Efficient Enhancement of Electrochemiluminescence from Cadmium

Feb 9, 2016 - Enzymes as key features in therapeutic cell mimicry. Fabian Itel , Philipp S. Schattling , Yan Zhang , Brigitte Städler. Advanced Drug ...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/ac

Efficient Enhancement of Electrochemiluminescence from Cadmium Sulfide Quantum Dots by Glucose Oxidase Mimicking Gold Nanoparticles for Highly Sensitive Assay of Methyltransferase Activity Hong Zhou,† Tongqian Han,‡ Qin Wei,*,‡ and Shusheng Zhang*,† †

Shandong Provincial Key Laboratory of Detection Technology for Tumor Markers, School of Chemistry and Chemical Engineering, Linyi University, Linyi 276005, People’s Republic of China ‡ Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022, People’s Republic of China ABSTRACT: Herein, an original electrochemiluminescence (ECL) method for the detection of DNA methyltransferase (MTase) activity is presented based on the efficient enhanced ECL of CdS quantum dots (QDs) through catalytic generation of coreactant and energy transfer by glucose oxidase mimicking gold nanoparticles (Au NPs). Briefly, a double-stranded DNA (dsDNA) containing the symmetric sequence of 5′-CCGG-3′ was bonded to the CdS QDs modified glassy carbon electrode (GCE). After that, the electrode was incubated with M.SssI CpG MTase which catalyzed the methylation of the specific CpG dinucleotides. Subsequently, the electrode was treated with a restriction endonuclease HpaII which could recognize and cut off the 5′-CCGG-3′ sequence. Once the CpG site in the 5′-CCGG3′ was methylated, the recognition function of HpaII was blocked, and it could not cut off the ds-DNA. Later, Au NPs were combined with the end of the ds-DNA section which was not cut off and has −SH groups. Therefore, the higher M.SssI MTase activity could lead to more Au NPs immobilized on ds-DNA. Au NPs could not only catalyze the oxidation of glucose with cosubstrate oxygen, producing gluconate and hydrogen peroxide (H2O2) which served as the ECL coreactant of CdS QDs, but also enhanced CdS QDs ECL via energy transfer (ET). Thus, the methylation event corresponding to the MTase activity could be monitored and amplified by this method. Finally, a logarithmic linear correlation between the ECL intensity of CdS QDs and the activity of M.SssI MTase that ranged from 1.0 to 120 U mL−1 with the detection limit of 0.05 U mL−1 was obtained.

T

reactions, and ruthenium complex served as an ECL tag.20 Then further works using the quenching effect between ruthenium complex and graphene,21,22 ferrocene molecule come forward.23 However, all of these works could not avoid the ECL background, which would limit the sensitivity and linear range of those biosensors. So a novel low-background protocol for DNA MTase sensing based on ECL method is of great necessity. Gold nanoparticles (Au NPs) have been used to develop ECL biosensors with increasing sensitivity for the transduction of biological binding events in the past decades.24 One of the interesting topics relating to the system is the research of ECL behavior of quantum dots (QDs) in contact with nanostructural metallic (Au, Ag) surfaces.25−27 The ECL properties of QDs near the metal surface could be improved significantly by adjusting the distance between nanostructural metallic

he term DNA methylation refers to the process of methyl transfer from the donor S-adenosylmethionine (SAM) to cytosine or adenine in particular short palindromic sequences induced by DNA methyltransferase (MTase).1 And the DNA methyltransferases have been used as predictive biomarkers and potential therapeutic targets in various types of cancer, such as lung cancer,2 gastric cancer,3 colon cancer,4 and so on. Therefore, the development of highly sensitive MTase activity detection is very important in cancer therapy. Recently, researchers have been proposing various techniques for the detection of DNA MTase activity, such as high-performance capillary electrophoresis,5 polymerase chain reaction,6 fluorescence,7 bioluminescence,8 chemiluminescence,9 electrochemical methods,10−12 and the electrogenerated chemiluminescence (ECL) method.13−17 And the standard method for detecting MTase activity is radioactive labeling with [methyl-3H]-SAM.18 Among these techniques, the ECL method for the detection of DNA MTase activity has attracted considerable attention.19 Some ECL methods for detection of DNA MTase activity were first reported on the basis of enzyme-linkage © XXXX American Chemical Society

