Effects of α-Galactooligosaccharides from Chickpeas on High-Fat-Diet

Mar 31, 2017 - Metabolic syndrome is a series of diseases, including central obesity, ...... Wallace , T. C.; Murray , R.; Zelman , K. M. The nutritio...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Effects of α‑Galactooligosaccharides from Chickpeas on High-FatDiet-Induced Metabolic Syndrome in Mice Zhuqing Dai,† Wanyong Lyu,‡ Minhao Xie,† Qingxia Yuan,† Hong Ye,† Bing Hu,† Li Zhou,† and Xiaoxiong Zeng*,† †

College of Food Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China Nutrition and Food Branch of China Association of Gerontology and Geriatrics, Beijing 100050, People’s Republic of China

J. Agric. Food Chem. 2017.65:3160-3166. Downloaded from pubs.acs.org by STOCKHOLM UNIV on 01/22/19. For personal use only.

‡

ABSTRACT: The gut microbiota has the ability to modulate host energy homeostasis, which may regulate metabolic disorders. Functional oligosaccharide may positively regulate the intestinal microbiota. Therefore, effects of α-galactooligosaccharides (αGOS) from chickpea on high-fat-diet (HFD)-induced metabolic syndrome and gut bacterial dysbiosis were investigated. After 6 weeks of intervention, HFD led to significant increases in levels of blood glucose, total cholesterol, triglyceride, glycated serum protein, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol of mice compared to normal-chow-fed mice. Meanwhile, all of the α-GOS-treated groups significantly decreased above parameters compared to the HFD group. HFD could significantly decrease the content of all bacteria, especially Bacteroides (9.82 ± 0.09 versus 10.3 ± 0.10; p < 0.05) and Lactobacillus (6.67 ± 0.18 versus 7.30 ± 0.24; p < 0.05), and a decrease in the production of short-chain fatty acids was also observed. Treatment with α-GOS significantly increased the number of Bifidobacterium (6.07 ± 0.23 of the low-dose treatment versus 5.65 ± 0.20 of the HFD group) and Lactobacillus (7.22 ± 0.16 of the low-dose treatment). It also significantly promoted the secretion of propionic and butyric acids. These results indicate that α-GOS from chickpeas may affect the metabolic disorders and gut bacterial ecosystem in a positive way. KEYWORDS: metabolic syndrome, α-galactooligosaccharide, chickpea, gut microbiota, short-chain fatty acid

■

INTRODUCTION Metabolic syndrome is a series of diseases, including central obesity, hyperglycemia, insulin resistance, hyperlipidemia, and hypertension.1 Humans are facing a devastating epidemic of metabolic syndrome because of growing unhealthy diets. It has been reported that high-fat-diet (HFD)-induced obesity can cause oxidative damage, inflammatory response, and metabolic endotoxemia, leading to various chronic metabolic abnormalities, such as type 2 diabetes, carcinogenesis, and cardiovascular disease.2,3 The mechanism of metabolic syndrome is a complex issue. Genetic, environmental, and dietary factors are all considered to be the main elements in the development of metabolic syndrome. However, accumulating evidence suggests that the shift of gut microflora induced by a HFD is a key factor in the development of obesity, insulin resistance, and other indicators of metabolic syndrome.4−6 A reduction of beneficial bacteria and an increase of pathogenic bacteria are consistently related to the development of obesity, systemic inflammation, and metabolic comorbidity in both humans and rodents.7−9 Galactooligosaccharides (GOS), formed by 1−10 galactosyl moieties linked to a terminal glucose or by exclusively galactosyl units (galactobiose, galactotriose, etc.), are considered to be one of the most common prebiotics.10,11 GOS play a significant role in human health; they are considered to be used by gut microbiota and modify the composition of intestinal microbes.12 For example, GOS have been reported to promote the proliferation of beneficial bacteria (Bifidobacterium and Lactobacillus) and suppress the growth of pathogenic and putrefactive bacteria.13−15 In addition to being prebiotics, GOS exhibit other functions, such as preventing constipation, reducing the level of blood total cholesterol (TC), improving © 2017 American Chemical Society

mineral absorption, and controlling some acute or chronic diseases.16−19 Chickpea (Cicer arietinum L.), one of the most important pulse crops, is grown and consumed in a wide area, especially in Asian and African countries. It accounts for a substantial proportion of human dietary nitrogen intake. Moreover, the nutritional values and health benefits of chickpeas have also attracted more and more attention nowadays.20−22 It is not only a good source of protein but also rich in carbohydrates and fibers. The carbohydrates of chickpea consist of mono-, di-, oligo-, and polysaccharides, and the amount of α-GOS (on the basis of a dry mass) is around 10.4−17.0% for different species of chickpeas.23,24 Ciceritol and stachyose are the most abundant α-GOS in chickpeas, taking up 36−43 and 25% of the content of total soluble sugars in chickpea seeds, respectively. This makes chickpeas become a great source of α-GOS. Recently, low-digestible carbohydrates have been widely demonstrated to be an effective prebiotic factor. They are highly selective for the growth of Bifidobacterium and Lactobacillus, which stimulates the secretion of short-chain fatty acids (SCFAs) and promotes alleviation of metabolic and inflammatory disorders.25−27 However, direct evidence of α-GOS from chickpeas in preventing metabolic syndrome is still limited. The purpose of this study, therefore, was to evaluate the effects of α-GOS from chickpea on HFD-induced metabolic syndrome. Received: Revised: Accepted: Published: 3160

