumor growth. We found that tumor volume was significantly decreased after the injection of dendritic MBG nanospheres (8.64 ± 4.63 mm3), compared with saline (23.67 ± 3.42 mm3) and MSN (19.16 ± 7.94 mm3) groups, demonstrating that dendritic MBG nanospheres themselves exert excellent anti-tumor effects. When mice were treated



with Dox-MBG, tumor volume was further decreased to 4.02 ± 1.26 mm3 (Figure 8). Our results revealed that (1) the inhibitory effect of dendritic MBG nanospheres on tumor growth is significantly better than that of MSNs; and (2) dendritic MBG nanospheres synergize with Dox, and the combination efficiently inhibits tumor growth.

Figure 8. In vivo therapy study of treatment with Saline, MSN, dendritic MBG, Dox-MSN, Dox-MBG and free DOX. Photograph of the solid tumors removed at the termination of the study (A), the curves of the relative tumor volume (B), tumor growth inhibition ratio (C), body weight change of the mice (D). *P＜0.05.

To understand how MBG nanospheres suppress tumor growth, we analyzed tumor tissues by cleaved Caspase-3 immunohistochemistry and TUNEL assay. Our


Page 30 of 44

Page 31 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


results showed that the number of apoptotic cells, labeled by brown cleaved Caspase-3 staining and green nuclei, in tumor tissue sections treated with dendritic MBG nanospheres is significantly greater than that in MSN-treated tumors and comparable to that in drug treatment groups (Figure 9). This demonstrates that dendritic MBG nanospheres induce apoptosis of tumor cells by activating Caspase-3. Caspase family is the common pathway for transmitting apoptosis signal, and Caspase-3 is a critical effector caspase in the apoptosis signaling cascade. In addition, cleaved Caspase-3 staining appears in nuclei, consistent with previous studies showing that activated Caspase-3 translocate from cytoplasm to nucleus of apoptotic cells 49. Our data here demonstrate that dendritic MBG nanospheres efficiently inhibit tumor growth in vivo by inducing apoptosis.



Figure 9. Apoptotic cell in tumor sections. Caspase-3 immunohistochemical staining and TUNEL staining of tumor after treating with Saline, MSN, dendritic MBG, Dox-MSN and Dox-MBG and free DOX (A); quantification of Caspase-3 (B)


Page 32 of 44

Page 33 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and TUNEL cell (C) by ImageJ software. *p＜0.05 vs. the saline. #p＜0.05.

3.4.2 Biosafety assessment of dendritic MBG nanospheres in vivo Although our research above shows that dendritic MBG nanospheres exhibit minimal damage to LO2 cells in vitro, the systemic toxicity of dendritic MBG nanospheres and Dox-MBG drug delivery system needs to be assessed in vivo. We found that dendritic MBG nanospheres and Dox-MBG did not cause obvious pathological changes in major organs during treatment, but resulting cell lysis and fragmentation to a certain extent in tumor (Figure 10). Animals treated with free Dox exhibited serious side effects, including weight loss (16.09 ± 0.97 g ， Figure 8D), and further histopathological examination showed that interstitial lymphocytes infiltrated into the heart (Figure 10), which may be related to drug-induced myocarditis. These observations suggest that dendritic MBG nanospheres can efficiently reduce cardiac and systemic toxicity caused by Dox. The mesoporous structure and calcium content of dendritic MBG nanospheres may allow efficient drug chelation 11, 34 to decrease the burst effect on non-target organs. In tumor tissues, the local acidic microenvironment disrupts the bond between drug molecules and Ca2+, thereby assisting controlled drug release from nanospheres. Therefore, dendritic MBG nanospheres can synergize with cancer drugs to improve therapeutic efficacy, and control drug release to reduce toxicity.



Figure 10. Histological assessments of tumor tissues (× ×10) and major organs (× × 20) after injection by Saline, MSN, dendritic MBG nanospheres, Dox-MSN and Dox-MBG nanospheres and free DOX with H&E stain in mice. The black arrows denote interstitial lymphocyte.