Received: February 2, 2016 Accepted: February 9, 2016

A

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry Table 1. DNA Oligonucleotide Sequences name

sequences (5′−3′)

length

ZH1 ZH2

NH2−(CH2)6−AATCTCAGTTATACGATTCATACAAGTCTCCGGATTGACTCA SH−(CH2)6−TGAGTCAATCCGGAGACTTGTATGAATCGTATAACTGAG

42 39

electrochemical and chemiluminescent analytical system (Remax Electronic Instrument Limited Co., Xi’an, China) using a three-electrode system that consisted of a Pt wire that served as the counter electrode, a Ag/AgCl electrode with saturated KCl solution as reference electrode, and a glassy carbon electrode (GCE, 3 mm in diameter) as working electrode, respectively. Synthesis of CdS QDs. CdS QDs were prepared according to the literature.31 Briefly, Cd(NO3)2·4H2O (0.1683 g) was dissolved in 30 mL of ultrapure water and heated to 70 °C under stirring. After that, a freshly prepared solution of Na2S (0.5960 g) in 30 mL of ultrapure water was slowly injected, and an orange-yellow solution was instantly obtained. The reaction was held at 70 °C for 3 h with continuous refluxing. The final reaction precipitates were centrifuged and washed thoroughly with absolute ethanol and ultrapure water two times, respectively. Then, the obtained precipitate was redispersed into water for centrifugation to collect the upper yellow solution of CdS QDs. The obtained solution was stored at 4 °C. Preparation of Au NPs with Different Diameters. Au NPs (10 nm) were prepared according to literature procedure with a slight modification.32 Briefly, 1 mL of 1 wt % solution of HAuCl4 and 99 mL of ultrapure water were mixed under rapid stirring at 100 °C. After that, 1 wt % sodium citrate solution (2.5 mL) was added quickly, and the solution was kept boiling for 15 min until the color of the solution gradually changed from light yellow to deep red. After cooling to room temperature, the solution was stored at 4 °C. To prepare Au NPs with different diameters, different volumes of sodium citrate solution (1 wt %) were added (Table 2).

surface and QDs which, due to the energy transfer, occurs between the excitons in the QDs and plasmons in the metal surface. For example, ECL signal from CdS/Mn QDs film was increased when CdS/Mn QDs film and Au NPs were at an appropriate distance.27 And these theories have been used for the detection of cancer cells, biomolecules, enzymes, and so on.28 Moreover, Au NPs showed catalysis toward glucose oxidation, producing gluconate and hydrogen peroxide (H2O2).29−31 This catalysis effect of Au NPs could provide a new strategy for construction of ECL biosensors with better performance if combined with the above-mentioned energy transfer. However, so far there are no reports about the coupling of the above advantages of Au NPs for making a novel ECL biosensor. Herein, an ECL biosensor without background for the highly sensitive detection of DNA MTase activity was established based on the coupling of the catalytic function of Au NPs for glucose and the ECL enhancement of Au NPs for CdS QDs. In order to apply these two features of Au NPs, the designed double-stranded DNA (ds-DNA) has amino and mercapto groups, respectively, at both ends, which could combine with CdS QDs and Au NPs. For reducing the ECL background, the electrolyte during the detection process was consisted of glucose instead of H2O2. Once connected with ds-DNA, Au NPs could catalyze glucose in the electrolyte to produce H2O2 which worked as the coreagent for the ECL reaction of CdS QDs. At the same time, Au NPs could enhance the ECL of CdS QDs by energy transfer. So, the self-produced H2O2 played a role of switch which shows whether the activity of the MTase is off or on. Besides, this method could realize the highly sensitive MTase activity detection. And quantum dots were first applied to the detection of DNA MTase activity in this proposal.

■

Table 2. Relationship between the Diameters of Au NPs and the Volumes of Sodium Citrate Solution

EXPERIMENTAL SECTION Chemicals and Reagents. DNA oligonucleotides were ordered from New England Biolabs (Ipswich, MA), and their sequences are as shown in the following Table 1. M.SssI CpG methyltransferase (M.SssI MTase) supplied with 10× NEBuffer 2, restrictionendonuclease HpaII supplied with 10× CutSmart buffer, and HpaII restriction endonuclease were obtained from New England Biolabs (Ipswich, MA). The normal human serum samples containing normal cells and cancer human serum samples containing lung cancer cells were provided by the tumor hospital of Linyi city. Glucose, tris(hydroxymethyl)aminomethane (Tris), and tris(2carboxyethyl)phosphine hydrochloride (TCEP) were obtained from Shanghai Yangu Biotechnology Co., Ltd. (Shanghai, China). N-Hydroxysuccinimide (NHS, 98%), 1-(3-(dimethylamino)-propyl)-3-ethylcarbodiimide hydrochloride (EDC, 98.5%), and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (Beijing, China). All aqueous solutions were prepared using ultrapure water (Milli-Q, Millipore). Apparatus. Transmission electron microscope (TEM) images were obtained from an H-800 microscope (Hitachi, Japan). The UV−vis absorbance spectra were examined with a UV−vis spectrophotometer (PerkinElmer, Malaysia). The ECL measurements were performed with an MPI-A multifunctional