February 1, 2017 March 27, 2017 March 31, 2017 March 31, 2017 DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry Table 1. Group-Specific Primers Based on 16S rRNA Sequences Used for qPCR target bacterial group all bacteria Bacteroides Bifidobacterium Lactobacillus Clostridium leptum group Clostridium coccoides

■

sequence (5′ → 3′)

PCR product size (bp)

F-Eub338 ACTCCTACGGGAGGCAGCAG R-Eub518 ATTACCGCGGCTGCTGG F-AllBac296 GAGAGGAAGGTCCCCCAC R-AllBac412 CGCTACTTGGCTGGTTCAG F-Bifido CGCGTCYGGTGTGAAAG R-Bifido CCCCACATCCAGCATCCA F-Lacto GAGGCAGCAGTAGGGAATCTTC R-Lacto GGCCAGTTACTACCTCTATCCTTCTTC F-sg-Clept GCACAAGCAGTGGAGT R3-sg-Clept CTTCCTCCGTTTTGTCAA F-g-Ccoc AAATGACGGTACCTGACTAA R-g-Ccoc CTTTGAGTTTCATTCTTGCGAA

192 108 244 126 242 441

stored at −80 °C. After 6 weeks of treatment, mice were fasted overnight (from 9:00 pm to 9:00 am) and the cage bedding was changed at 9:00 pm to avoid coprophagy. After chloral hydrate (200 mg/kg of body weight) anesthesia, blood was collected by eyeball enucleating. Liver, spleen, kidney, and colon were quickly removed and stored at −80 °C until further analysis. Total cecum and colon contents were also collected, immediately frozen, and stored at −80 °C until further analysis. Biochemical Analysis. Blood glucose levels were determined before sacrifice using an Ascensia contour blood glucose meter (Bayer Healthcare LLC, Mishawaka, IN, U.S.A.). The serum insulin level was measured using a rat/mouse insulin ELISA kit, and the insulin resistance index was calculated according to the homeostasis assessment model (HOMA-IR).29 The glycated serum protein level was measured using a glycosylated serum protein assay kit. Serum TC and TG levels were measured by a TC assay kit and a TG assay kit, respectively. Serum HDL-C and LDL-C levels were measured using a HDL-C assay kit and a LDL-C assay kit, respectively. Uric acid levels were measured using a uric acid assay kit. Histology Analysis. The liver and colon tissues were cut into pieces (0.5 cm3), washed with saline, and placed in a labeled cassette. The tissues were then fixed in 12% formaldehyde solution for 24 h, and the residual fixative was washed away with distilled water. These tissues were then processed using 30, 50, 70, 80, 90, 95, and 100% ethanol for dehydration, respectively. After the tissues were embedded in paraffin (BMJ-III embedding machine, Changzhou Electronic Instrument Factory, Jiangsu, China), they were cut into 5 μm thick sections by RM2235 microtome (Leica, Heidelberg, Germany). The hematoxylin and eosin (H&E) staining method was applied to stain the tissues, and two H&E-stained sections per liver were used for observation of steatosis with a microscope at 40× magnification. The histology was evaluated on the basis of four parameters: macrovesicular steatosis, microvesicular steatosis, hepatocellular hypertrophy, and inflammation. Analysis of SCFAs. Luminal samples were weighted and suspended in a sufficient volume (600 μL) of acidified water (pH 1−2) by vortex. After the samples were kept still at room temperature for 10 min and filtrated with 0.2 μm nylon filter (Millipore MillexGN), the extract was centrifuged at 6000 rpm for 20 min. The contents of SCFAs were then analyzed using an Agilent 1100 series HPLC system with a diode array detector (DAD) set at 210 nm. Chromatographic separation of acetic, propionic, and butyric acids was achieved at 30 °C using a Beckman Ultrasphere C18 column (4.6 × 250 mm, 5 μm particle size). The mobile phase was composed of KH2PO4 solution (phase A, 20 mM and pH 2.5) and methanol (phase B) with a gradient elution as follows: 0−16 min, 5% B; 16−30 min, from 5 to 30% B; and 30−40 min, 30% B. The flow rate was set at 0.8 mL/min, and the injection volume was 20 μL. Three biological replicates were processed in each group analyzed. Quantitative Polymerase Chain Reaction (qPCR) Analysis. In the present study, qPCR was used to evaluate the effects of α-GOS on microbial composition after 6 weeks of treatment in comparison to the