4. CONCLUSION In the present study, we have successfully developed a dendritic mesoporous MBG nanospheres with radial channels by optimizing the ratio between reactants. These nanospheres have large specific surface area, and Ca2+ in nanospheres chelate to drug molecules, thereby effectively controlling drug release and prolonging the in vivo drug half-life. In addition, dendritic MBG nanospheres activate TRP channels and CaSR on tumor cells, induce calcium influx, activate Calpain-1 to cleave Bcl-2, disrupt cellular homeostasis, and activate Caspase-3 apoptosis signaling cascade,


Page 34 of 44

Page 35 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


thereby achieving specific tumor suppression with minimal effects on normal cells. Finally, in vivo studies show that dendritic MBG nanospheres synergize with cancer therapeutic drugs to achieve efficient tumor suppression with low toxicity. Our findings suggest that dendritic MBG nanospheres can serve as an excellent drug delivery system for cancer treatment.

AUTHOR INFORMATION Corresponding Authors *E-mail: [email protected] (J. S.) ORCID Jiao Sun: 0000-0002-2300-0500 Notes The authors declare that no competing interests exist. Author Contributions Jiao Sun conceived and designed the experiments. Baiyan Sui and Xin Liu performed the experiments and analyzed the data. Baiyan Sui, Xin Liu and Jiao Sun wrote the manuscript. All authors read and approved the final manuscript.

ACKNOWLEDGMENTS This work was supported by grants from National Natural Science Foundation of China (31771086) and Science and Technology Commission of Shanghai Municipality (18DZ2290300, 16142202800).



Page 36 of 44

REFERENCES (1) Yin, T.; Liu, J.; Zhao, Z.; Zhao, Y.; Dong, L.; Yang, M.; Zhou, J.; Huo, M. Redox Sensitive Hyaluronic

Acid-Decorated

Graphene

Oxide

for

Photothermally

Controlled

Tumor-Cytoplasm-Selective Rapid Drug Delivery. Advanced Functional Materials 2017, 27 (14), 1604620, DOI: 10.1002/adfm.201604620. (2) Li, J.; Hu, Y.; Yang, J.; Wei, P.; Sun, W.; Shen, M.; Zhang, G.; Shi, X. Hyaluronic Acid-Modified Fe3o4@Au Core/Shell Nanostars for Multimodal Imaging and Photothermal Therapy of Tumors. Biomaterials 2015, 38, 10-21, DOI: 10.1016/j.biomaterials.2014.10.065. (3) Wei, P.; Chen, J.; Hu, Y.; Li, X.; Wang, H.; Shen, M.; Shi, X. Dendrimer-Stabilized Gold Nanostars as a Multifunctional Theranostic Nanoplatform for Ct Imaging, Photothermal Therapy, and Gene Silencing

of

Tumors. Advanced

Healthcare

Materials

2016,

5 (24),

3203-3213,

DOI:

10.1002/adhm.201600923. (4) Li, X.; Xing, L.; Zheng, K.; Wei, P.; Du, L.; Shen, M.; Shi, X. Formation of Gold Nanostar-Coated Hollow Mesoporous Silica for Tumor Multimodality Imaging and Photothermal Therapy. ACS Appl Mater Interfaces 2017, 9 (7), 5817-5827, DOI: 10.1021/acsami.6b15185. (5) Kang, M. S.; Lee, N. H.; Singh, R. K.; Mandakhbayar, N.; Perez, R. A.; Lee, J. H.; Kim, H. W. Nanocements Produced from Mesoporous Bioactive Glass Nanoparticles. Biomaterials 2018, 162, 183-199, DOI: 10.1016/j.biomaterials.2018.02.005. (6) Romero-Sanchez, L. B.; Mari-Beffa, M.; Carrillo, P.; Medina, M. A.; Diaz-Cuenca, A. Copper-Containing Mesoporous Bioactive Glass Promotes Angiogenesis in an in Vivo Zebrafish Model. Acta Biomater 2018, 68, 272-285, DOI: 10.1016/j.actbio.2017.12.032. (7) Wu, C.; Chang, J. Multifunctional Mesoporous Bioactive Glasses for Effective Delivery of