diameters/nm sodium citrate solution (1 wt %)/mL

10 2.5

20 1

30 0.5

Double-Stranded DNA Preparation. Double-stranded DNA was prepared according to the literature.33 The mixture of the 1.0 mM of TCEP and the same concentration of the two oligonucleotides (1.0 μM each) was prepared in a hybridization buffer (10 mM PBS, 10 mM MgCl2, 1.0 M NaCl, pH 7.4). Then the solution was heated to 90 °C for 5 min and cooled down to room temperature slowly. Finally, the stock solution of the prepared ds-DNA (1.0 μM) was kept at 4 °C. Fabrication of the ECL Biosensor. The proposed strategy is shown in Figure 1. First, the bare GCE was polished with 0.05 μm Al2O3 powder, then washed with ultrapure water. When the GCE was dried, 10 μL of CdS QDs solution was dropped on the well-polished GCE surface and dried to obtain GCE/CdS. Then, GCE/CdS was immersed into PBS containing 0.1 M NaCl and 3 mM mercaptoacetic acid for 5 h at 4 °C in order to introduce carboxyl groups. After that, GCE/CdS was washed thoroughly with PBS. Then, carboxyl groups were activated by immersing GCE/CdS in EDC/NHS B

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 1. Schematic illustration of the M.SssI MTase activity assay principle.

Figure 2. TEM images of Au NPs (A) 12 nm, (B) 20 nm, (C) 30 nm, and CdS QDs (D); ECL emission from GCE−CdS QDs under continuous cyclic potential scan for 17 cycles (E). ECL detection buffer: 0.1 M PBS (pH 7.4) containing 3 mM H2O2. Scan rate, 100 mV s−1.

solution (20 mg mL−1/10 mg mL−1) for 1 h and washing with PBS. The immobilization of the ds-DNA on the surface of GCE/ CdS was performed by dropping 10 μL of ds-DNA (1.0 μM) on a freshly activated GCE/CdS and incubating for 4 h at 37 °C, which is denoted as GCE/CdS/ds-DNA. Then the electrode was washed with 10 mM Tris wash buffer (pH 7.4) and ultrapure water sequentially to remove the nonspecifically adsorbed ds-DNA. After that, GCE/CdS/ds-DNA was immersed into 1% BSA for 1 h to block nonspecific binding sites to GCE/CdS/ds-DNA/BSA. The immobilization process was characterized by both ECL intensity signals and electrochemical impedance spectroscopy (EIS) after each step. MTase Activity Assay. GCE/CdS/ds-DNA/BSA was first incubated with 2.5 μL of 1× NEBuffer 2 which contained some concentration of M.SssI MTase at 37 °C for 2 h, and the methylation at the CpG dinucleotide sites of the immobilized ds-DNA was achieved. Then the electrode was incubated with 1× CutSmart buffer (2.5 μL) containing HpaII restriction endonuclease (50 U mL−1) at 37 °C for 2 h, and the cleavage reaction happened. After washing with CutSmart buffer, the electrode was dropped with 2 μL of TCEP (10 mM) to reduce disulfide bonds. Then, the electrode was immersed into a mixed solution (0.5 mL, Au NPs, 10 mM Tris, pH 7.4) for 8 h to obtain GCE/CdS/ds-DNA/BSA/Au. After being washed with Tris (10 mM, pH 7.4), GCE/CdS/ds-DNA/BSA/Au was

placed in the ECL cell to measure the ECL signals in PBS (pH = 7.5) containing 100 mM KCl and 20 mM glucose.

