Endoplasmic Reticulum Protein (ERp) 29 Binds As ... - ACS Publications

Feb 5, 2014 - Bisphenol A (BPA), which is used in polycarbonate and epoxy resins, affects the development or function of the central nervous system...
2 downloads 5 Views 496KB Size
Download PDF
Article pubs.acs.org/crt

Endoplasmic Reticulum Protein (ERp) 29 Binds As Strongly As Protein Disulfide Isomerase (PDI) to Bisphenol A Yuka Miyake, Shoko Hashimoto, Yoshie Sasaki, Tomohiro Kudo, Ami Oguro, and Susumu Imaoka* Research Center for Environmental Bioscience and Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337, Japan ABSTRACT: Bisphenol A (BPA), which is used in polycarbonate and epoxy resins, affects the development or function of the central nervous system. Previously, we isolated a BPA-binding protein from rat brain, identified it as protein disulfide isomerase (PDI), and found that BPA binds to the b′ domain of PDI and inhibits its activity. There are 20 kinds of PDI family proteins in mammalian endoplasmic reticulum. The member proteins each have a different length and domain arrangement. Here we investigated the binding of BPA and T3 to ERp29, ERp57, and ERp72, which each have the b or b′ domain. BPA/T3 binding of ERp57 and that of ERp72 were lower than that of PDI, and BPA did not inhibit the oxidase or reductase activity of these proteins. On the other hand, BPA and T3 bound to ERp29 as strongly as to PDI. The CD spectrum of PDI was changed in the presence of BPA in a dose-dependent manner, while that of ERp29 was not, suggesting that BPA did not affect the conformation of ERp29. We found that PDI suppresses GH expression in rat GH3 cells stimulated by thyroid hormone (T3) overexpression of PDI and that ERp57 reduced the GH level, but overexpression of ERp29 did not change GH expression. These results suggested that affinity to T3 does not involve the reduction of the T3 response. In this study, ERp29 was first identified as a BPA-binding protein but is not involved in the T3 response of GH3 cells.

■

INTRODUCTION Bisphenol A (BPA) is an endocrine-disrupting chemical used in polycarbonate and epoxy resins.1 Recent reports revealed that BPA not only disrupts endogenous hormone function but also affects the development or function of the central nervous system.2,3 Previously, we isolated a BPA-binding protein from a synaptosomal fraction of rat brain and identified it as protein disulfide isomerase (PDI).4 PDI is a protein folding enzyme that catalyzes the oxidation, reduction, and isomerization of disulfide bonds of misfolded or nascent protein. PDI consists of a, b, b′ a′, and c domains where a and a′ contain the active site dithiol sequence CGHC.5 Both b and b′ domains lack the active site motif, and the b′ domain has a hydrophobic region to interact with unfolded or misfolded proteins and is essential for the catalysis of disulfide formation for noncovalent ligand binding.6 PDI is known as a multifunctional protein. In addition to catalyzing disulfide formation, PDI acts as a β-subunit of collagen-prolyl-4-hydroxylase (C-P4H) and microsomal triglyceride transferase (MTP).7,8 Moreover, PDI is also known as a thyroid hormone (T3)-binding protein.9 Previously, we found that BPA binds to PDI and competitively inhibits T3 binding to PDI, and both BPA and T3 inhibit the isomerase activity of PDI.4 We also searched the BPA binding domain of PDI, and found that the a and b′ domains are BPA/T3 binding sites of PDI and that the BPA/T3 binding to the b′ domain is essential for the inhibition of the isomerase activity of PDI.10 Additionally, we investigated PDI’s function in the T3 response of rat pituitary tumor (GH3) cells, which induce the growth hormone (GH) expression depend on T3 concentration, and found that © 2014 American Chemical Society