MATERIALS AND METHODS

Chemicals and Diets. Chickpea seeds were obtained from Xinjiang Agricultural University (Urumchi, Xinjiang Uygur Autonomous Region, China). Normal chow (NC, 10% kcal from fat and a total of 3.85 kcal/g) and a HFD (45% kcal from fat and a total of 5.21 kcal/g) were purchased from Jiangsu Xietong Organism Co., Ltd. (Nanjing, China). Rat/mouse insulin enzyme-linked immunosorbent assay (ELISA) kit, glycosylated serum protein assay kit, TC assay kit, triglyceride (TG) assay kit, high-density lipoprotein cholesterol (HDLC) assay kit, low-density lipoprotein cholesterol (LDL-C) assay kit, and uric acid assay kit were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Other chemicals and reagents were obtained from Sigma-Aldrich Chemical Co., Ltd. (St. Louis, MO, U.S.A.), unless otherwise stated. Preparation of α-GOS from Chickpea. α-GOS from chickpea were extracted and partially purified according to a previous method, with some modifications.28 The powder of the dried chickpeas was soaked with 100% petroleum ether for 24 h at ambient temperature. The defatted residue was filtrated and extracted with 50% (v/v) aqueous ethanol twice by stirring at 50 °C for 2 h. The extracts were combined and centrifuged at 4000 rpm for 15 min, and the supernatant was concentrated by rotary evaporation (Heidolph Instruments, Schwabach, Germany). The concentrated solution was stirred with 30 g of activated charcoal/celite (1:1, w/w) for 30 min. The mixture was then washed with 8% (v/v) aqueous ethanol (to remove mono- and disaccharides) and 50% aqueous ethanol; the latter elute was concentrated and freeze-dried to yield α-GOS as a fine white powder. Agilent 1100 series high-performance liquid chromatography (HPLC) system (Agilent Technologies, Santa Clara, CA, U.S.A.) equipped with a refraction index detector (RID) was used to analyze the composition of α-GOS. The analysis was performed with a SugarD column (4.6 × 250 mm, Nacalai Tesque, Inc., Kyoto, Japan) eluted with a mobile phase of acetonitrile/water (75:25, v/v) at a flow rate of 1.0 mL/min, and the sugars were identified by comparing the retention times to those of standard sugars. Animal Trial. A total of 50 6-week-old male CD-1 (ICR) IGS mice (body weight of 26.2 ± 3.4 g) were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All of the experiments were approved by the Medical Research Committee on Animal Care and Use, Disease Control Centre of Jiangsu Province (SCXK2013-0005), China. The mice were maintained in cages (five mice per cage) in a controlled environment (temperature of 24−25 °C, humidity of 50−55%, and 12 h light/dark cycles) with free to access food and water. They were randomly divided into five groups (10 mice for each group). One group was fed NC as a blank control; one group was fed a HFD as a model control; and the other three groups were fed a HFD as well as 0.083 g day−1 kg−1 (low-dose treatment, HFD + LDT), 0.42 g day−1 kg−1 (medium-dose treatment, HFD + MDT), and 0.83 g day−1 kg−1 (high-dose treatment, HFD + HDT) α-GOS in drinking water, respectively. During the experiment, the body weight of mice, food consumption, and water consumption were recorded weekly. Fresh feces were collected every 2 weeks and 3161

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry

Figure 1. HPLC chromatograms of (A) soluble sugars and (B) α-GOS from chickpea. Peaks: 1, fructose; 2, sucrose; 3, raffinose; 4, ciceritol; and 5, stachyose. control. Briefly, total DNA was extracted from a fresh fecal sample (200 mg) using a TIANamp Stool DNA kit (Tiangen Biotechnology Co., Ltd., Beijing, China) according to the instructions of the manufacturer, and the resulting DNA samples were stored at −80 °C. The concentration of DNA was assessed spectrophotometrically using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, U.S.A.). Different microbial groups, including total bacteria, Bacteroides, Lactobacillus, Bifidobacterium, Eubacterium rectale/ Clostridium coccoides, and Clostridium leptum, were distinguished and quantified by qPCR (Applied Biosystems 7500 Real-Time PCR System, ABI Co., Ltd., Foster City, CA, U.S.A.). The 16S rRNA genetargeted group-specific primers used in this study are listed in Table 1. The reaction mixture (20 μL) comprised 10 μL of SYBR Premix Ex (Takara Biotechnology Co., Ltd., Dalian, China), 0.4 μL of ROX Reference II, 0.4 μL of each of the specific primers (10 μM, Sangon Biotechnology Co., Ltd., Shanghai, China), 6.8 μL of sterile distilled water, and 2 μL of DNA template. The PCR reaction was initiated by a 5 min activation at 95 °C, followed by 40 cycles at 95 °C for 10 s, and 60 °C for 35 s to anneal the primer and elongate the product. The sample DNA copy number was calculated by absolute quantification. For standard curves, a series of 10 times gradient dilutions of the standard products was used and at least six non-zero standard concentrations per assay were applied. The concentration of each bacterium was expressed as log10 copy number. Each reaction was carried out in triplicate. Statistical Analysis. Statistical analysis was performed using SPSS software, version 15.0. The data were presented as the mean ± standard deviation (SD) and analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test to compare multiple groups and Student’s t test to determine the differences in two groups. The level of statistical significance was set at p < 0.05.

■

were fructose, sucrose, raffinose, ciceritol, and stachyose, which is consistent with the previous reports.30−32 After purification, most fructose and sucrose were removed and the resulting αGOS were mainly composed of 15.0% raffinose, 25.1% ciceritol, and 51.5% stachyose. Throughout the animal experiment, there were no significant differences in food and water consumption among the five groups (data not shown). After 6 weeks of treatment, mice fed with a HFD had a higher body weight compared to those fed with NC (Figure 2). The growth of body weight of NC, HFD,

Figure 2. Changes of body weight (the body weight was recorded weekly) of controls and α-GOS-fed mice for 6 weeks.