■

RESULTS AND DISCUSSION Characterization of Au NPs and CdS QDs. In order to explore the influence of Au NPs size on catalytic performance of glucose, Au NPs with different sizes were prepared. The TEM image (Figure 2A) shows that the prepared Au NPs are monodisperse nanocrystals of near spherical morphology with an average diameter of 12 nm. Parts B and C of Figure 2 demonstrate the Au NPs with average diameters of 20 and 30 nm, respectively. As revealed in Figure 2D, the average diameter of CdS QDs is about 5 nm, which was consistent with a previous report.30 Figure 2E describes the ECL intensity−time curves of CdS QDs film modified GCE in H2O2 PBS solution (containing 100 mM KCl, pH = 7.5) by cycling 17 cycles of continuous potential scans from −1.4 to 0 V. The strong and stable ECL signal produced by CdS QDs film indicated that CdS QDs film provided a good platform to build ECL sensors. The Important Roles of Au NPs on CdS QDs ECL Intensity. As shown in Figure 1, the thiol-modified end of dsDNA was combined with Au NPs through Au−S and the amino-modified end of ds-DNA was linked with CdS QDs via the condensation between −NH2 and −COOH. Once connected with ds-DNA, Au NPs could catalyze glucose to C

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 3. (A) ECL−potential curves of GCE/CdS/ds-DNA/BSA/Au in PBS (pH = 7.5) containing 100 mM KCl without (curve a) and with (curve b) 20 mM glucose and GCE/CdS/ds-DNA/BSA in PBS (pH = 7.5) containing 100 mM KCl with (curve c) 20 mM glucose. (B) ECL−potential curves of GCE/CdS/ds-DNA/BSA (curve a) and GCE/CdS/ds-DNA/BSA/Au (curve b) in PBS (pH = 7.5) containing 100 mM KCl and 3 mM H2O2. (C) The ECL spectrum of the CdS QDs (curve a) and UV−vis spectrum of Au NPs (curve b). (D) ECL−potential curves of GCE/CdS/dsDNA/BSA/Au (curve a, 10 nm Au NPs; curve b, 30 nm Au NPs; curve c, 20 nm Au NPs) in PBS (pH = 7.5) containing 100 mM KCl and 20 mM glucose.

produce H2O2. In the presence of H2O2, CdS QDs could produce stable ECL signal. In addition, the designed ds-DNA was about 15 nm at length, which had been proved as the effective distance of the resonance energy transfer (RET) between Au NPs and CdS QDs in our previous works.27,28 In this study, the important roles of Au NPs on CdS QDs ECL intensity were investigated (Figure 3, parts A and B). Figure 3A shows the cyclic ECL intensity on potential curves of GCE/ CdS/ds-DNA/BSA/Au in PBS (pH = 7.5) containing 100 mM KCl without (curve a) and with (curve b) 20 mM glucose and GCE/CdS/ds-DNA/BSA in PBS (pH = 7.5) containing 100 mM KCl with 20 mM glucose (curve c). Comparing curve a with curve b, GCE/CdS/ds-DNA/BSA/Au had almost no ECL signal with the absence of glucose. Apparently, these results confirmed that the glucose, which could be catalyzed by Au NPs to produce H2O2, played an important role on enhancing the ECL intensity. Comparing curve c with curve b, GCE/CdS/ ds-DNA/BSA had no ECL signal with the presence of glucose, which manifested that glucose could not act as coreactor of CdS QDs and the produced H2O2 was mainly caused by Au NPs. The ECL behaviors of CdS QDs with the presence of glucose were similar to that of cadmium-based QDs.34 The possible ECL mechanisms (Figure 1) are described with the following equations:

First, glucose was oxidized by O2 at the presence of Au NPs producing gluconic acid and H2O2 (eq 1). Then, electrons from the working electrode were injected to the conduction band of the CdS QDs (eq 2) to form the negatively charged CdS QDs (CdS•−) when the potential was negative enough. After that, CdS QDs•− reacted with the strong oxidant H2O2 and produced excited-state CdS QDs (eq 3). Finally, when CdS* decayed back to the ground-state CdS QDs, an intense emission was obtained (eq 4). Figure 3B shows that the ECL signal was about 2 times larger than that of GCE/CdS/ds-DNA/BSA after Au NPs were connected with ds-DNA. This enhanced ECL signal could be attributed to the ECL energy transfer (ECL-ET) between Au NPs and CdS QDs. When they are separated at a certain distance, the emission of ECL from the CdS QDs could induce surface plasmon resonance (SPR) of Au NPs, and then the induced SPR in turn enhanced the ECL response of CdS QDs.27,28 The UV−vis spectra of the Au NPs and the ECL spectrum of the CdS QDs film were investigated to further testify the feasibility of energy transfer. Figure3C (curve a) exhibits the characteristic absorbance of Au NPs in the range from 460 to 600 nm that peaked at about 519 nm. In the ECL spectrum of the CdS QDs (curve b), there was a broad ECL emission in the range of 450−600 nm that peaked at about 510 nm. Obviously, there is a considerable spectral overlap between the ECL of the CdS QDs and the SPR of Au NPs. On the basis of this necessary overlap for efficient energy transfer in a photoluminescence or chemiluminescence system,35,36 the successful ECL-ET between CdS QDs and Au NPs was achieved. The ECL-ET and catalysis of Au NPs were related with their diameters. Therefore, Au NPs with different diameters were investigated to find the best comprehensive