overepression of PDI reduces T3-induced GH expression and release. Also, BPA affects GH release and the GH level.11 Recently, multiple PDI-like proteins were characterized and PDI family members are considered to have different redox potentials that act sequentially on newly synthesized proteins.12 There are 20 kinds of PDI family proteins in mammalian endoplasmic reticulum. Each member protein has a different length and domain arrangement, and each has at least one domain with a thioredoxin-like structure.12 ERp57 and ERp72 are ubiquitous proteins whose domain structures are similar to that of PDI.13 ERp57 consists of a, b, b′, and a′ domains, and ERp72 consists of c, a0, a, b, b′, and a′ domains. The a and a′ domains of ERp57 and ERp72 also have active sites that contain the CGHC motif. ERp57 is a glycoprotein-specific disulfide isomerase that interacts with lectin-like chaperons, calnexin or calreticulin, to recruit substrates. Therefore, ERp57 does not contain a hydrophobic pocket for noncovalent ligand binding in the b′ domain.14 One of the physiological actions of ERp57 is the processing of MHC class I. ERp57 is involved with the oxidative folding of the MHC class I heavy chain by catalyzing disulfide bond formation and isomerization in vivo.15 ERp72 is also a disulfide isomerase in ER that possesses three thioredoxin homology domains. Known substrates of ERp72 include cholera toxin, matrilin-3, and mutant LDL receptor,16,17 and ERp72 is known as a member of a multichaperone complex18 that regulates the folding of interferon-γ in the endoplasmic reticulum. On the other hand, ERp29 does not contain thiolReceived: September 28, 2013 Published: February 5, 2014 501

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506

Chemical Research in Toxicology

Article

Table 1. Primer Sequences Used in This Study cDNA

a

Primer sequencea

GenBank accession number

PDI

NM_000918

forward: AAGAGCTCGATCCGTGTCCGACATGCTG SacI reverse: ACGGATCCTTGCGTATTACAGTTCATCT BamHI

ERp72

NM_004911

forward: AAGGATCCGCCCCCGCTACCATGAGG BamHI reverse: TTCTGCAGCCGCAGACCTCAGGCCTb PstI

ERp29

BC101495

forward: AAGGATCCGATATGGCTGCCGCTGTGCCCC BamHI reverse: AAGTCGACTTACAGCTCCTCTTTCTCGGCC SalI

Underline, restriction enzyme site; bold and underline, start codon or stop codon. bStop codon is upstream of this primer.

reactive sites.19 The crystal structure of ERp29 has been clarified; it has one thioredoxin-like domain and a dimerization (D) domain that is composed of five α helixes.20 The dimerization of ERp29 is essential for its diverse functions, which includes acting as an escort factor by binding to a secretory protein such as thyroglobulin (Tg) in the ER to facilitate its secretion.21 Here, we clarified the effects of BPA on PDI, ERp57, ERp72, and ERp29, which have a, a′, b, or b′ domain, because BPA binds to a or b′ domain of PDI.10 We investigated the BPA binding affinities of ERp57, ERp72, and ERp29 as well as BPA’s effects on their isomerase activities. Furthermore, we investigated the effects of the PDI, ERp57, and ERp72 expression levels on the T3-induced GH release of GH3 cells.

■

Surface Plasmon Resonance (SPR) Analysis. BPA amine derivative or T3 was immobilized on the CM5 sensor chip by an amine coupling method described previously.4,10 Briefly, a CM5 sensor chip (GE Healthcare, Piscataway, NJ) was activated by the injection of 70 μL of N-hydroxysuccinimide (NHS) and a 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) mixture, creating a reactive ester on the surface, and then 140 μL of 500 μM BPA-amine derivative (resolved in 100 mM borate buffer, pH 9.0) was pulsed. The immobilized chip was masked by 70 μL of ethanolamine. Analyses were performed at 25 °C with the BIAcore 2000 system (BIAcore, Uppsala, Sweden) using HBSEP buffer (10 mM HEPES, pH 7.4, containing 150 mM NaCl, 3 mM ethylenediaminetetraacetic acid, and 0.005% (v/v) Tween 20). Regeneration of the chip surface was achieved by running 5 μL of regeneration buffer (100 mM Tris-HCl containing 6 M guanidine) through the flow cell at 10 μL/min. PDI family proteins were perfused over the chip at a flow rate of 10 μL/min, and the resonance changes were recorded. The sensor gram of the control chip was subtracted from that of the immobilized BPA chip. Data were analyzed by nonlinear curve fitting with BIA evaluation software RNase Oxidative Refolding Assay. RNase refolding assay was performed as described previously.4,10 Briefly, reduced and denatured RNase A (8 μM) was incubated with PDI family protein (1 μM) in 100 mM sodium phosphate buffer, pH 7.5, containing 4.5 mM cytidine 2′,3′cyclic monophosphate (cCMP), 2 mM EDTA, 1 mM GSH, 0.2 mM GSSG, and with or without 100 μM BPA at 25 °C in a final volume of 0.2 mL. The reaction was started by adding reduced and denatured RNase A. Changes in absorbance at 296 nm were monitored with a spectrophotometer, the Multiskan Spectrum instrument (Thermo Labsystems, Boston, MA). Insulin Reduction Assay. Initially, 5 μM of PDI, ERp57, and ERp72 was incubated in 0.1 M potassium phosphate buffer, pH 7.4, containing 0.33 mM DTT and 2 mM EDTA for 5 min at room temperature. The reaction was started by the addition of 130 μM oxidized insulin, and change in absorbance at 650 nm was monitored in the presence or absence of 100 μM BPA. The absorbance was monitored continuously just after addition of insulin. The measurement was continued until 50 min. The linear increase region was used for the calculation of activity. Circular Dichroism Spectroscopy. Circular dichroism (CD) spectra of PDI and Erp29 were obtained with a J-600 spectropolarimeter (Jasco, Tokyo, Japan) as described previously.10 Measurements to detect the secondary structures were performed using 0.5 μM PDI or 1 μM ERp29 at 25 °C; the average of 10 scans from 200 to 250 nm was obtained with a cell path length of 1 cm, scan speed of 20 nm/min, a spectral bandwidth of 1.0 nm, and a time constant of 2 s. Measurements to detect tertiary structures were performed using 40 μM PDI or 80 μM ERp29 at 25 °C; the average of 10 scans from 240 to 310 nm was obtained with a cell path length of 1 cm, a scan speed of 20 nm/min, a spectral bandwidth of 1.0 nm, and a time constant of 2 s. The maximum

