Efficient Total Nitrogen Removal in an Ammonia Gas Biofilter through

Article pubs.acs.org/est

Efficient Total Nitrogen Removal in an Ammonia Gas Biofilter through High-Rate OLAND Haydée De Clippeleir,† Emilie Courtens,† Mariela Mosquera,† Siegfried E. Vlaeminck,† Barth F. Smets,‡ Nico Boon,*,† and Willy Verstraete† †

Laboratory of Microbial Ecology and Technology (LabMET), Ghent University, Coupure Links 653, 9000 Ghent, Belgium Department of Environmental Engineering, Technical University of Denmark (DTU), Miljoevej, Building 113, 2800 Kgs. Lyngby, Denmark

‡

ABSTRACT: Ammonia gas is conventionally treated in nitrifying biofilters; however, addition of organic carbon to perform post-denitrification is required to obtain total nitrogen removal. Oxygen-limited autotrophic nitrification/denitrification (OLAND), applied in fullscale for wastewater treatment, can offer a cost-effective alternative for gas treatment. In this study, the OLAND application thus was broadened toward ammonia loaded gaseous streams. A down flow, oxygen-saturated biofilter (height of 1.5 m; diameter of 0.11 m) was fed with an ammonia gas stream (248 ± 10 ppmv) at a loading rate of 0.86 ± 0.04 kg N m−3 biofilter d−1 and an empty bed residence time of 14 s. After 45 days of operation a stable nitrogen removal rate of 0.67 ± 0.06 kg N m−3 biofilter d−1, an ammonia removal efficiency of 99%, a removal of 75−80% of the total nitrogen, and negligible NO/N2O productions were obtained at water flow rates of 1.3 ± 0.4 m3 m−2 biofilter section d−1. Profile measurements revealed that 91% of the total nitrogen activity was taking place in the top 36% of the filter. This study demonstrated for the first time highly effective and sustainable autotrophic ammonia removal in a gas biofilter and therefore shows the appealing potential of the OLAND process to treat ammonia containing gaseous streams.

■

INTRODUCTION Ammonia (NH3) is a colorless and reactive air pollutant that is an important cause of acidification of soils and waters and high levels of nitrate in surface and drinking waters. It is commonly emitted from both industrial and agricultural activities such as wastewater treatment plants, chemical and manufacturing industries, composting plants, and livestock farming.1−3 In contrast to the operational complexity and high costs of physicochemical treatment processes, biological treatment can offer cost-effective and straightforward purification of gas streams. The latter biofiltration systems are mainly based on nitrification, transforming ammonia into nitrite and nitrate, and as a result end up with a highly loaded percolate mixture of ammonium (NH4+), nitrite (NO2−), and nitrate (NO3−).4 To obtain dischargeable effluent, post-denitrification with the addition of an external organic carbon source is applied or the effluent is send to a central wastewater treatment facility.5,6 Anoxic autotrophic nitrogen removal by anoxic ammoniumoxidizing or anammox bacteria (AnAOB), able to combine nitrite with ammonium to N2 gas, can offer a solution in this nitrogen rich biofilter environment devoid in organic carbon. Oxygen-limited autotrophic nitrification/denitrification (OLAND) is a one-stage realization of partial nitritation/ anammox, the economically preferred nitrogen removal technology for wastewaters with a biodegradable COD/N ratio below 3.7 This process is based on the cooperation between aerobic ammonium-oxidizing bacteria (AerAOB), which oxidize part of the ammonium to nitrite in the outer © 2012 American Chemical Society

aerobic zones of the biofilm, and AnAOB, which subsequently convert nitrite and ammonium to nitrogen gas in the inner, anoxic zones. As a result, nitrogen is converted autotrophically in one step to nitrogen gas. This autotrophic nitrogen removal process has been established in full-scale for several wastewater treatment applications.8−10 However, this process was thus far not applied for the treatment of gaseous ammonia-rich streams. Application of an OLAND biofilter would allow a total nitrogen removal, defined as a total nitrogen loss based on gas and water composition, in the biofilter itself due to N2 gas production by AnAOB. Although most ammonia gas biofilters are based on nitrification, a total nitrogen removal efficiency is commonly observed ranging from 10 to 50% (Table 1). Total nitrogen removal can occur in the inert form of N2 or in the unsustainable form of NO or N2O. However, the contribution of NO and N2O production to the total nitrogen removal and the operational factors inducing higher total nitrogen removal rates are unclear. Until now the total nitrogen removal was attributed to denitrification by heterotrophic and/or nitrifying bacteria, both needing oxygen limitation, or by bacterial growth. The contribution of AnAOB as a cause for total nitrogen removal in biofilters was not considered before despite the presence of ammonium and nitrite and the occurrence of Received: Revised: Accepted: Published: 8826

April 30, 2012 June 18, 2012 July 16, 2012 July 16, 2012 dx.doi.org/10.1021/es301717b | Environ. Sci. Technol. 2012, 46, 8826−8833