HFD + LDT, HFD + MDT, and HFD + HDT was 30.0, 36.5, 24.8, 34.6, and 32.2%, respectively. Mice fed with α-GOS showed a lower increase in body weight compared to the HFD group; however, there were no significant differences on the body weight among these four groups (p > 0.05). Effects of α-GOS on the Blood-Glucose-Related Index. As shown in panels A and B of Figure 3, HFD-fed mice showed significant increases in the blood glucose level and glycated serum protein level (p < 0.05) after 6 weeks of dietary intervention. In comparison to the HFD group, the three α-

RESULTS

Effect of α-GOS on the Body Weight. As shown in Figure 1A, the soluble sugars extracted from chickpea were effectively separated by HPLC. According to the retention times of standard sugars, the main soluble sugars in the extract 3162

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry

Liver Steatosis. The histopathology of liver sections is shown in Figure 4. For HFD-fed mice, increased lipid

Figure 4. Representative images of liver microsections stained with H&E and observed with 40× magnification: (A) NC group, (B) HFD group, (C) HFD + LDT group, (D) HFD + MDT group, and (E) HFD + HDT group.

Figure 3. Effect of controls and α-GOS on levels of serum blood glucose, glycated protein, insulin, and insulin resistance in mice fed for 6 weeks. Letters a−d represent significant differences between different groups (p < 0.05).

deposition in the livers was observed and the cytoplasm of the centrilobular hepatocytes showed microvesicular steatosis with numerous small lipid droplets as well as macrovesicular steatosis with large lipid droplets. In addition, the clusters of inflammatory cells were observed in the livers of the HFD group. For HFD + LDT and HFD + MDT groups, the livers showed slight fatty degeneration, in which the average percentages of microvesicular steatosis and macrovesicular steatosis were less than 20%. Several mice from these groups showed a markedly attenuated degree of hepatic steatosis compared to mice from the HFD group, with the fatty change primarily consisting of the widely scattered large lipid droplets in the central leaflet region and little evidence of microvesicular involvement. For HFD + HDT, the livers showed almost no fatty degeneration, with no appearance of steatosis nor inflammation. Thus, the treatment of α-GOS significantly reduced the incidence of fatty liver. Effects of α-GOS on SCFAs. The concentrations of acetic, lactic, propionic, and butyric acids and total SCFA amount were reduced after HFD feeding (Table 3). Supplementation of αGOS prevented the decrease in total SCFAs and even promoted the secretion of SCFAs. In comparison to NC and HFD groups, all three treatments of α-GOS significantly increased the concentrations of propionic and butyric acids (p < 0.05). A high dose of α-GOS also significantly increased the secretion of acetic and lactic acids, while HFD + LDT and HFD + MDT did not. In comparison to the three doses of treatments, the promoting effect of α-GOS on secretion of SCFAs showed a dose-dependent relationship. Effects of α-GOS on Gut Microbiota. After a period of 6 weeks of treatment, HFD feeding significantly decreased gut

GOS treatments reduced the blood glucose level by 38.1, 28.2, and 34.0%, respectively. Among them, HFD + LDT and HFD + HDT showed significant differences (p < 0.05). Reduced glycated serum protein levels were also observed for α-GOS treatments; however, there was no significant difference compared to the HFD group. The insulin level showed no significant change for mice fed with a HFD (Figure 3C), while HOMA-IR significantly increased for the HFD group (Figure 3D). All of the α-GOS treatments reduced HOMA-IR compared to the HFD group, but there were no statistical differences when analyzed by Tukey’s post-hoc test. For the three treatments of α-GOS, HFD + LDT showed better effects on reducing the blood glucose level and glycated serum protein level, while HFD + HDT showed a better effect on reducing HOMA-IR. Effects of α-GOS on Serum Lipid. The serum concentrations of TC, TG, HDL-C, and LDL-C were measured at the end of the animal experiment, and the results are shown in Table 2. All four serum-lipid-related indexes for HFD-fed mice were significantly higher than those for NC-fed mice (p < 0.05). α-GOS treatments significantly decreased the elevation in serum TC, TG, HDL-C, and LDL-C (p < 0.05). The three treatments of α-GOS even lowered TG and HDL-C levels to normal levels, which showed no significant difference with those for the NC group. The serum TG concentration was significantly lower (p < 0.05) following administration of HFD + LDT than that of HFD + MDT.

Table 2. Effects of α-GOS on Concentrations of Serum TC, TG, HDL-C, and LDL-C in Mice Fed for 6 Weeksa treatment NC HFD HFD + LDT HFD + MDT HFD + HDT a

TC (mmol/L) 3.53 6.41 5.04 5.87 5.14

± ± ± ± ±

0.62 1.31 0.99 0.74 0.47

a d b c bc

TG (mmol/L) 0.38 0.99 0.39 0.41 0.54

± ± ± ± ±

0.17 0.36 0.18 0.11 0.26

a b a a a

HDL-C (mmol/L) 0.69 1.62 0.68 0.73 0.94

± ± ± ± ±

0.38 0.29 0.22 0.29 0.47

LDL-C (mmol/L)

a b a a a

0.92 3.02 2.32 2.53 1.99

± ± ± ± ±

0.26 0.67 0.44 0.65 0.60

a d bc c b

Values are the mean ± SD (n = 10). Letters a−d represent significant differences between different groups (p < 0.05). 3163

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry Table 3. Effects of α-GOS on Secretion of Total SCFAs in Mice Fed for 6 Weeksa production of SCFAs (mM) treatment

acetic acid

NC HFD HFD + LDT HFD + MDT HFD + HDT a

100 92.5 103 116 118

± ± ± ± ±

12.5 10.4 10.6 14.8 16.0

lactic acid

ab a abc bc c

63.9 55.2 60.5 61.1 79.2

± ± ± ± ±

13.8 8.82 10.4 5.90 8.68

propionic acid a a a a b

57.1 51.1 94.5 88.5 94.3

± ± ± ± ±

11.1 14.0 7.22 10.7 10.2

butyric acid

a a b b b

47.5 37.9 63.6 66.6 70.0

± ± ± ± ±

8.54 6.47 6.98 10.9 7.41

total SCFAs

a a b b b

269 237 302 332 362

± ± ± ± ±

24.1 24.7 42.7 21.5 36.9

ab a bc cd d

Values are the mean ± SD (n = 10). Letters a−d represent significant differences between different groups (p < 0.05).