MATERIALS AND METHODS

Chemicals. 2,2-Bis(4-hydroxyphenyl) propane (bisphenol A) and other chemicals were purchased from Wako Pure Chemical Industries (Osaka, Japan). 3,3′,5-Triiodo-L-thyronine (T3), ribonuclease A (RNaseA) type III from bovine pancreas, cytidine 2′,3′-cyclic monophosphate (cCMP), and insulin were purchased from SigmaAldrich (St. Louis, MO). T3 was dissolved in 0.1 M NaOH at 10 mM to make stock solutions and was stored at −20 °C. Appropriate vehicle controls were performed in all experiments. Isolation of Human PDI, ERp57, ERp72, and ERp29 cDNAs. Total RNA was extracted from Hep3B cells with Isogen. Human ERp57 cDNA was isolated previously.22 Table 1 shows the primers used for human PDI, ERp72, and ERp29 designed from DNA sequences and their GenBank accession numbers. The full-length of PDI (198th to 1724th nucleotide of mRNA sequence in the GenBank accession number shown in Table 1) was used in this study. The cDNAs were amplified with DNA polymerase. KOD plus: denaturation at 94 °C for 2 min, followed by 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 68 °C for 1 min. The amplified cDNAs of PDI, ERp72, and ERp29 were cut with SacI and BamHI, BamHI and PstI, and BamHI and SalI, respectively, then ligated into a pBluescript II(SK+) vector (Stratagene, La Jolla, CA). For the expression of proteins in Escherichia coli, cDNAs were subcloned into pQE vectors (Qiagen, Valencia, CA), and they were expressed described previously.10 The purification of human PDI, ERp57, ERp72, and ERp29 expressed in E. coli was done by the method described previously.4 The antibodies against human PDI, ERp57, ERp72, and ERp29 were prepared as described previously.4 All experiments were conducted in accordance with guidelines on the welfare of experimental animals and with the approval of the Ethics Committee on the use of animals of Kwansei Gakuin University. For the overexpression of proteins in GH3 cells, the cDNAs were subcloned into pcDNA (Invitrogen, Carlsbad, CA) and overexpression was performed by a method described previously.23 502