Environmental Science & Technology

Article

Table 1. Overview of the Operational Parameters and Nitrogen Losses in Ammonia Gas Biofiltersc loading rate(++) N loss (%)

DF/ UF

packing material

0

UF

0−30

DF

15

DF

16−32

UF

52

DF

30−60

DF

98a

DF

slow release slow release slow release slow release slow release slow release inert

75−80

DF

inert

height (m)

H/D

EBRT (s)

NH3 in ppm

(kg N m−3 biofilter d−1)

(kg N m−2 biofilter section d−1)

water flow rate(+) (m3 m−2 biofilter d−1) b

temp (°C) 24

ref

1.0

10

20−36

90−260

0.1−0.6

0.1−0.6

0.1

0.3

3

14

270−700

1.3−3.0

0.4−0.9

3.9

22−25

Baquerizo et al.4 Sakuma et al.6

0.6

4

32−85

10−150

0.1−0.2

0.07−0.1

1.6

30

Kim et al.2

1.0

7

30−35

50−200

0.1−0.6

0.1−0.6

0b

25−30

Chen et al.15

1.5

9

54

35

0.03

0.05

0.4

20−25

Cabrol5

1.4

14

50

35−170

0.1−0.3

0.1−0.5

0.08

20−30

0.6

11

60

100−600

0.1−0.5

0.05−0.3

72

20−25

1.6

14

14

250 ± 10

0.9 ± 0.1

1.3 ± 0.1

1.2 ± 0.4

20−25

Malthautier et al.32 Moussavi et al.33 this study

External organic carbon source addition in filter to obtain simultaneous nitrification/denitrification. bThe air flow was humidified before entering the biofilter. cDF/UF: down flow/upflow reactors, H/D: height over diameter ratio; EBRT: empty bed residence time. The water to N ratio expressed as L water g−1 Nin can be calculated by dividing (+) by (++). a

concentration of 3.8 g VSS L−1 biofilter. The total contact surface based on the specific surface of the Kaldnes rings was estimated at 800 m2 m−3 total reactor. The inlet ammonia stream was supplied at the top as a mixture of compressed air and pure ammonia and was controlled by two digital mass flow controllers (Bronkhorst, The Netherlands) to ensure a stable inlet concentration of 248 ± 10 ppmv, a gas velocity of 0.1 m s−1, and a gas empty bed residence time (EBRT) of 14 s. The biofilter was humidified by discontinuously spraying (1 s every 5 min) tap water at an initial flow rate of 0.8 m3 m−2 biofilter section d−1 on top of the filter. The filter was operated at room temperature (23 ± 1 °C). Daily, samples were taken from the gas in- and outlet (200 mL) and from the water phase (10 mL) to determine the ammonia, ammonium, nitrite, and nitrate concentration. Nitrous oxide and nitric oxide concentration were only measured during the profile measurements. Profile Measurements. On days 90 and 99, gas and water samples were taken at 0, 7, 32, 57, 82, 107, 132, and 157 cm depth from the top for the detection of NH3, O2, NO, N2O and NH4+, NO2−, and NO3−. In all water samples, the pH was also measured. These measurements allowed obtaining vertical activity profiles. Activity Batch Test. On day 125, the specific activities of AerAOB, AnAOB, and nitrite oxidizing bacteria (NOB) in the different zones of the biofilters (see profile measurements) was determined in separate activity tests in aqueous media at 22 °C and at initial nitrogen concentration of 100 mg N L−1, as described by Vlaeminck et al.17 Chemical Analyses. NH3 was measured in the gas phase with colorimetric gas detection tubes (RAE, Hoogstraten, Belgium), using 100 mL of gas sample. The NH3 detection tubes had a detection limit of 1 ppmv NH3 (0.62 mg NH3−N m−3). The N2O and O2 concentrations in the gas phase were analyzed with a Compact GC (Global Analyzer Solutions, Breda, The Netherlands), equipped with a Porabond precolumn and a Molsieve SA column. The thermal conductivity detector had a detection limit of 1 ppmv for each gas component. NO measurements were done based on the principle of chemiluminescence using Eco Physics CLD 77 a.m. (Eco Physics AG, Duernten, Switzerland) with a detection