Table 4. Effects of α-GOS on Colonic Microbiota Composition in Mice Fed for 6 Weeksa treatment bacterial group all bacteria Bacteroides Bifidobacterium Lactobacillus Eubacterium rectal/Clostridium coccoides group Clostridium leptum group

NC 11.2 10.3 5.79 7.30 9.76 9.39

± ± ± ± ± ±

0.10 0.10 0.34 0.24 0.20 0.32

HFD c c ab b a c

10.6 9.82 5.65 6.67 9.61 8.90

± ± ± ± ± ±

0.08 0.09 0.20 0.18 0.26 0.23

HFD + LDT a ab a a a ab

10.6 9.76 6.07 7.22 9.62 9.03

± ± ± ± ± ±

0.16 0.14 0.23 0.16 0.24 0.19

a a bc b a abc

HFD + MDT 10.7 9.92 6.25 7.21 9.42 8.85

± ± ± ± ± ±

0.14 0.18 0.31 0.20 0.39 0.33

a ab c b a a

HFD + HDT 10.8 10.0 6.16 7.29 9.68 9.23

± ± ± ± ± ±

0.16 0.23 0.28 0.25 0.25 0.26

a b c b a bc

Data are the mean ± SD (n = 10), expressed as log10 copy number per gram of freeze-dried luminal sample. Letters a−c represent significant differences between different groups of a certain bacterial group (p < 0.05).

a

total bacterial quantity (p < 0.05) and altered the composition of gut microbiota (Table 4). Briefly, HFD significantly decreased the amount of Bacteroides, Lactobacillus, and C. leptum groups compared to the NC group, while no significant differences were observed in the number of Bifidobacterium and E. rectale/C. coccoides groups between HFD and NC groups. In comparison to the HFD group, the α-GOS diet significantly stimulated (p < 0.05) the growth of Bifidobacterium and Lactobacillus. The number of Bacteroides, E. rectale/C. coccoides, and C. leptum groups did not show significant changes (p > 0.05) between HFD and α-GOS groups. A high dose of α-GOS treatment significantly increased the proliferation of total bacteria compared to the HFD group, mainly as a result of the stimulation of Bifidobacterium, Lactobacillus, and C. leptum groups.

alteration of the microbial cross-feeding patterns and promotion of microflora might also cause high levels of fecal SCFAs.35 Because of its non-digestible characteristic in the gastrointestinal tract, GOS have been shown to be an excellent dietary source for production of SCFAs and health-promoting bacteria, such as Bifidobacterium and Lactobacillus.10 The present study also demonstrated the positive effects. Administration of prebiotics is helpful in lowering hepatic steatosis, colon inflammation, level of blood glucose, and insulin concentration, which has been demonstrated by animal experiments and human trials.1,36,37 In the present study, significantly lower concentrations of blood lipid, blood glucose, and serum insulin were detected after the administration of αGOS. Liver histopathology also showed that treatment of αGOS inhibited the microvesicular steatosis and macrovesicular steatosis. The results are consistent with the proliferation of prebiotics. The exact mechanisms by which GOS exert their protective effect on metabolic syndrome are still not fully understood. However, some studies have demonstrated that the promotion of gut microbiota might play an important role. Oligosaccharides are metabolized by the colonic microbiota and fermented to produce SCFAs, mainly including acetic, propionic, and butyric acids. SCFAs are absorbed in the colon, where butyric acid provides energy for colonic epithelial cells. Acetic and propionic acids are the substrates for gluconeogenesis and lipogenesis in liver and peripheral organs. Except as energy sources, SCFAs have the ability to regulate colonic gene expression by inhibiting histone deacetylase and modulating the signaling pathway through G-protein-coupled receptors (GPRs), such as GPR41 or GPR43.27,38 In another aspect, GOS may promote mucosal barrier function by directly stimulating the intestinal goblet cells.39 Other oligosaccharides, such as human milk oligosaccharides and bovine colostrum oligosaccharides, have also been reported to have effects on gene expression of colonic epithelial cells.40 The third possible explanation for the findings might be that α-GOS reduced oxidative stress, particularly in the liver, which is known to be present in HFD-induced metabolic syndrome. Likewise, a study