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506

Chemical Research in Toxicology

Article

voltage was below 1000 V. BPA was dissolved in ethanol at the concentration of 50 or 10 mM in the stock solution. In the CD measurement, a final concentration of ethanol was 0.1% when addition of BPA and the same amount of ethanol was added to the control sample. Cell Culture. The rat pituitary tumor (GH3) cell line was obtained from the Health Science Research Resources Bank (cell no. JCRB9047, Osaka, Japan). GH3 cells were maintained in Ham’s F-10 containing 15% horse serum, 2.5% FBS, and 1% penicillin and streptomycin at 37 °C in 5% CO2. Treatment of GH3 Cells with T3. The T3 deletion (Td) medium was prepared as described previously.11 The pcDNA vector containing each cDNA was transfected into GH3 cells using HilyMax (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s protocol. After 24 h, the medium was changed to Td medium. After 24 h, GH3 cells were incubated for a further 24 h in the presence or absence of 10 nM T3. Overexpression of PDI family proteins were detected by Western blotting with anti-PDI, ERp57, ERp72, and ERp29 antibodies. Reverse Transcriptase-PCR. Total RNA extraction from GH3 cells was performed as described above. Polymerase chain reaction (PCR) was performed using a reaction mixture containing Green Go Taq Flexi Buffer (Promega, Madison, WI, USA), 10 pmol of each primer, and 100 ng cDNA according to the following protocol: 10 min at 95 °C and then x cycles of 30 s at 95 °C, 30 s at 57 °C, and 30 s at 72 °C. Primers for rat β-actin were 5′-CTACAATGAGCTGCGTGTGG-3′ (sense) and 5′TGAGGTAGTCTGTCAGGTCC-3′ (antisense). Primers for rat growth hormone (GH) were 5′-CTGCTGACACCTACAAAGA-3′ (sense) and 5′-CAGTGTGTGCCTAGAAAGCA-3′ (antisense). PCR protocol was conducted in 22 cycles (for GH) and 19 cycles (for βactin).

and off-rate constants (ka and kd) of PDI and ERp29 for bindings to BPA and T3 were shown in Table 2. ERp29 bound to BPA or T3 as strongly as PDI. We first clarified that ERp29 is also a BPAbinding protein. Table 2. The On- and Off-Rate Constants (ka and kd) of PDI and ERp29 for Bindings to BPA and T3 ERp29 PDI

ligand

ka (l/Ms)

kd (l/s)

KD (M)

BPA T3 BPA T3

1.44 × 103 5.95 × 103 1.22 × 103 3.85 × 103

1.54 × 10−3 8.98 × 10−4 7.35 × 10−3 1.06 × 10−3

1.07 × 10−6 1.51 × 10−7 6.01 × 10−6 2.75 × 10−7

BPA’s Effect on Isomerase Activities of PDI, ERp57, ERp72, and ERp29. We previously found that BPA inhibited the oxidative folding activity of PDI.4 In the present study, we investigated whether BPA also inhibited the oxidative folding activities of PDI family proteins. RNase refolding assays were performed using PDI, ERp57, ERp72, and ERp29 in the presence or absence of BPA (Figure 2). The oxidative folding activity of

■

RESULTS Binding of BPA or T3 to PDI, ERp57, ERp72, and ERp29. Previously, we isolated PDI as a BPA-binding protein from the rat brain and found that thyroid hormone, T3, bound to the common site of PDI with BPA.4 Furthermore, BPA bound to the b′ domain, the substrate binding domain of PDI, and inhibited isomerase activity.10 In the present study, we used the human PDI family proteins having the b or b′ domain to assess BPA/T3 binding to PDI family proteins. We investigated the binding of BPA or T3 to recombinant PDI, ERp57, ERp72, and ERp29 by surface plasmon resonance (SPR) spectroscopy (Figure 1). BPA binding to ERp57 and ERp72 was very low, although the domain structures of ERp57 and ERp72 were similar to that of PDI.24 In the T3 binding of these proteins, ERp57 and ERp72 both showed low levels of binding compared with PDI and ERp29. The on-

Figure 2. RNase oxidation activity and insulin reduction activity of PDI family proteins. (A) Oxidation assays with reduced RNase A were performed using PDI, ERp57, ERp72, and ERp29 in the presence or absence of 100 μM BPA. The activities were calculated from the increase in absorbance at 296 nm per min. (B) Insulin reduction assays were performed using PDI, ERp57, ERp72, and ERp29 in the presence or absence of 100 μM BPA. The activities were calculated from the increase of absorbance at 650 nm per min. Each activity was expressed as a relative percentage when the value of PDI activity was set at 100%. Values are the mean ± SD of three replicates. *p < 0.01, significantly different from the activity in the absence of BPA. ND, not detected.