Page 37 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Therapeutic Ions and Drug/Growth Factors. Journal of controlled release 2014, 193, 282-95, DOI: 10.1016/j.jconrel.2014.04.026. (8) Zhou, Y.; Shi, M.; Jones, J. R.; Chen, Z.; Chang, J.; Wu, C.; Xiao, Y. Strategies to Direct Vascularisation Using Mesoporous Bioactive Glass-Based Biomaterials for Bone Regeneration. International Materials Reviews 2017, 62 (7), 392-414, DOI: 10.1080/09506608.2016.1266744. (9) Sui, B.; Zhong, G.; Sun, J. Drug-Loadable Mesoporous Bioactive Glass Nanospheres: Biodistribution, Clearance, Brl Cellular Location and Systemic Risk Assessment Via Ca-45 Labelling and Histological Analysis. Scientific Reports 2016, 6, DOI: 10.1038/srep33443. (10) Wang, Y.; Wang, J.; Hao, H.; Cai, M.; Wang, S.; Ma, J.; Li, Y.; Mao, C.; Zhang, S. In Vitro and in Vivo Mechanism of Bone Tumor Inhibition by Selenium-Doped Bone Mineral Nanoparticles. Acs Nano 2016, 10 (11), 9927-9937, DOI: 10.1021/acsnano.6b03835. (11) Wu, C.; Fan, W.; Chang, J. Functional Mesoporous Bioactive Glass Nanospheres: Synthesis, High Loading Efficiency, Controllable Delivery of Doxorubicin and Inhibitory Effect on Bone Cancer Cells. Journal Of Materials Chemistry B 2013, 1 (21), 2710-2718, DOI: 10.1039/c3tb20275e. (12) Wang, X.; Zhang, Y.; Lin, C.; Zhong, W. Sol-Gel Derived Terbium-Containing Mesoporous Bioactive Glasses Nanospheres: In Vitro Hydroxyapatite Formation and Drug Delivery. Colloids and surfaces. B, Biointerfaces 2017, 160, 406-415, DOI: 10.1016/j.colsurfb.2017.09.051. (13) Abdul-Muneer, P. M.; Long, M.; Conte, A. A.; Santhakumar, V.; Pfister, B. J. High Ca(2+) Influx During Traumatic Brain Injury Leads to Caspase-1-Dependent Neuroinflammation and Cell Death. Mol Neurobiol 2017, 54 (6), 3964-3975, DOI: 10.1007/s12035-016-9949-4. (14) Huang, C. C.; Aronstam, R. S.; Chen, D. R.; Huang, Y. W. Oxidative Stress, Calcium Homeostasis, and Altered Gene Expression in Human Lung Epithelial Cells Exposed to Zno Nanoparticles.



Page 38 of 44

Toxicology in vitro 2010, 24 (1), 45-55, DOI: 10.1016/j.tiv.2009.09.007. (15) Lee, J. H.; Mandakhbayar, N.; El-Fiqi, A.; Kim, H. W. Intracellular Co-Delivery of Sr Ion and Phenamil Drug through Mesoporous Bioglass Nanocarriers Synergizes Bmp Signaling and Tissue Mineralization. Acta Biomater 2017, 60, 93-108, DOI: 10.1016/j.actbio.2017.07.021. (16) Xin, C.; Zhao, N.; Zhan, H.; Xiao, F.; Wei, W.; Sun, Y. Phase Transition of Silica in the Tmb-P123-H2o-Teos Quadru-Component System: A Feasible Route to Different Mesostructured Materials.

