Enhancing Corrosion Resistance, Osteoinduction and Antibacterial

Subscriber access provided by University of Sunderland

Tissue Engineering and Regenerative Medicine

Enhancing Corrosion Resistance, Osteoinduction and Antibacterial Properties by Zn/Sr Additional Surface Modification of Magnesium Alloy Guangzheng Yang, Huawei Yang, Lei Shi, Taolei Wang, Wuchao Zhou, Tian Zhou, Wei Han, Zhiyuan Zhang, Wei Lu, and Jingzhou Hu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b00781 • Publication Date (Web): 18 Oct 2018 Downloaded from http://pubs.acs.org on October 18, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Enhancing Corrosion Resistance, Osteoinduction and Antibacterial Properties by Zn/Sr Additional Surface Modification of Magnesium Alloy Guangzheng Yanga,#, Huawei Yangb,#, Lei Shic,#, Taolei Wangd, Wuchao Zhoue, Tian Zhouf, Wei Hang, Zhiyuan Zhangf, Wei Lud*, Jingzhou Huf** a. Department of Prosthodontics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory of Stomatology, Shanghai 200011, China b. Department of Stomatology, Shanghai Tenth People’s Hospital, Tongji University, Shanghai 200072, China c. Department of Oral and Maxillofacial Surgery, Gansu Provincial Hospital, Lanzhou 730000, China d. School of Materials Science and Engineering，Tongji University，Shanghai 201804，China e. Department of Oral and Maxillofacial Surgery, The Affiliated Stomatological Hospital of Nanchang University, Nanchang 330006, China f. Department of Oral & Maxillofacial-Head & Neck Oncology, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory of Stomatology, Shanghai 200011, China g. Department of Oral and Maxillofacial Surgery, Nanjing Stomatological Hospital, Medical School of Nanjing University, Nanjing 210008, China

Corresponding Authors **e-mail: [email protected] *e-mail: [email protected]

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: To control the degradation of magnesium alloy and enhance its osteoinduction activity and antibacterial properties, we proposed the addition of Zn and Sr ions in the process of surface modification of the magnesium alloy (ZK60) by a one-pot hydrothermal process. We found that after surface modification, the surface of the materials formed a cluster crystal-structure coating layer, while the successful incorporation of Zn and Sr ions in the surface coating did not affect the morphology of the microstructure. The corrosion resistance of the surface of the modified magnesium alloy was significantly improved, and cells grew well on the modified material surfaces. Zn and Sr ions released from the coating layer promote cell osteogenic differentiation, and Zn ions also provide a good antibacterial effect. Thus, the combined use of Zn and Sr offers antibacterial effects and promotes osteogenic differentiation of cells. To summarize, we have developed a controllable and degradable magnesium alloy material that offers both osteoinduction and antibacterial effects. The development of this material provides ideas about the preparation of a novel biodegradable magnesium alloy with better bioactivity for clinical application.

Key words: magnesium alloy; surface modification; corrosion; antibacterial; osteogenic


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Osteogenic activity deficiency and infection are two main reasons for the poor healing of bone1-2. It is often necessary to implant fixed material to assist in the healing process of a bone fracture or defect. Traditional metallic materials, such as stainless steel and titanium alloy, lack osteoinduction properties3. This means that the material can neither promote bone formation on its surface nor induce resident stem cells to differentiate into osteoblasts. Additionally, implant-associated bacterial infection is one of the most serious complications in orthopedic surgery2, and these infections are sometimes difficult to treat with external antibacterial agents. Further, secondary operations are often required to remove these undegradable implanted devices when the damaged tissue is healed; these operations are bound to cause additional trauma and economic burden for the patients4. Therefore, the development of new biodegradable biomaterials with good osteoinduction and antibacterial properties has become an important issue. Magnesium alloy easily degrades in the liquid environment, and its mechanical strength is comparable to that of bone at the initial degradation stage; thus, the stress shielding effect can be effectively avoided5-6. Degraded product magnesium ions are also necessary for the growth of human tissues7, so biodegradable magnesium alloy material has received considerable attention as a temporary auxiliary repair material. However, the degradation rate of magnesium alloy is too rapid in the humoral environment. Moreover, the formation