anoxic activity in these filters. Heterotrophic denitrification is possible when organic compounds in the gas or water phase are available and can lead to both N2 and NO/N2O formation.11 Nitrifier denitrification by aerobic ammonium-oxidizing bacteria (AerAOB) implicates nitrogen removal by NO and N2O formation instead of N2 production12 and hence negatively affects the sustainability of the technology. It was reported that almost 20% of the NH3 loading can be converted to N2O by autotrophic and/or heterotrophic denitrification.13 Finally, nitrogen can also be incorporated into the biomass and used for growth. It was estimated that the nitrogen incorporation in biomass accounts for 7% of the nitrogen input.5 The stimulation of AnAOB in the biofilter and thus application of the OLAND process for the treatment of ammonia containing gas streams could offer two advantages. First, AerAOB inhibition by free ammonia or free nitrous acid is commonly observed in biofilters and results in ammonium to nitrate ratios in the percolate of around 1.4,5,14,15 The lower ammonium consumption rate by AerAOB can be compensated during the OLAND process by ammonium consumption by AnAOB. Second, the higher the AnAOB activity in the filter, the higher the nitrogen gas production rate, and thus the higher the total nitrogen removal rate in the filter will be. Together, these two facts will decrease the need for post-treatment of the percolate and consequently the cost for external organic carbon source addition. The goal of this study was to demonstrate the possibility to obtain fully autotrophic total nitrogen removal in an ammonia gas biofilter through a combination of AerAOB and AnAOB activity, also referred to as the OLAND process. This is the first study showing anammox as the main nitrogen removal process in ammonia gas biofilters.

■

MATERIALS AND METHODS Biofilter Setup and Operation. The biofilter consisted of a PVC cylindrical column with a height of 1.57 m and an internal diameter of 0.11 m. The section surface of the filter was thus 95 cm2. The column was packed with Kaldnes K1 packing material (AnoxKaldnes, Lund, Sweden), and on 50% of the carriers OLAND biomass from a stably working OLAND rotating contactor16 was added, resulting in an initial biomass 8827

dx.doi.org/10.1021/es301717b | Environ. Sci. Technol. 2012, 46, 8826−8833


Article

Table 2. Overview of the Primers Sets and Conditions Used for Determination of the Abundance of AerAOB, AOA, AnAOB, and NOB with qPCR functional group

target gene

AerAOB

amoA gene

AOA

Creanarchaeal amoA gene

Nitrospira sp. Nitrospira sp. AnAOB AnAOB

16S 16S 16S 16S

rRNA rRNA rRNA rRNA

primers

sequences (5′-3′)

amoA- 1F amoA-2R CrenamoA23f Creanamo A616r Nspra675f Nspra746r Amx809f Amx1066r

GGGGTTTCTACTGGTGGT CCCCTCKGSAAAGCCTTCTTC ATGGTCTGGCTWAGACG GCCATCCATCTGTATGTCCA GCG GTG AAA TGC GTA GAK ATC G TCA GCG TCA GRW AYG TTC CAG AG GCC GTA AAC GAT GGG CAC T ATG GGC ACT MRG TAG AGG GGT TT

melting temp (°C)

ref

55

34

56

35

67.2 65.3 67.1 67.4

36 36 37 37

Figure 1. Nitrogen loading and removal rates (top) and corresponding contribution of the different nitrogen species in the emitted air and water flow, as a percentage of the incoming nitrogen (bottom). The nitrogen removal is considered to be due to N2 formation, since profile measurements showed negligible amounts of NO (0.5% of incoming N) and N2O (below detection limit) production. Three main periods are distinguished: a startup period (phase I); a pH stabilization period (phase II); and a water flow rate optimization period (phase III).

Germany) and an electrode installed on a C833 m (Consort, Turnhout, Belgium). Quantification with Real-Time PCR. Biomass samples (approximately 5 g) for nucleic acid analysis were taken from the OLAND rotating contactor (inoculum of the biofilter) and at 7, 32, 57, 82, 107, 132, and 157 cm depth after 125 days of operation. DNA was extracted using FastDNA SPIN Kit for

limit of 1 ppbv. Ammonium (Nessler method) and VSS (after removing the biomass from the carriers) were measured according to standard methods.18 Nitrite and nitrate were determined on a Metrohm 761 Compact Ion Chromatograph (Zofingen, Switzerland) equipped with a conductivity detector. Dissolved oxygen (DO) and pH were measured with, respectively, an HQ30d DO meter (Hach Lange, Düsseldorf, 8828



Article

Soil (MP Biomedicals, LLC), according to the manufacturer’s instructions. The obtained DNA was purified with the Wizard DNA Clean-up System (Promega, USA), and its final concentration was measured spectrophometrically using a NanoDrop ND-1000 spectrophotometer (Nanodrop Technologies). The SYBR Green assay (Power SyBr Green, Applied Biosystems) was used to quantify the 16S rRNA of bacterial anammox bacteria and Nitrospira sp. and the functional amoA gene for AerAOB and ammonium-oxidizing archaea (AOA). The primers for quantitative polymerase chain reactions (qPCR) used in this study are listed in Table 2. Plasmid DNAs carrying AerAOB, AOA functional AmoA gene and Nitrospira and anammox 16SrRNA gene, respectively, were used as standards for qPCR.