Au NPs

glucose + O2 ⎯⎯⎯⎯⎯⎯→ gluconic acid + H 2O2

(1)

CdS + e− → CdS−•

(2)

2CdS−• + H 2O2 → 2CdS* + 2OH−

(3)

CdS* → CdS + hv

(4) D

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 4. Effect of methylation time (A) and HpaII concentrations (B) on the ECL response in PBS (pH = 7.5) containing 100 mM KCl and 20 mM glucose.

Figure 5. (A) ECL intensity−time graphs of GCE (curve a), GCE/CdS (curve b), GCE/CdS/ds-DNA (curve c), GCE/CdS/ds-DNA/BSA (curve d), and GCE/CdS/ds-DNA/BSA/Au (curve e) measured in PBS (pH = 7.5) containing 100 mM KCl and 3 mM H2O2. (B) Electrochemical impedance spectroscopy (EIS) of 2.5 mM Fe(CN)63−/4− and 100 mM KCl at (a) bare GCE, (b) GCE/CdS, (c) GCE/CdS/ds-DNA, (d) GCE/ CdS/ds-DNA/BSA, and (e) GCE/CdS/ds-DNA/BSA/Au. The inset shows the general Randles model equivalent circuit for EIS.

at the concentration of 50 U mL−1. Therefore, 50 U mL−1 of HpaII restriction endonuclease was selected as optimal condition for detection. Characterization of the ECL Sensor. ECL intensity at each immobilization step was recorded to monitor the construction of the sensor (Figure 5A). Curve a depicts that the bare GCE has no ECL signal. The strong ECL signal was obtained after CdS QDs were modified on the electrode (curve b). After the successive conjugation of ds-DNA (curve c) and BSA (curve d), the CdS QDs ECL intensity decreased gradually. These phenomena can be explained by the assembled biological macromolecule layers at the electrode surface forming a barrier for electron transfer and hindering the diffusion ECL coreactant toward the electrode surface. Finally, the connecting of Au NPs with ds-DNA gave rise to the enhancement of CdS QDs, which was corresponded with the results of the ECL-ET between CdS QDs and Au NPs (Figure 3B). EIS was employed to further investigate the surface features of the modified electrodes. Figure 5B shows the EIS Nyquist plot observed upon the stepwise modification processes. The typical impedance spectrum comprises a semicircle portion at higher frequencies that represents the charge-transfer resistance (Rct) and the linear part at lower frequencies that corresponds to the diffusion process. The inset of Figure 5B shows a Randles model equivalent circuit for EIS. The equivalent circuit contained Rct, the solution resistance (Rs), the charge of the constant phase element (Cdl), and Warburg element (ZW).37−39 The Rct value, which represents the charge-transfer kinetics of the Fe(CN)63−/4− redox system, can be estimated from the semicircle diameter of EIS Nyquist plot at the high-frequencies range. The bare GCE gave a small semicircle diameter of EIS

effect. Figure 3D describes the experiment results, which showed that Au NPs (20 nm) presented the best ECL-RET and catalysis. Therefore, Au NPs (20 nm) were used for the detection of MTase activity. Optimization of ECL Sensor Working Conditions. In order to evaluate the effects of methylation time on the methylation process, GCE/CdS/ds-DNA/BSA was incubated with M.SssI MTase for different times (ranging from 20 to 160 min). Finally, the ECL signal of GCE/CdS/ds-DNA/BSA/Au is shown in Figure 4A; the ECL response increased with the methylation time from 20 to 120 min obviously. These phenomena indicated that more ds-DNA was methylated with more methylation time. However, the ECL response increased slowly when further prolonging the methylation time after 160 min, which indicated the rate of the M.SssI-catalyzed methylation reaction was slowed down. This phenomenon may be attributed to the approximate saturation of the methylation level. Therefore, 120 min was selected as optimization of methylation time. In order to make sure the ds-DNA without incubating with M.SssI MTase could be cut off completely, the concentrations of HpaII restriction endonuclease were optimized. Finally, the ECL signal of obtained GCE/CdS/ds-DNA/BSA/Au was recorded and is shown in Figure 4B, and the ECL response decreased obviously with improving the HpaII restriction endonuclease concentrations from 0 to 50 U mL−1. These phenomena indicated that more ds-DNA was cut off with the increasing concentration of HpaII restriction endonuclease. However, the ECL response decreased slowly when further increasing the HpaII restriction endonuclease concentration to 70 U mL−1. These phenomena indicated that the ds-DNA without incubating with M.SssI MTase was cut off completely E

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 6. (A) ECL intensity of the sensor to different concentrations of the M.SssI MTase, from left to right: 0, 1, 10, 20, 30, 50, 70, 90, 100, 120 U mL−1. (B) The calibration curve of the M.SssI MTase activity assay, from left to right: 1, 10, 20, 30, 50, 70, 90, 100, 120 U mL−1.