PDI, ERp57, and ERp72, which have the a or a′ domain, was detected, while that of ERp29, which does not have a domain, was not detected. Our examination of BPA’s inhibitory effect revealed that, in the presence of BPA, PDI activity was significantly inhibited but that of ERp57 and that of ERp72 were not inhibited. We also used an insulin reduction assay (Figure 2B). As a result, BPA inhibited only PDI activity, similar to the result of the RNase refolding assay. These results indicate that BPA specifically inhibits PDI’s isomerase activity and that significant BPA binding like PDI was required in order to inhibit isomerase activity. Circular Dichroism of PDI and ERp29. To investigate how BPA binding induces conformational change in PDI or ERp29, we measured the circular dichroism spectra of PDI and ERp29 in the presence of BPA (Figure 3). Far-UV spectra signals around 200−250 nm reflect the α-helix and β-strand spectra. BPA did not change the spectra of far-UV spectra signals, suggesting that BPA did not affect the secondary structure of PDI as described

Figure 1. Interaction of BPA and T3 with PDI, ERp57, ERp72, and ERp29 by surface plasmon resonance spectroscopy. BPA-amine derivative (A) or T3 (B) were immobilized on a sensor chip (CM5), and 10 μM of PDI, ERp57, ERp72, and ERp29 was pulsed at a cell flow rate of 10 μL/min. Each sensor gram shows the resonance unit (RU) from which was subtracted the RU of the control sensor chip. The association of proteins with BPA/T3 was detected in 0−120 s, and dissociation was detected after 120 s. 503

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506

Chemical Research in Toxicology

Article

Figure 3. Circular dichroism (CD) spectra of PDI and ERp29. (A,C) Circular dichroism spectra of PDI (A) and ERp29 (C) were measured from 240 to 310 nm. Measurements were performed using 40 μM PDI or 80 μM ERp29 at 25 °C. (B,D) Circular dichroism spectra of PDI (B) and ERp29 (D) were measured from 200 to 250 nm. Measurements were performed using 0.5 μM PDI or 1 μM ERp29 at 25 °C. Values (average of 10 scans) were converted to the mean molar ellipticity per residue (θ).

previously.10 Near-UV spectra signals around 260−300 nm were attributable to aromatic residues tyrosine and tryptophan. As a result, the PDI spectra around 285 nm changed in the presence of BPA in a dose-dependent manner, suggesting that BPA affected the 3D structure of PDI. BPA may compete for binding to the b′ domain of PDI with the 347th tryptophan residue of x-linker.10,25 On the other hand, BPA affected neither the near- nor far-UV spectra of ERp29. These results indicate that BPA does not change the conformation of ERp29 even though the binding is stronger than that of PDI. Induction of GH in GH3 Overexpressing PDI Family Proteins by T3. Previously we found that overexpression of PDI in GH3 cells reduced the GH induction by T3.11 We investigated the effects of the overexpression of ERp57, ERp72, and ERp29 on the GH expression of GH3 cells by stimulation of T3 (Figure 4). First, we confirmed that overexpression of human PDI in GH3 cells also reduces the GH mRNA induced by T3 because GH3 cells are derived from rats and we used rat PDI in the previous study.11 We used antibodies against human PDI, ERp57, ERp72, and ERp29, which can recognize rat homologues. The overexpression of human PDI, ERp57, ERp72, and ERp29 were successfully detected by these antibodies although the human PDI, ERp57, ERp72, and ERp29 were detected at the different mobility from those of rat homologues on SDSpolyacrylamide gel electrophoresis. The overexpression of ERp57 reduced the GH mRNA, but that of ERp72 and that of ERp29 did not change the GH mRNA. These results indicated that ERp57 has similar functions as PDI in T3 response and that affinity with T3 is not involved with the function of reducing GH induction.