■

RESULTS Performance of the Biofilter. In a biomass free control test with inert Kaldnes K1 packing material, all nitrogen inserted via the gas phase as NH3 could be found back in the effluent gas and water phase, excluding nitrogen removal by leakages. After inoculation of the biofilter with active OLAND biofilm on the Kaldnes K1 packing material, the biofilter was immediately fed with an ammonia gas stream, without acclimatization of the biomass by water recirculation, at a loading rate of 0.88 ± 0.04 kg N m−3 biofilter d−1. After 31 days of operation, the ammonia gas removal efficiency remained stable around 99 ± 0.7%, independent of the operational conditions (Figure 1). Although a high pH value around 8.3 ± 0.6 was measured during the start-up period (phase I, Figure 1), only 20 ± 5% of the nitrogen load was detected in the percolate as ammonium and the total nitrogen removal accounted already for 53 ± 11% of the total nitrogen load. During phase II (Figure 1), an ammonium decrease and nitrite and nitrate increase in the percolate together with higher total nitrogen removal efficiencies up of 70 ± 5% were accompanied by a pH decrease from 8.3 ± 0.6 (Phase I) to 6.6 ± 0.4 (Phase II). From day 45 onward, the decrease in pH was stabilized by addition of coccolith lime on the biofilter top (on average 0.7 kg m−3 biofilter d−1) resulting in a pH value of 6.9 ± 0.3 during the following operation period (end of phase II and phase III). During phase III, the influence of the water flow rate on the biofilter performance was tested as the latter influences the NH3 dissolution and the nitrogen concentration at which the bacteria are exposed to. A small increase in the water flow rate from 1.2 ± 0.6 to 1.7 ± 0.2 m3 m−2 biofilter section d−1 combined with the stable pH conditions allowed higher total nitrogen removal efficiencies of 79 ± 6% between day 73 and day 90. The latter was mainly due to higher ammonium removal efficiencies (Figure 1). A decrease from day 91−105 of the water flow rate to 1.2 ± 0.4 m3 m−2 biofilter section d−1 did not have a significant effect on the removal performance. Moreover, during the increase of the water flow rate up to 2.4 ± 0.7 m3 m−2 biofilter section d−1 (day 106−125), the removal efficiency remained stable around 79 ± 7% and only the absolute concentration in the percolate decreased due to dilution. A NH3 gas inlet failure (day 114), resulting in 1 day without NH3 addition, had no significant influence on the performance afterward. Vertical Distribution of Microbial Activity. The vertical profile measurement during phase III showed that the highest microbial activity occurred in the top 0.57 m of the biofilter (Figure 2), while at all height oxygen was saturated in the gas phase. Ammonia dissolved for 80−95%, depending on the

Figure 2. Vertical profile measurement expressed as NH3, NH4+, NO2−, and NO3− productions based on the gas and water phase analysis at day 90 (A) and day 99 (B) operated at water flow rates of 1.4 and 1.1 m3 m−2 biofilter section d−1, respectively. Total NO production was negligible (0.5% of nitrogen input), and N2O production was not detected.

water flow rate, in the first 32 cm of the biofilter (Figure 2). In the first 7 cm, only dissolution and no microbial activity occurred. In the subsequent zones the highest total nitrogen removal rates were observed. In these zones, ammonium and nitrite were consumed without an equivalent nitrate production (Figure 2). In this upper 57 cm of the filter, 91% of the total nitrogen removal was taking place (Figure 2A) and according to the stoichiometry, the absence of organic carbon and the absence of NO or N2O production, this was mainly attributed to the AnAOB. In the lower two-thirds (>57 cm depth, Figure 2A) some denitrification (9% of the total nitrogen removal), probably using organics from bacterial decay, occurred. Although the total nitrogen removal rate in the biofilter remained constant when the water flow rates was decreased from 1.4 to 1.1 m3 m−2 biofilter section d−1 (Figure 2B), a downward shift of the OLAND activity from 0.07 to 0.57 m to 0.32−0.82 m was observed. This was probably attributed to the inhibition of the AnAOB activity by higher nitrite concentrations in the upper section of the filter and the slower dissolution of NH3 (Table 3). Biomass samples were taken at 6 biofilter zones and the AnAOB, AerAOB, and NOB activity was tested in aqueous medium. Despite the 4-fold lower total nitrogen removal rate compared to the biofilter performance (0.2 compared to 0.8 kg N m−3 biofilter d−1), the vertical profile distribution of the AnAOB activity confirmed the direct biofilter profile measurements (Table 3). AnAOB activity was measured in the zone 7− 82 cm and decreased rapidly in the lower compartments (Table 3). In the lower zones (>82 cm), (nitrifier) denitrification could 8829



Article

Table 3. Operational Conditions Measured Directly in the Filter and Microbial Activities Measured in Separate Aqueous Activity Tests (n = 3) at Different Top down Biofilter Zonesb top down biofilter zone pH (-) free ammonia (mg N L−1) NO2− (mg N L−1)

water flow rate (m3 m‑2 biofilter section d‑1)

7−32 cm

32−57 cm

1.4 1.1 1.4 1.1 1.4 1.1

8.6 8.1 61 51 200 441

7.2 6.6 0.4 1.0 147 411

total anoxic nitrogen removal rate (mg N g−1 VSS d−1) aerobic ammonium oxidation rate (mg N g−1 VSS d−1) aerobic nitrate production rate (mg N g−1 VSS d−1)

57−82 cm

82−107 cm

7.1 6.5 6.8 6.0 0.4 0.07 0.4 0.07 119 122 248 254 top down biofilter zone

107−132 cm

132−157 cm

6.3 6.3 0.03 0.09 30 21

7.1 7.1 0.2 0.5 71 121

microbial group

7−32 cm

32−57 cm

57−82 cm

82−107 cm

107−132 cm

132−157 cm

AnAOB AerAOB NOB

13 ± 3 142 ± 52 1±1

9±3 252 ± 27 n.d.