Nyquist plot (curve a), which indicated a low Rct value of the redox couple. Obvious gradual increases in Rct values were observed due to the immobilization of CdS QDs, ds-DNA, and BSA (curves b, c, and d) blocking the charge transfer of the Fe(CN)63−/4− redox system. After Au NPs were immobilized on the electrode, the Rct value was decreased apparently, which indicated Au NPs could accelerate the charge transfer of the Fe(CN)63−/4− redox system. These phenomena were consistent with the ECL results. ECL Detection of MTase by the ECL Immunosensor. Under the optimal conditions, the biosensor was utilized to investigate the relationship between the ECL intensity values and M.SssI MTase concentration. Figure 6A shows the ECL intensity values of the as-prepared sensor after efficient reaction of M.SssI MTase at different concentrations. It was found that the ECL intensity increased with the increasing of M.SssI MTase concentration in the range of 1−120 U mL−1. As presented in Figure 6B, a good linear relationship between the logarithm of ECL intensity and M.SssI MTase concentration was obtained. The equation can be expressed as the following: lg(ECL intensity) = 2.043 + 0.008C (U mL−1) (R2 = 0.986). The detection limit is detected to be 0.05 U/mL, which was the lowest response concentration. As shown in Table 3, the

performance of the sensor was compared with some previous reports. It was found that the prepared sensor exhibited broader linear range than most of them, and has a relatively low detection limit. The high sensitivity of this sensor can be explained by the function of Au NPs, which can achieve M.SssI MTase detection without ECL background. Effects of Inhibitors on M.SssI MTase Activity. In order to research our proposed assay for the inhibitor screening ability, the following experiments were carried out using 5azacytidine (5-Aza) and 5-aza-2′-deoxycytidine (5-Aza-dC) as model inhibitors on M.SssI MTase. Both compounds are nucleoside analogues, and could inactivate DNA MTase, which have been used in the majority of methylation inhibition experiments and also in a large number of clinical trials.43 As shown in Figure 7, the M.SssI MTase relative activity decreased with the increasing concentrations of the inhibitors in a dosedependent manner. These results also indicated that 5-Aza-dC exhibited a higher inhibition efficiency than that of 5-Aza. This was because that 5-Aza-dC can be more readily incorporated into DNA and does not need to be modified to a deoxy form. The half-maximal inhibitory concentration (IC50) represents the concentration of a drug that is required for 50% decrease in enzyme activity in vitro. From the experimental data, the IC50 values for 5-Aza and 5-AzadC were obtained to be ∼3.2 and 2.0 μM, respectively. Above results demonstrated that the assay of proposed M.SssI MTase activity is a useful tool for anticancer drug discovery and can be used in MTase inhibitor screening. Preliminary Analysis of Real Samples. To further verify the practical utility of this approach, normal and cancer human serum samples are used. Normal human serum sample containing some concentration of normal cells broken fluid and cancer human serum sample containing some concentration of lung cancer cells broken fluid were obtained by five freeze−thaw cycles, in which samples were frozen at −20 °C then thawed at 9 ± 1 °C in a water bath. As shown in Table 4

Table 3. Comparison with Other Technologies for M.SssI MTase detection techniques photoelectrochemical biosensor colorimetry ECL biosensor ECL quenching sensor ECL sensor

linear range (U mL−1)

LOD (U mL−1)

0.1−50

0.035

40

2.5−40 0.25−10 0.1−100 1−120

2.5 0.18 0.03 0.05

41 42 23 this work

refs

Figure 7. Inhibition effect of (A) 5-Aza and (B) 5-Aza-dC on M.SssI MTase activity. F

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

■

Table 4. Results of the M.SssI MTase Activity Test in Cancer Human Serum Sample Using the Proposed Method samples cancer serum [containing lung cancer cells (2 × 106 cell mL−1) broken fluid] cancer serum [containing lung cancer cells (2 × 104 cell mL−1) broken fluid] normal serum [containing normal cells (2 × 106 cell mL−1) broken fluid]