Journal

of

colloid

and

interface

science

2014,

433,

176-182,

DOI:

10.1016/j.jcis.2014.07.021. (17) Carroll, N. J.; Crowder, P. F.; Pylypenko, S.; Patterson, W.; Ratnaweera, D. R.; Perahia, D.; Atanassov, P.; Petsev, D. N. Microfluidic Synthesis of Monodisperse Nanoporous Oxide Particles and Control of Hierarchical Pore Structure. ACS Appl Mater Interfaces 2013, 5 (9), 3524-9, DOI: 10.1021/am3030195. (18) Sharma, M.; Jain, P.; Mishra, A.; Mehta, A.; Choudhury, D.; Hazra, S.; Basu, S. Variation of Surface Area of Silica Monoliths by Controlling Ionic Character/Chain Length of Surfactants and Polymers. Materials Letters 2017, 194, 213-216, DOI: 10.1016/j.matlet.2017.02.074. (19) He, Q.; Shi, J.; Chen, F.; Zhu, M.; Zhang, L. An Anticancer Drug Delivery System Based on Surfactant-Templated Mesoporous Silica Nanoparticles. Biomaterials 2010, 31 (12), 3335-46, DOI: 10.1016/j.biomaterials.2010.01.015. (20) Feng, W.; Nie, W.; He, C.; Zhou, X.; Chen, L.; Qiu, K.; Wang, W.; Yin, Z. Effect of Ph-Responsive Alginate/Chitosan Multilayers Coating on Delivery Efficiency, Cellular Uptake and Biodistribution of Mesoporous Silica Nanoparticles Based Nanocarriers. ACS Appl Mater Interfaces 2014, 6 (11), 8447-60, DOI: 10.1021/am501337s.


Page 39 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(21) Liu, C.; Liu, X.; Xue, Y.; Ding, T.; Sun, J. Hydrolyzed Tilapia Fish Collagen Modulates the Biological Behavior of Macrophages under Inflammatory Conditions. RSC Advances 2015, 5 (39), 30727-30736, DOI: 10.1039/c5ra02355f. (22) Yu, Y.; Jin, G.; Xue, Y.; Wang, D.; Liu, X.; Sun, J. Multifunctions of Dual Zn/Mg Ion Co-Implanted Titanium on Osteogenesis, Angiogenesis and Bacteria Inhibition for Dental Implants. Acta Biomater 2017, 49, 590-603, DOI: 10.1016/j.actbio.2016.11.067. (23) Liu, X.; Sui, B.; Sun, J. Blood-Brain Barrier Dysfunction Induced by Silica Nps in Vitro and in Vivo: Involvement of Oxidative Stress and Rho-Kinase/Jnk Signaling Pathways. Biomaterials 2017, 121, 64-82, DOI: 10.1016/j.biomaterials.2017.01.006. (24) Liu, X.; Sui, B.; Sun, J. Size- and Shape-Dependent Effects of Titanium Dioxide Nanoparticles on the Permeabilization of the Blood–Brain Barrier. Journal of Materials Chemistry B 2017, 5 (48), 9558-9570, DOI: 10.1039/c7tb01314k. (25) Šoltys, M.; Balouch, M.; Kašpar, O.; Lhotka, M.; Ulbrich, P.; Zadražil, A.; Kovačík, P.; Štĕpánek, F. Evaluation of Scale-up Strategies for the Batch Synthesis of Dense and Hollow Mesoporous Silica Microspheres. Chemical Engineering Journal 2018, 334, 1135-1147, DOI: 10.1016/j.cej.2017.11.026. (26) Shih, S.-J.; Sari, D. R. M.; Lin, Y.-C. Influence of Chemical Composition on the Bioactivity of Spray Pyrolyzed Mesoporous Bioactive Glass. International Journal of Applied Ceramic Technology 2016, 13 (4), 787-794, DOI: 10.1111/ijac.12552. (27) Yan, X.; Huang, X.; Yu, C.; Deng, H.; Wang, Y.; Zhang, Z.; Qiao, S.; Lu, G.; Zhao, D. The in-Vitro Bioactivity of Mesoporous Bioactive Glasses. Biomaterials 2006, 27 (18), 3396-403, DOI: 10.1016/j.biomaterials.2006.01.043. (28) López-Noriega, A.; Arcos, D.; Izquierdo-Barba, I.; Sakamoto, Y.; Terasaki, O.; Vallet-Regí, M.