■

DISCUSSION HFD feeding resulted in weight gain and high levels of blood glucose, insulin resistance, TC, and TG. It also led to hepatic steatosis and changes of selected fecal microbial abundances and SCFAs. These results are similar to some reports that dietinduced obesity is shown to be correlated with the alteration of gut microbiota. For example, a HFD reduced the amount of Bifidobacterium and Lactobacillus in a study conducted by Singh et al.33 Daniel et al. found that a HFD caused changes of the diversity of dominant gut bacteria, decreased the amount of Ruminococcaceae, and increased the amount of Rikenellaceae.34 After α-GOS intervention, significant increases of Bifidobacterium and Lactobacillus were observed. It is believed that Bifidobacterium and Lactobacillus play a protective role against pathogens by producing antimicrobial agents and/or blocking adhesion of pathogens. In this way, they were thought to protect gut integrity and to regulate the host metabolism. Besides, increased levels of SCFAs were observed in α-GOS-fed mice. SCFAs are produced when dietary fiber is fermented in the colon, which supplies the host with an additional amount of energy. Two-thirds of the energy supply for normal colonic epithelia was from SCFAs, particularly butyric acid. The 3164

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry

H.; Wang, J.; Ehrlich, S. D.; Nielsen, R.; Pedersen, O.; Kristiansen, K.; Wang, J. A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature 2012, 490, 55−60. (9) Chalkiadaki, A.; Guarente, L. High-fat diet triggers inflammationinduced cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction. Cell Metab. 2012, 16, 180−188. (10) Torres, D. P. M.; Goncalves, M. P.; Teixeira, J. A.; Rodrigues, L. R. Galacto-oligosaccharides: Production, properties, applications, and significance as prebiotics. Compr. Rev. Food Sci. Food Saf. 2010, 9, 438−454. (11) Park, A. R.; Oh, D. K. Galacto-oligosaccharide production using microbial b-galactosidase: Current state and perspectives. Appl. Microbiol. Biotechnol. 2010, 85, 1279−1286. (12) Whisner, C. M.; Martin, B. R.; Schoterman, M. H. C.; Nakatsu, C. H.; McCabe, L. D.; McCabe, G. P.; Wastney, M. E.; van den Heuvel, E. G.; Weaver, C. M. Galacto-oligosaccharides increase calcium absorption and gut bifidobacteria in young girls: A doubleblind cross-over trial. Br. J. Nutr. 2013, 110, 1292−1303. (13) Fernando, W. M. U.; Hill, J. E.; Zello, G. A.; Tyler, R. T.; Dahl, W. J.; Van Kessel, A. G. Diets supplemented with chickpea or its main oligosaccharide component raffinose modify faecal microbial composition in healthy adults. Benefic. Microbes 2010, 1, 197−207. (14) Searle, L. E.; Cooley, W. A.; Jones, G.; Nunez, A.; Crudgington, B.; Weyer, U.; Dugdale, A. H.; Tzortzis, G.; Collins, J. W.; Woodward, M. J.; La Ragione, R. M. Purified galactooligosaccharide, derived from a mixture produced by the enzymic activity of Bif idobacterium bif idum, reduces Salmonella enterica serovar Typhimurium adhesion and invasion in vitro and in vivo. J. Med. Microbiol. 2010, 59, 1428−1439. (15) Marin-Manzano, M. C.; Abecia, L.; Hernandez-Hernandez, O.; Sanz, M. L.; Montilla, A.; Olano, A.; Rubio, L. A.; Moreno, F. J.; Clemente, A. Galacto-oligosaccharides derived from lactulose exert a selective stimulation on the growth of Bif idobacterium animalis in the large intestine of growing rats. J. Agric. Food Chem. 2013, 61, 7560− 7567. (16) Shadid, R.; Haarman, M.; Knol, J.; Theis, W.; Beermann, C.; Rjosk-Dendorfer, D.; Schendel, D. J.; Koletzko, B. V.; KraussEtschmann, S. Effects of galactooligosaccharide and long-chain fructooligosaccharide supplementation during pregnancy on maternal and neonatal microbiota and immunityA randomized, double-blind, placebo-controlled study. Am. J. Clin. Nutr. 2007, 86, 1426−1437. (17) Gosling, A.; Stevens, G. W.; Barber, A. R.; Kentish, S. E.; Gras, S. L. Recent advances refining galactooligosaccharide production from lactose. Food Chem. 2010, 121, 307−318. (18) Ariefdjohan, M. W.; Martin, B. R.; Lachcik, P. J.; Weaver, C. M. Acute and chronic effects of honey and its carbohydrate constituents on calcium absorption in rats. J. Agric. Food Chem. 2008, 56, 2649− 2654. (19) Weaver, C. M.; Martin, B. R.; Nakatsu, C. H.; Armstrong, A. P.; Clavijo, A.; McCabe, L. D.; McCabe, G. P.; Duignan, S.; Schoterman, M. H.; van den Heuvel, E. G. Galactooligosaccharides improve mineral absorption and bone properties in growing rats through gut fermentation. J. Agric. Food Chem. 2011, 59, 6501−6510. (20) Wallace, T. C.; Murray, R.; Zelman, K. M. The nutritional value and health benefits of chickpeas and hummus. Nutrients 2016, 8, 766. (21) Gupta, R. K.; Gupta, K.; Sharma, A.; Das, M.; Ansari, I. A.; Dwivedi, P. D. Health risks and benefits of chickpea (Cicer arietinum). consumption. J. Agric. Food Chem. 2017, 65, 6−22. (22) Zhang, Y.; Su, D.; He, J. Y.; Dai, Z. Q.; Asad, R.; Ou, S. Y.; Zeng, X. X. Effects of ciceritol from chickpeas on human colonic microflora and the production of short chain fatty acids by in vitro fermentation. LWT - Food Sci. Technol. 2017, 79, 294−299. (23) Jukanti, A. K.; Gaur, P. M.; Gowda, C. L.; Chibbar, R. N. Nutritional quality and health benefits of chickpea (Cicer arietinum L.): A review. Br. J. Nutr. 2012, 108 (Supplement 1), S11−S26. (24) Rachwa-Rosiak, D.; Nebesny, E.; Budryn, G. Chickpeas composition, nutritional value, health benefits, application to bread and snacks: A review. Crit. Rev. Food Sci. Nutr. 2015, 55, 1137−1145.