ECL intensity

M.SssI MTase detection (U mL−1)

164

21.5

117

3.1

44

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: 86 531-82765969. Fax: 86 531-82765969. *E-mail: [email protected]. Phone: 86 0539-8766107. Fax: 86 0539-8766107. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (21405072, 21275086, 21375047, 21575050, and 21535002), the “Innovation Team Development Plan” of the Ministry of Education Rolling Support (IRT_15R31), the Special Foundation for Taishan Scholar Professorship of Shandong Province (nos. tspd20150209 and ts20130937), the Shandong Provincial Natural Science Foundation, China (ZR2014BL023), and the Project of Shandong Province Higher Educational Science and Technology Program (no. J14LC14).

0

and Figure 8, detection of M.SssI MTase activity in cancer human serum sample containing different concentrations of

■

REFERENCES

(1) Cheng, X. D.; Roberts, R. J. Nucleic Acids Res. 2001, 29, 3784− 3795. (2) Belinsky, S. A.; Nikula, K. J.; Baylin, S. B.; Issa, J. P. Proc. Natl. Acad. Sci. U. S. A. 1996, 93, 4045−4050. (3) Mutze, K.; Langer, R.; Schumacher, F.; Becker, K.; Ott, K.; Novotny, A.; Hapfelmeier, A.; Höfler, H.; Keller, G. Eur. J. Cancer 2011, 47, 1817−1825. (4) Issa, J. P. J.; Vertino, P. M.; Wu, J.; Sazawal, S.; Celano, P.; Nelkin, B. D.; Hamilton, S. R.; Baylin, S. B. J. Nat. Cancer. Inst. 1993, 85, 1235−1240. (5) Fraga, M. F.; Rodríguez, R.; Cañal, M. J. Electrophoresis 2000, 21, 2990−2994. (6) van Steensel, B.; Henikoff, S. Nat. Biotechnol. 2000, 18, 424−428. (7) Li, W.; Liu, Z.; Lin, H.; Nie, Z.; Chen, J.; Xu, X.; Yao, S. Anal. Chem. 2010, 82, 1935−1941. (8) Jiang, C.; Yan, C. Y.; Huang, C.; Jiang, J.-H.; Yu, R.-Q. Anal. Biochem. 2012, 423, 224−228. (9) Zeng, Y.; Hu, J.; Long, Y.; Zhang, C.-y. Anal. Chem. 2013, 85, 6143−6150. (10) He, X.; Su, J.; Wang, Y.; Wang, K.; Ni, X.; Chen, Z. Biosens. Bioelectron. 2011, 28, 298−303. (11) Wu, H.; Liu, S.; Jiang, J.; Shen, G.; Yu, R. Chem. Commun. 2012, 48, 6280−6282. (12) Su, J.; He, X.; Wang, Y.; Wang, K.; Chen, Z.; Yan, G. Biosens. Bioelectron. 2012, 36, 123−128. (13) Deng, S. Y.; Lei, J. P.; Huang, Y.; Cheng, Y.; Ju, H. X. Anal. Chem. 2013, 85, 5390−5396. (14) Chen, Z. H.; Liu, Y.; Wang, Y. Z.; Zhao, X.; Li, J. H. Anal. Chem. 2013, 85, 4431−4438. (15) Yang, M. L.; Chen, Y.; Xiang, Y.; Yuan, R.; Chai, Y. Q. Biosens. Bioelectron. 2013, 50, 393−398. (16) Richter, M. M. Chem. Rev. 2004, 104, 3003−3036. (17) Miao, W. Chem. Rev. 2008, 108, 2506−2553. (18) Pradhan, S.; Bacolla, A.; Wells, R. D. J.; Roberts, R. J. J. Biol. Chem. 1999, 274, 33002−33010.

Figure 8. ECL intensity−time graphs of cancer human serum containing 2 × 106 (cell mL−1) lung cancer cells broken fluid (curve a), cancer human serum containing 2 × 104 (cell mL−1) lung cancer cells broken fluid (curve b), and normal human serum sample containing 2 × 106 (cell mL−1) normal cells broken fluid (curve c).

lung cancer cells broken fluid is satisfactorily achieved and substantiated the fine accuracy of this method in biological samples. We also spiked M.SssI MTase in normal human serum samples and then determined the concentrations of the M.SssI MTase in the spiked samples. The recoveries ranged from 96.0% to 100.5% (Table 5), indicating that our assay possesses great selectivity even in complex media and may therefore find practical utility in clinical settings.