13 ± 4 389 ± 10 19 ± 14

2 ± 2a 226 ± 54 157 ± 63

n.d.a 149 ± 59 140 ± 26

n.d.a 244 ± 37 136 ± 46

a

Anoxic nitrite consumption without anoxic ammonium consumption was observed, but this should not be considered as AnAOB activity. bn.d.: not detected; AerAOB: aerobic ammonium oxidizing bacteria; AnAOB: anoxic ammonium oxidizing bacteria; NOB: nitrite oxidizing bacteria.

Figure 3. Abundance of AerAOB, AOA, AnAOB, and Nitrospira, expressed as copies of AerAOB-AmoA, AOA-amoA, AnAOB-16SrRNA and Nitrospira-16SrRNA ng−1 DNA, respectively, in the inoculum and in the different biofilter zones after 125 days of operation.

observed decrease in inhibition factors such as free ammonia and the NOB activity measured at these zones (Table 3) confirmed the abundance measurements.

take place because anoxic nitrite consumption was taking place, while no difference in ammonium concentration was observed (data not shown). AerAOB were active over the total depth of the biofilter, while NOB started to show activity at the lower part of the biofilter (>82 cm). The total biomass concentration, measured after emptying the biofilter, increased during 125 days of operation from 3.8 g VSS L−1 biofilter to 19 g VSS L−1 biofilter, with the highest concentration at 7−32 cm depth. Vertical Abundance of N Species. The biofilter was inoculated with biomass containing 2 × 102 AerAOB-AmoA copies, 9 × 103 AnAOB-16SrRNA copies, and 2 × 102 Nitrospira-16SrRNA copies ng−1 DNA, which was homogeneously distributed over the filter. AOA were not detected in the inoculum. However after 125 days of operation, up to 2 × 102 AOA-AmoA copies ng−1 DNA were detected (Figure 3). AnAOB abundance remained constant over the filter. AerAOB showed a peak concentration at a depth of 57−82 cm, which correlated well with the activity test (Table 3). The Nitrospira abundance increased significantly to 2 × 105 Nitrospira16SrRNA copies ng−1 DNA below a depth of 82 cm. The

■

DISCUSSION OLAND Application for NH3 Treatment. This study showed for the first time that AnAOB activity can be obtained in an oxygen-saturated biofilter treating a NH3 gas stream. The application of the OLAND process instead of nitrification in the biofiltration technology would allow higher total nitrogen removal in the biofilter itself (up to 80%), significantly decreasing the cost for an external carbon source addition needed for post-denitrification of the percolate. Moreover, this study showed that by implementing the OLAND process, a sustainable total nitrogen removal can be obtained without NO and N2O formation. The unsustainable nitrogen removal during conventional NH3 treatment is in most studies neglected and not measured (Table 1) but is expected to be high (up to 20% of the nitrogen loading rate can be emitted as N2O13). 8830