indicated that a Western HFD induced marked whole-body oxidative stress and elevated body adiposity, without changing body weight.41 α-GOS from soybean were reported to have an effective effect in reducing the oxidative stress.42 In conclusion, administration of α-GOS from chickpeas to mice fed a HFD led to an increased production of SCFAs and incrassation of beneficial Bifidobacterium and Lactobacillus. Furthermore, there were significant effects on some metabolic syndrome markers, namely, blood glucose, insulin, TC, TG, HDL-C, and LDL-C, as a result of the administration of αGOS. The shift in gut microbiota might be responsible for the alleviation of metabolic syndrome. Therefore, dietary intervention using α-GOS from chickpeas should be an advisible method to enhance the gastrointestinal systems and effective in alleviating some of the parameters of metabolic syndrome.

■

AUTHOR INFORMATION

Corresponding Author

*Telephone/Fax: +86-25-84396791. E-mail: [email protected]. cn. ORCID

Xiaoxiong Zeng: 0000-0003-2954-3896 Funding

This work was supported by a grant-in-aid for scientific research from the National Natural Science Foundation of China (31171750), a grant funded by the Jiangsu Key Laboratory of Quality Control and Further Processing of Cereals & Oils, and a project funded by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Wang, J. J.; Tang, H.; Zhang, C. H.; Zhao, Y. F.; Derrien, M.; Rocher, E.; van-Hylckama Vlieg, J. E. T.; Strissel, K.; Zhao, L. P.; Obin, M.; Shen, J. Modulation of gut microbiota during probiotic-mediated attenuation of metabolic syndrome in high fat diet-fed mice. ISME J. 2015, 9, 1−15. (2) Despres, J. P.; Lemieux, I. Abdominal obesity and metabolic syndrome. Nature 2006, 444, 881−887. (3) Bardou, M.; Barkun, A. N.; Martel, M. Obesity and colorectal cancer. Gut 2013, 62, 933−947. (4) Zhao, L. P. The gut microbiota and obesity: From correlation to causality. Nat. Rev. Microbiol. 2013, 11, 639−647. (5) Parks, B. W.; Nam, E.; Org, E.; Kostem, E.; Norheim, F.; Hui, S. T.; Pan, C.; Civelek, M.; Rau, C. D.; Bennett, B. J.; Mehrabian, M.; Ursell, L. K.; He, A. Q.; Castellani, L. W.; Zinker, B.; Kirby, M.; Drake, T. A.; Drevon, C. A.; Knight, R.; Gargalovic, P.; Kirchgessner, T.; Eskin, E.; Lusis, A. J. Genetic control of obesity and gut microbiota composition in response to high-fat, high-sucrose diet in mice. Cell Metab. 2013, 17, 141−152. (6) Everard, A.; Cani, P. D. Diabetes, obesity and gut microbiota. Best Pract. Res. Clin. Gastroenterol. 2013, 27, 73−83. (7) Zhang, C. H.; Zhang, M. H.; Wang, S. Y.; Han, R. J.; Cao, Y. F.; Hua, W. Y.; Mao, Y. J.; Zhang, X. J.; Pang, X. Y.; Wei, C. C.; Zhao, G. P.; Chen, Y.; Zhao, L. P. Interactions between gut microbiota, host genetics and diet relevant to development of metabolic syndromes in mice. ISME J. 2010, 4, 232−241. (8) Qin, J.; Li, Y.; Cai, Z.; Li, S.; Zhu, J.; Zhang, F.; Liang, S.; Zhang, W.; Guan, Y.; Shen, D.; Peng, Y.; Zhang, D.; Jie, Z.; Wu, W.; Qin, Y.; Xue, W.; Li, J.; Han, L.; Lu, D.; Wu, P.; Dai, Y.; Sun, X.; Li, Z.; Tang, A.; Zhong, S.; Li, X.; Chen, W.; Xu, R.; Wang, M.; Feng, Q.; Gong, M.; Yu, J.; Zhang, Y.; Zhang, M.; Hansen, T.; Sanchez, G.; Raes, J.; Falony, G.; Okuda, S.; Almeida, M.; LeChatelier, E.; Renault, P.; Pons, N.; Batto, J. M.; Zhang, Z.; Chen, H.; Yang, R.; Zheng, W.; Li, S.; Yang, 3165