Ordered Mesoporous Bioactive Glasses for Bone Tissue Regeneration. Chemistry of Materials 2006, 18 (13), 3137-3144, DOI: 10.1021/cm060488o. (29) Ikeue, K.; Miyoshi, N.; Tanaka, T.; Machida, M. Ca-Containing Mesoporous Silica as a Solid Base Catalyst for the Knoevenagel Condensation Reaction. Catalysis Letters 2011, 141 (6), 877-881, DOI: 10.1007/s10562-011-0613-3. (30) Moon, D. S.; Lee, J. K. Tunable Synthesis of Hierarchical Mesoporous Silica Nanoparticles with Radial Wrinkle Structure. Langmuir : the ACS journal of surfaces and colloids 2012, 28 (33), 12341-7, DOI: 10.1021/la302145j. (31) Li, X.; Chen, X.; Miao, G.; Liu, H.; Mao, C.; Yuan, G.; Liang, Q.; Shen, X.; Ning, C.; Fu, X. Synthesis of Radial Mesoporous Bioactive Glass Particles to Deliver Osteoactivin Gene. Journal Of Materials Chemistry B 2014, 2 (40), 7045-7054, DOI: 10.1039/c4tb00883a. (32) Zhang, Y.; Hsu, B. Y.; Ren, C.; Li, X.; Wang, J. Silica-Based Nanocapsules: Synthesis, Structure Control and Biomedical Applications. Chemical Society reviews 2015, 44 (1), 315-35, DOI: 10.1039/c4cs00199k. (33) Rosenholm, J. M.; Sahlgren, C.; Linden, M. Towards Multifunctional, Targeted Drug Delivery Systems Using Mesoporous Silica Nanoparticles--Opportunities & Challenges. Nanoscale 2010, 2 (10), 1870-83, DOI: 10.1039/c0nr00156b. (34) Zhao, L.; Yan, X.; Zhou, X.; Zhou, L.; Wang, H.; Tang, H.; Yu, C. Mesoporous Bioactive Glasses for Controlled Drug Release. Microporous And Mesoporous Materials 2008, 109 (1-3), 210-215, DOI: 10.1016/j.micromeso.2007.04.041. (35) Bajenaru, L.; Berger, D.; Miclea, L.; Matei, C.; Nastase, S.; Andronescu, C.; Moisescu, M. G.; Savopol, T. Correlation of the Intracellular Reactive Oxygen Species Levels with Textural Properties of


Page 40 of 44

Page 41 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Functionalized Mesostructured Silica. Journal of biomedical materials research. Part A 2014, 102 (12), 4435-42, DOI: 10.1002/jbm.a.35131. (36) Rizzuto, R.; De Stefani, D.; Raffaello, A.; Mammucari, C. Mitochondria as Sensors and Regulators of Calcium Signalling. Nature Reviews Molecular Cell Biology 2012, 13 (9), 566-578, DOI: 10.1038/nrm3412. (37) Pinton, P.; Giorgi, C.; Siviero, R.; Zecchini, E.; Rizzuto, R. Calcium and Apoptosis: Er-Mitochondria Ca2+ Transfer in the Control of Apoptosis. Oncogene 2008, 27 (50), 6407-18, DOI: 10.1038/onc.2008.308. (38) Capiod, T. The Need for Calcium Channels in Cell Proliferation. Recent patents on anti-cancer drug discovery 2013, 8 (1), 4-17, DOI: 10.2174/1574892811308010004. (39) Resende, R. R.; Andrade, L. M.; Oliveira, A. G.; Guimaraes, E. S.; Guatimosim, S.; Leite, M. F. Nucleoplasmic Calcium Signaling and Cell Proliferation: Calcium Signaling in the Nucleus. Cell communication and signaling 2013, 11 (1), 14, DOI: 10.1186/1478-811X-11-14. (40) Meng, K.; Xu, J.; Zhang, C.; Zhang, R.; Yang, H.; Liao, C.; Jiao, J. Calcium Sensing Receptor Modulates Extracellular Calcium Entry and Proliferation Via Trpc3/6 Channels in Cultured Human Mesangial Cells. PloS one 2014, 9 (6), e98777, DOI: 10.1371/journal.pone.0098777. (41) Wu, L. J.; Sweet, T. B.; Clapham, D. E. International Union of Basic and Clinical Pharmacology. Lxxvi. Current Progress in the Mammalian Trp Ion Channel Family. Pharmacological reviews 2010, 62 (3), 381-404, DOI: 10.1124/pr.110.002725. (42) Nilius, B.; Szallasi, A. Transient Receptor Potential Channels as Drug Targets: From the Science of Basic Research to the Art of Medicine. Pharmacological reviews 2014, 66 (3), 676-814, DOI: 10.1124/pr.113.008268.