Article

AnAOB Niche in NH3 Biofilters. Total nitrogen removal in NH3 fed biofilters has been reported in several studies (Table 1). However, the total nitrogen removal efficiency was mainly lower than 60%, while in this study a total nitrogen removal efficiency of almost 80% was obtained (Table 1). The total nitrogen removal rates obtained in the NH3 fed OLAND biofilter were in the same range as OLAND application for wastewater treatment.19 Generally, the total nitrogen removal in ammonia gas biofilters can be attributed to several processes: (i) denitrification; (ii) nitrifier denitrification; (iii) nitrogen biomass incorporation; (iv) chemical reactions; and as shown in this study (v) anammox. Because inert packing material was used in this study and no organic carbon source was present in the gas or water flow, the contribution of denitrification to the total nitrogen removal was considered to be minor. In contrast to several studies suggesting that AerAOB were responsible for the total nitrogen removal due to nitrifier denitrification,2,15 the latter pathway could be excluded in this study because no N2O and very low NO emissions (0.5% of N loading) were detected. Also chemical reactions leading to NO or N2O formation could be neglected in this study.12,20 Nitrogen incorporation in the biomass could probably explain for a part the 9−15% nitrogen loss that was measured during the profile measurements but that was based on the stoichiometry not caused by AnAOB activity. The total nitrogen removal to N2 in the top part of the filter (>82 cm) was attributed to AnAOB activity as 85−91% of the nitrogen removal took place at the biofilter zones where ammonium and nitrite consumption was observed (Figure 2) and as the specific activity tests confirmed AnAOB activity in the top part of the filter (Table 3). Moreover, if denitrification had been responsible for the total nitrogen removal, at least 2 kg COD m−3 biofilter d−1 should have been consumed, corresponding with 1.5 g VSS m−3 biofilter d−1, or around 40% of the inoculated biomass organics, allowing no biomass growth in the filter. Data on the microbial community structure in NH3 biofilters are still relatively scarce, compared to other engineered systems such as bioreactors for wastewater treatment. Studies performed on NH3 fed biofilters discuss mainly overall diversity and dynamics21 or focus only on the AerAOB11,22,23 or ammonium oxidizing archaea.22 The anaerobic ammonium oxidation was not considered before in this application domain. Moreover, due to a lack of information about the relation between the community structure and the total nitrogen balance in these biofilters (Table 1), there was no evidence of the presence of Planctomycetes and more specifically AnAOB in NH3 fed biofilters. However, this study showed that AerAOB in close relationship with AnAOB can cause high nitrogen removal rates in gaseous biofilters. Both substrates ammonia and nitrite are commonly present in biofilters due to the high AerAOB activity and lower NOB activity,4 which indicate a niche environment for AnAOB, provided that anoxic conditions are created. As the biofilter was fed under fully aerobic conditions, anoxic zones should have been present to allow AnAOB activity. It could be calculated that anoxic zones could be obtained in the biofilm itself when the thickness of an oxygen-consuming biofilm was higher than 384 μm24 given oxygen saturation in the gas phase over the whole depth of the biofilter. On the other hand, preferential gas and water flow due to a low ratio between the filter diameter and packing diameter (11 < 12) could probably occur allowing oxygen gradients in the filter.25

Due to the high free ammonia concentration and consequently NOB inhibition26 at the top of the biofilters (Table 3), total nitrogen removal by AnAOB was mainly taking place between 7 and 57 cm depth despite the high nitrite levels (around 200 mg NO2−-N L−1). AnAOB can irreversibly be inhibited by nitrite. However the reported inhibition range (100−350 mg N L−1) is broad, and the effect depends on the AnAOB species.27−29 In this study, inhibition of AnAOB was only observed at nitrite levels above 411 mg N L−1 (Table 3), and this effect seemed reversible in case the water flow rate was adjusted. Therefore, the water flow rate relative to the nitrogen gas loading of the system, calculated as the ratio between the water flow rate (m3 m−2 biofilter section d−1) and the nitrogen loading rate (kg N m−2 biofilter section d−1), determined the degree of AnAOB activity over NOB activity in the system as well as the AnAOB over NOB abundance. Water to N ratios lower than 1 L g−1 Nin resulted in both AnAOB and NOB inhibition in the top layers (Figure 2B), while AnAOB were favored above NOB at higher water to N ratios (around 1 L g−1 Nin). In most studies reporting minor total nitrogen removal efficiencies (Table 1), this ratio was high (≫1 L g−1 Nin) decreasing free ammonia concentrations in the filter (higher dilution) and consequently allowing NOB activity. As a result, AnAOB probably did not have a competitive advantage compared to NOB in the top layers and could not significantly invade the filter in contrast to the OLAND biofilter in this study. So, to obtain high nitrogen losses without significant N2O emissions and thus a niche for AnAOB, high nitrogen levels together with low water to N ratios (around 1 L g−1 Nin) are advised. OLAND: Gas versus Water Treatment. OLAND is considered an established technology for the treatment of digestates in several application domains19 as it can provide high and stable performance and decreased operational cost by decreasing the energy consumption and avoiding the addition of external organic carbon.19 Compared to these water applications, the OLAND biofilter for gas treatment could offer an additional advantage. The optimal balance between AerAOB, AnAOB, and NOB activity is more easily obtained without complicated control systems as needed during wastewater treatment. In the latter application, NOB activity is avoided by a combination of DO control, free ammonia levels, and specific SRT control of aerobic flocs,30 which significantly increases the operational complexity. Moreover, the control of the microbial balance becomes more difficult when treating low nitrogen concentration.31 In the OLAND biofilter, the nitrogen gas flow, although containing low NH3 concentrations, is concentrated in the water film on top of the biofilm, allowing more easily NOB inhibition by free ammonia or even free nitrous acid. Therefore, besides saving costs for further percolate treatment, the OLAND biofilter can be stably operated at minimal operational complexity.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +32-9-2645976. Fax: +32-9-2646248. E-mail: Nico. [email protected]. Notes