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166

Article

Journal of Agricultural and Food Chemistry (25) Rastall, R. A. Gluco and galacto-oligosaccharides in food: Update on health effects and relevance in healthy nutrition. Curr. Opin. Clin. Nutr. Metab. Care 2013, 16, 675−678. (26) Ye, E. Q.; Chacko, S. A.; Chou, E. L.; Kugizaki, M.; Liu, S. M. Greater whole-grain intake is associated with lower risk of type 2 diabetes, cardiovascular disease, and weight gain. J. Nutr. 2012, 142, 1304−1313. (27) Maslowski, K. M.; Vieira, A. T.; Ng, A.; Kranich, J.; Sierro, F.; Yu, D.; Schilter, H. C.; Rolph, M. S.; Mackay, F.; Artis, D.; Xavier, R. J.; Teixeira, M. M.; Mackay, C. R. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature 2009, 461, 1282−1286. (28) Dai, Z. Q.; Su, D.; Zhang, Y.; Sun, Y.; Hu, B.; Ye, H.; Jabbar, S.; Zeng, X. X. Immunomodulatory activity in vitro and in vivo of verbascose from mung beans (Phaseolus aureus). J. Agric. Food Chem. 2014, 62, 10727−10735. (29) Matthews, D. R.; Hosker, J. P.; Rudenski, A. S.; Naylor, B. A.; Treacher, D. F.; Turner, R. C. Homeostasis model assessment: Insulin resistance and b-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985, 28, 412−419. (30) Sánchez-Mata, M. C.; Peñuela-Teruel, M. J.; Cámara-Hurtado, M.; Díez-Marqués, C.; Torija-Isasa, M. E. Determination of mono-, di-, and oligosaccharides in legumes by high-performance liquid chromatography using an amino-bonded silica column. J. Agric. Food Chem. 1998, 46, 3648−3652. (31) Xiang, X. L.; Yang, L. Y.; Hua, S.; Li, W.; Sun, Y.; Ma, H.; Zhang, J. S.; Zeng, X. X. Determination of oligosaccharide contents in 19 cultivars of chickpea (Cicer arietinum L.). seeds by high performance liquid chromatography. Food Chem. 2008, 111, 215−219. (32) Frias, J.; Hedley, C.; Price, K.; Fenwick, G.; Vidal-Valverde, C. Improved methods of oligosaccharide analysis for genetic studies of legume seeds. J. Liq. Chromatogr. 1994, 17, 2469−2483. (33) Singh, D. P.; Khare, P.; Zhu, J.; Kondepudi, K. K.; Singh, J.; Baboota, R. K.; Boparai, R. K.; Khardori, R.; Chopra, K.; Bishnoi, M. A novel cobiotic-based preventive approach against high-fat diet-induced adiposity, nonalcoholic fatty liver and gut derangement in mice. Int. J. Obes. 2016, 40, 487−496. (34) Daniel, H.; Gholami, A. M.; Berry, D.; Desmarchelier, C.; Hahne, H.; Loh, G.; Mondot, S.; Lepage, P.; Rothballer, M.; Walker, A.; Bohm, C.; Wenning, M.; Wagner, M.; Blaut, M.; Schmitt-Kopplin, P.; Kuster, B.; Haller, D.; Clavel, T. High-fat diet alters gut microbiota physiology in mice. ISME J. 2014, 8, 295−308. (35) Schwiertz, A.; Taras, D.; Schafer, K.; Beijer, S.; Bos, N. A.; Donus, C.; Hardt, P. D. Microbiota and SCFA in lean and overweight healthy subjects. Obesity 2010, 18, 190−195. (36) Festi, D.; Schiumerini, R.; Eusebi, L. H.; Marasco, G.; Taddia, M.; Colecchia, A. Gut microbiota and metabolic syndrome. World J. Gastroenterol. 2014, 20, 16079−16094. (37) Tzortzis, G.; Vulevic, J. Oligosaccharides composition for preventing or reducing the risk of metabolic syndrome. WO Patent 2013005001 A1, Jan 10, 2013. (38) Sina, C.; Gavrilova, O.; Forster, M.; Till, A.; Derer, S.; Hildebrand, F.; Raabe, B.; Chalaris, A.; Scheller, J.; Rehmann, A.; Franke, A.; Ott, S.; Hasler, R.; Nikolaus, S.; Folsch, U. R.; Rose-John, S.; Jiang, H. P.; Li, J.; Schreiber, S.; Rosenstiel, P. G protein-coupled receptor 43 is essential for neutrophil recruitment during intestinal inflammation. J. Immunol. 2009, 183, 7514−7522. (39) Bhatia, S.; Prabhu, P. N.; Benefiel, A. C.; Miller, M. J.; Chow, J.; Davis, S. R.; Gaskins, H. R. Galacto-oligosaccharides may directly enhance intestinal barrier function through the modulation of goblet cells. Mol. Nutr. Food Res. 2015, 59, 566−573. (40) Lane, J. A.; O’Callaghan, J.; Carrington, S. D.; Hickey, R. M. Transcriptional response of HT-29 intestinal epithelial cells to human and bovine milk oligosaccharides. Br. J. Nutr. 2013, 110, 2127−2137. (41) Heinonen, I.; Rinne, P.; Ruohonen, S. T.; Ruohonen, S.; Ahotupa, M.; Savontaus, E. The effects of equal caloric high fat and western diet on metabolic syndrome, oxidative stress and vascular endothelial function in mice. Acta Physiol. 2014, 211, 515−527.

(42) Chen, H.; Liu, L. J.; Zhu, J. J.; Xu, B.; Li, R. Effect of soybean oligosaccharides on blood lipid, glucose levels and antioxidant enzymes activity in high fat rats. Food Chem. 2010, 119, 1633−1636.

3166

DOI: 10.1021/acs.jafc.7b00489 J. Agric. Food Chem. 2017, 65, 3160−3166