Figure 4. GH mRNA expression of GH3 cells overexpressing PDI family proteins. (A) Confirmation of overexpression of PDI family proteins in GH3 cells. Total cellular proteins from pcDNA-transfected GH3 cells (mock) or GH3 cells overexpressing PDI, ERp57, ERp72, and ERp29 were isolated and immunoblotting was performed using antibodies against human PDI, ERp57, ERp72, and ERp29, which can recognize rat homologues. The overexpression of human PDI, ERp57, ERp72, and ERp29 were successfully detected by these antibodies although the human PDI, ERp57, ERp72, and ERp29 were detected at the different mobility from those of rat homologues on SDSpolyacrylamide gel electrophoresis. Specific antibodies against PDI, ERp57, ERp72, ERp29, or β-actin; β-actin was used as a loading control. (B) Expression of GH mRNA in GH3 cells overexpressing PDI, ERp57, ERp72, or ERp29. Control pcDNA-transfected GH3 cells (mock) or GH3 cells transfected by pcDNA including PDI, ERp57, ERp72, or ERp29 cDNA were cultured for 24 h in the presence of 10 nM T3. Total RNA was isolated from cells in three different culture plates, and qRTPCR was performed. Control GH mRNA levels of mock cells without T3 were set at 1.0. Values are expressed as the mean ± SD for three replicates. **p < 0.01, significantly different from mock.

DISCUSSION This study elucidates for the first time that ERp29 is a BPA/T3binding protein. ERp29 consists of a b domain and a D domain

(C-terminal half).20 The b domain of ERp29 was sufficient for peptide binding. As a natural substrate, thyroglobulin, which is precursor of T4 and T3, was found, and ERp29 was essential for

■

504

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506

Chemical Research in Toxicology

■

the post-translational processing or secretion of thyroglobulin.26 Rainey-Barger et al.21 screened the binding peptide to ERp29 and found that ERp29 binds peptides with two or more aromatic residues. Because BPA and T3 have phenol structures, BPA and T3 are considered to bind to the b domain of ERp29 via those structures. The isolated b′ domain of PDI can bind to BPA, and the His residue in the b′ domain played an important role in the binding.10 However, BPA could not bind to the isolated b domain of ERp29 (data not shown). The BPA favors amino acid residues outside of the b domain, and it may require basic amino acid residue because phenol groups are acidic and required basic His in PDI.10 The near-UV CD spectrum of PDI is affected by BPA in a dose-dependent manner, suggesting that BPA affected the PDI 3D conformation. We previously found that BPA affects the tryptophan fluorescence of the b′x fragment (b′ domain and x linker).10 The x linker is known to provide flexibility to the PDI structure. Therefore, BPA is considered to affect the flexibility of the x linker. On the other hand, the structure of ERp29 is smaller than that of PDI and ERp29 does not have a flexible linker such as the x linker. Therefore, the effects of BPA on the CD spectrum of ERp29 would be very small. ERp57 and ERp72 have low BPA-binding capacities, although the domain structure of ERp57 and ERp72 are similar to that of PDI.24 Previously, we found that BPA binds to the b′ domain of PDI and considered that BPA binds to a substrate-binding site, which forms hydrophobic pocket, in the b′ domain.10 However, ERp57 lacks a protein substrate-binding site in its b′ domain because ERp57 recognizes substrates with a partner protein, either calnexin (CNX) or calreticulin (CRT), either of which recruits glycoprotein substrates through a lectin domain.14,27 Therefore, we considered that ERp57 does not have a BPAbinding site in the b′ domain. ERp72 is also considered to have only low BPA-binding affinity for the same reason as with ERp57. ERp72 could not bind to CNX or CRT, but it does not have a hydrophobic pocket in the b′ domain.28 Therefore, ERp72 is considered to act with other partner proteins. Our previous study suggested that the BPA-binding domain of PDI was not only a b′ domain but also an a domain.10 There are estrogen-receptor like sequences in the a domain of PDI.9 Estrogen could competitively bind to PDI with BPA and T3.4 ERp57 and ERp72 each have an a domain; however, there are no estrogen-receptor-like sequences in the a domains of ERp57 and ERp72. In the catalytically active proteins, BPA affected only the isomerase activity of PDI, suggesting that significant BPA binding is required for an inhibitory effect. In the experiment using GH3 cells, overexpression of PDI and ERp57 reduced the GH induction by T3. Overexpression of ERp29 did not change the GH induction, although ERp29 had high T3-binding affinity. On the other hand, ERp57 has only low T3-binding affinity. Therefore, we considered that T3-binding affinity is not required for the reduction of GH, but isomerase activity is required for the reduction of GH. T3 induces GH via TR and other cofactors. PDI and ERp57 are considered to facilitate the formation or cleavage of the disulfide bonds of factors that are involved with GH induction in GH3 cells. In this study, we found for the first time that ERp29 has binding activity with small molecules. If the physiological significance of this finding is clarified, we will be able to learn a new aspect of the function of ERp29.