The authors declare no competing financial interest. 8831



■

Article

(16) Pynaert, K.; Smets, B. F.; Wyffels, S.; Beheydt, D.; Siciliano, S. D.; Verstraete, W. Characterization of an autotrophic nitrogenremoving biofilm from a highly loaded lab-scale rotating biological contactor. Appl. Environ. Microbiol. 2003, 69 (6), 3626−3635. (17) Vlaeminck, S. E.; Geets, J.; Vervaeren, H.; Boon, N.; Verstraete, W. Reactivation of aerobic and anaerobic ammonium oxidizers in OLAND biomass after long-term storage. Appl. Microbiol. Biotechnol. 2007, 74 (6), 1376−1384. (18) Greenberg, A. E.; Clesceri, L. S.; Eaton, A. D. Standard Methods for the Examination of Water and Wastewater; American Public Health Association: Washington, DC, 1992. (19) Vlaeminck, S. E.; De Clippeleir, H.; Verstraete, W. Microbial resource management of one-stage partial nitritation/anammox. Microb. Biotechnol. 2012, 5 (3), 433−488. (20) Vermeiren, J.; Van de Wiele, T.; Van Nieuwenhuyse, G.; Boeckx, P.; Verstraete, W.; Boon, N. Sulfide- and Nitrite- Dependent Nitric Oxide Production in the Intestinal Tract. Microb. Biotechnol. 2012, 5 (3), 379−387. (21) Cabrol, L.; Malhautier, L.; Poly, F.; Lepeuple, A.-S.; Fanlo, J.-L. Assessing the bias linked to DNA recovery from biofiltration woodchips for microbial community investigation by fingerprinting. Appl. Microbiol. Biotechnol. 2010, 85 (3), 779−790. (22) Yasuda, T.; Kuroda, K.; Hanajima, D.; Fukumoto, Y.; Waki, M.; Suzuki, K. Characteristics of the Microbial Community Associated with Ammonia Oxidation in a Full-Scale Rockwool Biofilter Treating Malodors from Livestock Manure Composting. Microbes Environ. 2010, 25 (2), 111−119. (23) Yin, J.; Xu, W. Ammonia biofiltration and community analysis of ammonia-oxidizing bacteria in biofilters. Bioresour. Technol. 2009, 100 (17), 3869−3876. (24) Perez, J.; Picioreanu, C.; van Loosdrecht, M. Modeling biofilm and floc diffusion processes based on analytical solution of reactiondiffusion equations. Water Res. 2005, 39 (7), 1311−1323. (25) Beavers, G. S.; Sparrow, E. M.; Rodenz, D. E., Influence of bed size on the flow characteristics and porosity of randomly packed beds of spheres. Trans. ASME, Ser. E 1973, 40, (3). (26) Anthonisen, A. C.; Loehr, R. C.; Prakasam, T. B. S.; Srinath, E. G. Inhibition of nitrification by ammonia and nitrous acid. J. - Water Pollut. Control Fed. 1976, 48 (5), 835−852. (27) Dapena-Mora, A.; Fernandez, I.; Campos, J. L.; MosqueraCorral, A.; Mendez, R.; Jetten, M. S. M. Evaluation of activity and inhibition effects on Anammox process by batch tests based on the nitrogen gas production. Enzyme Microb. Technol. 2007, 40 (4), 859− 865. (28) Egli, K.; Fanger, U.; Alvarez, P. J. J.; Siegrist, H.; van der Meer, J. R.; Zehnder, A. J. B. Enrichment and characterization of an anammox bacterium from a rotating biological contactor treating ammoniumrich leachate. Arch. Microbiol. 2001, 175 (3), 198−207. (29) Strous, M.; Kuenen, J. G.; Jetten, M. S. M. Key physiology of anaerobic ammonium oxidation. Appl. Environ. Microbiol. 1999, 65 (7), 3248−3250. (30) Joss, A.; Derlon, N.; Cyprien, C.; Burger, S.; Szivak, I.; Traber, J.; Siegrist, H.; Morgenroth, E. Combined Nitritation-Anammox: Advances in Understanding Process Stability. Environ. Sci. Technol. 2011, 45 (22), 9735−9742. (31) De Clippeleir, H.; Yan, X.; Verstraete, W.; Vlaeminck, S. E. OLAND is feasible to treat sewage-like nitrogen concentrations at low hydraulic residence times. Appl. Microbiol. Biotechnol. 2011, 90 (4), 1537−1545. (32) Malhautier, L.; Gracian, C.; Roux, J. C.; Fanlo, J. L.; Le Cloirec, P. Biological treatment process of air loaded with an ammonia and hydrogen sulfide mixture. Chemosphere 2003, 50 (1), 145−153. (33) Moussavi, G.; Khavanin, A.; Sharifi, A. Ammonia removal from a waste air stream using a biotrickling filter packed with polyurethane foam through the SND process. Bioresour. Technol. 2011, 102 (3), 2517−2522. (34) Rotthauwe, J. H.; Witzel, K. P.; Liesack, W. The ammonia monooxygenase structural gene amoA as a functional marker:

ACKNOWLEDGMENTS H.D.C. was a supported by a PhD grant from the Institute for the Promotion of Innovation by Science and Technology in Flanders (IWT-Vlaanderen, number SB-81068). E.C. and S.E.V. were supported as doctoral candidate (Aspirant) and a postdoctoral fellow, respectively, from the Research Foundation Flanders (FWO-Vlaanderen). The authors thank Samuel Bodé for kind assistance with NO analyses and Joachim Desloover, Tom Hennebel, and Frederiek-Maarten Kerckhof for inspiring scientific discussions.