Page 42 of 44

(43) Ortiz-Capisano, M. C.; Reddy, M.; Mendez, M.; Garvin, J. L.; Beierwaltes, W. H. Juxtaglomerular Cell Casr Stimulation Decreases Renin Release Via Activation of the Plc/Ip(3) Pathway and the Ryanodine Receptor. American journal of physiology. Renal physiology 2013, 304 (3), F248-56, DOI: 10.1152/ajprenal.00451.2012. (44) Muanprasat, C.; Wongkrasant, P.; Satitsri, S.; Moonwiriyakit, A.; Pongkorpsakol, P.; Mattaveewong, T.; Pichyangkura, R.; Chatsudthipong, V. Activation of Ampk by Chitosan Oligosaccharide in Intestinal Epithelial Cells: Mechanism of Action and Potential Applications in Intestinal

Disorders.

Biochemical

pharmacology

2015,

96

(3),

225-36,

DOI:

10.1016/j.bcp.2015.05.016. (45) Gorvin, C. M.; Babinsky, V. N.; Malinauskas, T.; Nissen, P. H.; Schou, A. J.; Hanyaloglu, A. C.; Siebold, C.; Jones, E. Y.; Hannan, F. M.; Thakker, R. V. A Calcium-Sensing Receptor Mutation Causing Hypocalcemia Disrupts a Transmembrane Salt Bridge to Activate Beta-Arrestin-Biased Signaling. Science signaling 2018, 11 (518), DOI: 10.1126/scisignal.aan3714. (46) Altznauer, F.; Conus, S.; Cavalli, A.; Folkers, G.; Simon, H. U. Calpain-1 Regulates Bax and Subsequent Smac-Dependent Caspase-3 Activation in Neutrophil Apoptosis. The Journal of biological chemistry 2004, 279 (7), 5947-57, DOI: 10.1074/jbc.M308576200. (47) Wang, H.; Zhai, N.; Chen, Y.; Xu, H.; Huang, K. Cadmium Induces Ca(2+) Mediated, Calpain-1/Caspase-3-Dependent Apoptosis in Primary Cultured Rat Proximal Tubular Cells. Journal of inorganic biochemistry 2017, 172, 16-22, DOI: 10.1016/j.jinorgbio.2017.04.005. (48) Shinoura, N.; Yoshida, Y.; Nishimura, M.; Muramatsu, Y.; Asai, A.; Kirino, T.; Hamada, H. Expression Level of Bcl-2 Determines Anti- or Proapoptotic Function. Cancer research 1999, 59 (16), 4119-28, DOI: Published August 1999.


Page 43 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(49) Kamada, S.; Kikkawa, U.; Tsujimoto, Y.; Hunter, T. Nuclear Translocation of Caspase-3 Is Dependent on Its Proteolytic Activation and Recognition of a Substrate-Like Protein(S). The Journal of biological chemistry 2005, 280 (2), 857-60, DOI: 10.1074/jbc.C400538200.



Graphical abstract 35x26mm (600 x 600 DPI)


Page 44 of 44

Dual-Functional Dendritic Mesoporous Bioactive Glass Nanospheres

Recommend Documents