Article

AUTHOR INFORMATION

Corresponding Author

*Phone/Fax: +81-79-565-7673. E-mail: [email protected]. Funding

This study was partially supported by a Grant-in-Aid for Scientific Research (B) from the Japan Society for the Promotion of Science, by a Grant-in Aid from Hyogo Science and Technology Association, and by the Support Project to Assist Private Universities in Developing Bases for Research by the Ministry of Education, Culture, Sports, Science, and Technology of Japan. This study was also partially supported by a Grant-inAid from Kwansei Gakuin University. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Professor Shinichi Segawa (Kwansei Gakuin University) and Professor Hiroshi Yamaguchi (Kwansei Gakuin University) for their valuable discussions.

■

ABBREVIATIONS USED

■

REFERENCES

BPA, bisphenol A (2,2-bis(4-hydroxyphenyl)-propane; PDI, protein disulfide isomerase; ERp57, endoplasmic reticulum protein 57; ERp72, endoplasmic reticulum protein 72; ERp29, endoplasmic reticulum protein 29; T3, 3,3′,5-triiodo-L-thyronine; E2, 17β-estradiol; RNase A, ribonuclease A; ERRγ, estrogen-related receptor gamma; PDIp, pancreas-specific protein disulfide isomerase; SPR, surface plasmon resonance; CD, circular dichroism

(1) Krishnan, A. V., Stathis, P., Permuth, S. F., Tokes, L., and Feldman, D. (1993) Bisphenol-A: an estrogenic substance is released from polycarbonate flasks during autoclaving. Endocrinology 132, 2279−2286. (2) Obata, T., and Kubota, S. (2000) Formation of hydroxy radicals by environmental estrogen-like chemicals in rat striatum. Neurosci. Lett. 296, 41−44. (3) Suzuki, T., Mizuo, K., Nakazawa, H., Funae, Y., Fushiki, S., Fukushima, S., Shirai, T., and Narita, M. (2003) Prenatal and neonatal exposure to bisphenol-A enhances the central dopamine D1 receptormediated action in mice: enhancement of the methamphetamineinduced abuse state. Neuroscience 117, 639−644. (4) Hiroi, T., Okada, K., Imaoka, S., Osada, M., and Funae, Y. (2006) Bisphenol A binds to protein disulfide isomerase and inhibits its enzymatic and hormone-binding activities. Endocrinology 147, 2773− 2780. (5) Darby, N. J., and Creighton, T. E. (1995) Characterization of the active site cysteine residues of the thioredoxin-like domains of protein disulfide isomerase. Biochemistry (Moscow) 34, 16770−16780. (6) Klappa, P., Ruddock, L. W., Darby, N. J., and Freedman, R. B. (1998) The b′ domain provides the principal peptide-binding site of protein disulfide isomerase but all domains contribute to binding of misfolded proteins. EMBO J. 17, 927−935. (7) Wetterau, J. R., Combs, K. A., Spinner, S. N., and Joiner, B. J. (1990) Protein disulfide isomerase is a component of the microsomal triglyceride transfer protein complex. J. Biol. Chem. 265, 9800−9807. (8) Kivirikko, K. I., Myllyla, R., and Pihlajaniemi, T. (1989) Protein hydroxylation: prolyl 4-hydroxylase, an enzyme with four cosubstrates and a multifunctional subunit. FASEB J. 3, 1609−1617. (9) Obata, T., Kitagawa, S., Gong, Q. H., Pastan, I., and Cheng, S. Y. (1988) Thyroid hormone down-regulates p55, a thyroid hormonebinding protein that is homologous to protein disulfide isomerase and the beta-subunit of prolyl-4-hydroxylase. J. Biol. Chem. 263, 782−785. 505