■

REFERENCES

(1) Busca, G.; Pistarino, C. Abatement of ammonia and amines from waste gases: a summary. J. Loss Prev. Process Ind. 2003, 16 (2), 157− 163. (2) Kim, J. H.; Rene, E. R.; Park, H. S. Performance of an immobilized cell biofilter for ammonia removal from contaminated air stream. Chemosphere 2007, 68 (2), 274−280. (3) Chung, Y. C.; Huang, C. P.; Tseng, C. P. Reduction of H2S/NH3 production from pig feces by controlling environmental conditions. J. Environ. Sci. Health, Part A: Environ. Sci. Eng. Toxic Hazard. Subst. Control 1996, 31 (1), 139−155. (4) Baquerizo, G.; Maestre, J. P.; Machado, V. C.; Gamisans, X.; Gabriel, D. Long-term ammonia removal in a coconut fiber-packed biofilter: Analysis of N fractionation and reactor performance under steady-state and transient conditions. Water Res. 2009, 43 (8), 2293− 2301. (5) Cabrol, L. Evaluation de la robustesse d’un système de biofiltration d’effluent de compostage: Approche structurelle et fonctionnelle. University of Montpellier II, 2010. (6) Sakuma, T.; Jinsiriwanit, S.; Hattori, T.; Deshusses, M. A. Removal of ammonia from contaminated air in a biotrickling filter Denitrifying bioreactor combination system. Water Res. 2008, 42 (17), 4507−4513. (7) Kuai, L. P.; Verstraete, W. Ammonium removal by the oxygenlimited autotrophic nitrification-denitrification system. Appl. Environ. Microbiol. 1998, 64 (11), 4500−4506. (8) Joss, A.; Salzgeber, D.; Eugster, J.; Konig, R.; Rottermann, K.; Burger, S.; Fabijan, P.; Leumann, S.; Mohn, J.; Siegrist, H. Full-Scale Nitrogen Removal from Digester Liquid with Partial Nitritation and Anammox in One SBR. Environ. Sci. Technol. 2009, 43 (14), 5301− 5306. (9) Wett, B. Solved upscaling problems for implementing deammonification of rejection water. Water Sci. Technol. 2006, 53 (12), 121−128. (10) Abma, W. R.; Driessen, W.; Haarhuis, R.; van Loosdrecht, M. C. M. Upgrading of sewage treatment plant by sustainable and costeffective separate treatment of industrial wastewater. Water Sci. Technol. 2010, 61 (7), 1715−1722. (11) Juhler, S.; Revsbech, N. P.; Schramm, A.; Herrmann, M.; Ottosen, L. D. M.; Nielsen, L. P. Distribution and Rate of Microbial Processes in an Ammonia-Loaded Air Filter Biofilm. Appl. Environ. Microbiol. 2009, 75 (11), 3705−3713. (12) Chandran, K.; Stein, L. Y.; Klotz, M. G.; van Loosdrecht, M. C. M. Nitrous oxide production by lithotrophic ammonia-oxidizing bacteria and implications for engineered nitrogen-removal systems. Biochem. Soc. Trans. 2011, 39 (6), 1832−1837. (13) Maia, G. D. N.; Day, G. B.; Gates, R. S.; Taraba, J. L. Ammonia biofiltration and nitrous oxide generation during the start-up of gasphase compost biofilters. Atmos. Environ. 2012, 46, 659−664. (14) Smet, E.; Van Langenhove, H.; Maes, K. Abatement of high concentrated ammonia loaded waste gases in compost biofilters. Water, Air, Soil Pollut. 2000, 119 (1−4), 177−190. (15) Chen, Y. X.; Yin, J.; Wang, K. X. Long-term operation of biofilters for biological removal of ammonia. Chemosphere 2005, 58 (8), 1023−1030. 8832



Article

Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 1997, 63 (12), 4704−4712. (35) Tourna, M.; Freitag, T. E.; Nicol, G. W.; Prosser, J. I. Growth, activity and temperature responses of ammonia-oxidizing archaea and bacteria in soil microcosms. Environ. Microbiol. 2008, 10 (5), 1357− 1364. (36) Graham, D. W.; Knapp, C. W.; Van Vleck, E. S.; Bloor, K.; Lane, T. B.; Graham, C. E. Experimental demonstration of chaotic instability in biological nitrification. ISME J. 2007, 1 (5), 385−393. (37) Tsushima, I.; Kindaichi, T.; Okabe, S. Quantification of anaerobic ammonium-oxidizing bacteria in enrichment cultures by real-time PCR. Water Res. 2007, 41 (4), 785−794.

8833


Efficient Total Nitrogen Removal in an Ammonia Gas Biofilter through

Recommend Documents