■

Article

CONCLUSION

In conclusion, Au NPs were used as the transduction of M.SssI MTase activity events based on their catalysis and ECL-ET properties. This proposed method reduced the ECL detection background and realized the highly sensitive assay for the M.SssI MTase activity. Therefore, the simple method was suitable to build a biocompatible platform for M.SssI MTase activity assay, which might provide a promising potential for application in biological or clinical target analysis.

Table 5. Results of the Recovery test of M.SssI MTase in Normal and Cancer Human Serum Samples Using the Proposed Method samples

M.SssI MTase added (U/mL)

M.SssI MTase found (U/mL)

av value (U/mL)

recovery (%)

normal human serum (containing normal cells broken fluid)

10 20 30

9.38, 9.75, 9.63 19.81, 20.13, 19.74 30.27, 30.16, 29.98

9.59 19.89 30.14

96.0 99.5 100.5

G

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry (19) Liu, Z.; Qi, W.; Xu, G. Chem. Soc. Rev. 2015, 44, 3117−3142. (20) Li, Y.; Huang, C.; Zheng, J.; Qi, H. Biosens. Bioelectron. 2012, 38, 407−410. (21) Ji, L.; Cai, Z.; Qian, Y.; Wu, P.; Zhang, H.; Cai, C. Chem. Commun. 2014, 50, 10691−10694. (22) Li, X. J.; Li, Y. Y.; Feng, R.; Wu, D.; Zhang, Y.; Li, H.; Du, B.; Wei, Q. Sens. Actuators, B 2013, 188, 462−468. (23) Luo, X.; Li, Y.; Zheng, J.; Qi, H.; Liang, Z.; Ning, X. Chem. Commun. 2015, 51, 9487−9490. (24) Jie, G.; Liu, B.; Pan, H.; Zhu, J.-J.; Chen, H.-Y. Anal. Chem. 2007, 79, 5574−5581. (25) Matsuda, K.; Ito, Y.; Kanemitsu, Y. Appl. Phys. Lett. 2008, 92, 211911. (26) Maye, M. M.; Gang, O.; Cotlet, M. Chem. Commun. 2010, 46, 6111−6113. (27) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2009, 95, 905− 907. (28) Wang, J.; Shan, Y.; Zhao, W. W.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2011, 83, 4004−4011. (29) Luo, W.; Zhu, C.; Su, S.; Li, D.; He, Y.; Huang, Q.; Fan, C. ACS Nano 2010, 4, 7451−7458. (30) Cao, Y.; Yuan, R.; Chai, Y.; Mao, L.; Niu, H.; Liu, H.; Zhuo, Y. Biosens. Bioelectron. 2012, 31, 305−309. (31) Kong, F. Y.; Li, X. R.; Zhao, W. W.; Xu, J.-J.; Chen, H.-Y. Electrochem. Commun. 2012, 14, 59−62. (32) Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Anal. Chem. 1995, 67, 735−743. (33) Deng, H. M.; Yang, X. J.; Yeo, S. P. X.; Gao, Z. Q. Anal. Chem. 2014, 86, 2117−2123. (34) Li, L. L.; Liu, K. P.; Yang, G. H.; Wang, C.-M.; Zhang, J.-R.; Zhu, J.-J. Adv. Funct. Mater. 2011, 21, 869−878. (35) Huang, X.; Li, L.; Qian, H.; Dong, C.; Ren, J. Angew. Chem. 2006, 118, 5264−5267. (36) Zhou, H.; Liu, J.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2011, 47, 8358−8360. (37) Yang, L.; Li, Y. Biosens. Bioelectron. 2005, 20, 1407−16. (38) Huang, H.; Ran, P.; Liu, Z. Bioelectrochemistry 2007, 70, 257− 262. (39) Han, T. Q.; Li, X. J.; Li, Y. Y.; Cao, W.; Wu, D.; Du, B.; Wei, Q. Sens. Actuators, B 2014, 205, 176−183. (40) Yang, Z.; Wang, F.; Wang, M.; Yin, H.; Ai, S. Biosens. Bioelectron. 2015, 66, 109−114. (41) Li, W.; Liu, Z.; Lin, H.; Nie, Z.; Chen, J.; Xu, X.; Yao, S. Anal. Chem. 2010, 82, 1935−1941. (42) Wang, G. L.; Zhou, L. Y.; Luo, H. Q.; Li, N. B. Anal. Chim. Acta 2013, 768, 76−81. (43) Christman, J. K. Oncogene 2002, 21, 5483−5495.

H

DOI: 10.1021/acs.analchem.6b00450 Anal. Chem. XXXX, XXX, XXX−XXX