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506

Chemical Research in Toxicology

Article

(10) Hashimoto, S., Shiomoto, K., Okada, K., and Imaoka, S. (2012) The binding site of bisphenol A to protein disulphide isomerase. J. Biochem. 151, 35−45. (11) Okada, K., Imaoka, S., Hashimoto, S., Hiroi, T., and Funae, Y. (2007) Over-expression of protein disulfide isomerase reduces the release of growth hormone induced by bisphenol A and/or T3. Mol. Cell. Endocrinol. 278, 44−51. (12) Kozlov, G., Maattanen, P., Thomas, D. Y., and Gehring, K. (2010) A structural overview of the PDI family of proteins. FEBS J. 277, 3924− 3936. (13) Maattanen, P., Kozlov, G., Gehring, K., and Thomas, D. Y. (2006) ERp57 and PDI: multifunctional protein disulfide isomerases with similar domain architectures but differing substrate-partner associations. Biochem. Cell Biol. 84, 881−889. (14) Kozlov, G., Maattanen, P., Schrag, J. D., Pollock, S., Cygler, M., Nagar, B., Thomas, D. Y., and Gehring, K. (2006) Crystal structure of the bb′ domains of the protein disulfide isomerase ERp57. Structure 14, 1331−1339. (15) Zhang, Y., Baig, E., and Williams, D. B. (2006) Functions of ERp57 in the folding and assembly of major histocompatibility complex class I molecules. J. Biol. Chem. 281, 14622−14631. (16) Forster, M. L., Mahn, J. J., and Tsai, B. (2009) Generating an unfoldase from thioredoxin-like domains. J. Biol. Chem. 284, 13045− 13056. (17) Cotterill, S. L., Jackson, G. C., Leighton, M. P., Wagener, R., Makitie, O., Cole, W. G., and Briggs, M. D. (2005) Multiple epiphyseal dysplasia mutations in MATN3 cause misfolding of the A-domain and prevent secretion of mutant matrilin-3. Hum. Mutat. 26, 557−565. (18) Meunier, L., Usherwood, Y. K., Chung, K. T., and Hendershot, L. M. (2002) A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol. Biol. Cell 13, 4456−4469. (19) Demmer, J., Zhou, C., and Hubbard, M. J. (1997) Molecular cloning of ERp29, a novel and widely expressed resident of the endoplasmic reticulum. FEBS Lett. 402, 145−150. (20) Barak, N. N., Neumann, P., Sevvana, M., Schutkowski, M., Naumann, K., Malesevic, M., Reichardt, H., Fischer, G., Stubbs, M. T., and Ferrari, D. M. (2009) Crystal structure and functional analysis of the protein disulfide isomerase-related protein ERp29. J. Mol. Biol. 385, 1630−1642. (21) Rainey-Barger, E. K., Mkrtchian, S., and Tsai, B. (2007) Dimerization of ERp29, a PDI-like protein, is essential for its diverse functions. Mol. Biol. Cell 18, 1253−1260. (22) Komurasaki, R., Imaoka, S., Tada, N., Okada, K., Nishiguchi, S., and Funae, Y. (2010) LKM-1 sera from autoimmune hepatitis patients that recognize ERp57, carboxylesterase 1 and CYP2D6. Drug Metab. Pharmacokinet. 25, 84−92. (23) Hashimoto, S., and Imaoka, S. (2013) Protein-disulfide isomerase regulates the thyroid hormone receptor-mediated gene expression via redox factor-1 through thiol reduction−oxidation. J. Biol. Chem. 288, 1706−1716. (24) Imaoka, S. (2011) Chemical stress on protein disulfide isomerases and inhibition of their functions. Int. Rev. Cell. Mol. Biol. 290, 121−166. (25) Wang, C., Chen, S., Wang, X., Wang, L., Wallis, A. K., Freedman, R. B., and Wang, C. C. (2010) Plasticity of human protein disulfide isomerase: evidence for mobility around the X-linker region and its functional significance. J. Biol. Chem. 285, 26788−26797. (26) Baryshev, M., Sargsyan, E., and Mkrtchian, S. (2006) ERp29 is an essential endoplasmic reticulum factor regulating secretion of thyroglobulin. Biochem. Biophys. Res. Commun. 340, 617−624. (27) Zapun, A., Darby, N. J., Tessier, D. C., Michalak, M., Bergeron, J. J., and Thomas, D. Y. (1998) Enhanced catalysis of ribonuclease B folding by the interaction of calnexin or calreticulin with ERp57. J. Biol. Chem. 273, 6009−6012. (28) Kozlov, G., Maattanen, P., Schrag, J. D., Hura, G. L., Gabrielli, L., Cygler, M., Thomas, D. Y., and Gehring, K. (2009) Structure of the noncatalytic domains and global fold of the protein disulfide isomerase ERp72. Structure 17, 651−659.

506

dx.doi.org/10.1021/tx400357q | Chem. Res. Toxicol. 2014, 27, 501−506