of H2 during degradation is harmful to the growth and healing of the surrounding tissue8-9. Therefore, it is necessary to control the degradation rate of magnesium alloys. Currently, the most effective way to control the degradation rate of magnesium alloy and enhance the bioactivity of the surface of the material is surface modification to form a protective layer on the surface of magnesium alloy4. The protective layer can maintain the integrity of the mechanical properties of the material during the initial healing of the tissue. Additionally, numerous studies have confirmed that active ion components play an important role in the process of bone formation, development and repair, and some metal ions can act as antibacterial agents10. Thus, it is quite effective to add these ionic components to the material’s protective layer. According to previous reports, Zn ions provide a good antibacterial effect11 and play a role in promoting osteogenesis12, while Sr ions have good osteogenic properties13-14. Thus, our aim was to develop a surface modification that combined the advantages of these two metallic elements. A one-pot hydrothermal process is a relative simple method to form a protective coating to control the rapid degradation and maintain the stability of the implantation materials. Meanwhile, bioactive ions were applied to inhibit bacteria, promote osteogenic differentiation and achieve an optimal osteogenesis microenvironment in the initial implantation stage. In summary, to control the degradation rate of magnesium alloy materials, we prepared a protecting layer containing Zn and Sr ions on a magnesium alloy by the one-pot


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hydrothermal method. Corrosion resistance, osteoinduction and antibacterial activity of the new coating were investigated.

2. EXPERIMENTAL SECTION 2.1 Specimen fabrication and modification The ZK60 alloy substrates were cut into square size of 10×10×2mm, then polished with SiC papers of up to 2000 grit, ultrasonically cleaned in ethanol and dried in air. For the preparation of the coatings, an aqueous solution containing 0.05 M Ca(NO3)2·4H2O and 0.03 M NaH2PO4·2H2O was prepared by dissolving analytical grade reagents Ca(NO3)2·4H2O and NaH2PO4·2H2O in deionized water at room temperature. To dope the Zn and Sr ions in the coatings, 0.002 M Zn(NO3)2·6H2O and 0.005 M Sr(NO3)2 (the detail composition of hydrothermal reaction solution can be seen in Table 1), with analytical grade are dissolved in the above aqueous solutions. Next, the pH value of the solution was adjusted to 5 with HCl solution (3 mol/L). All the reagents mentioned above were purchased from Sinopharm Chemical Reagent Co. Ltd. The 50 mL volume stainless-steel autoclave with a Teflon liner was used. Subsequently, one piece of cut ZK60 substrates with 38 mL hydrothermal reaction solution were placed in the autoclave, heated to 140 °C by an oven, and then kept at this temperature for 2 h. The obtained samples were taken out and rinsed with deionized water for three times rapidly and then dried in nitrogen flow. Samples were applied to biological experiments after UV disinfection.



Page 6 of 34

Table1 Composition of hydrothermal reaction solution. Sample

Ca(NO3)2·4H2O

NaH2PO4·2H2O

Zn(NO3)2·6H2O

Sr(NO3)2

Undoped

0.05 M

0.03 M

-

-

Zn

0.05 M

0.03 M

0.002 M

-

Sr

0.05 M

0.03 M

-

0.005 M

Zn+Sr

0.05 M

0.03 M

0.002 M

0.005 M

2.2 Material characterization The coating surface and structure were observed using scanning electron microscopy (SEM, JEOL JAM-6700F, Japan) and Transmission electron microscope (TEM，Hitachi H-800, Japan). X-ray diffraction (XRD) (D/max 2500PC, Rigaku, Tokyo, Japan) was employed for characterizing the crystal phase of coating. Coating chemical composition was analyzed using energy-dispersive X-ray spectrometry (EDS, EPMA, JAX-8100, Japan). 2.3 Inmersion test The samples were immersed in 1 mL of simulated body fluid (SBF, PH=7.4) at 37 ºC in a shaking incubator for 1, 3, 7days. The concentration of Mg, Zn, Sr ions were determined by inductively coupled plasma atomic emission spectrometry (ICP-AES) (Agilent 725ES, USA). The pH value of inmersed solution was detected with a pH meter.

2.4 Electrochemical analysis


Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The in vitro corrosion behavior of the samples in SBF was evaluated in a three-electrode system (CHI660D electrochemical workstation, Shanghai, China). The working electrode was used for the samples, a platinum mesh was used as a counter electrode and Ag/AgCl was used as a reference electrode. The polarization curves were measured with a scanning rate of 1 mV/s.

2.5 In vivo animal study All animals used in this study were provided by the Ninth People's Hospital Animal Centre (Shanghai, China). The animal related experiments were conducted with the protocols approved by the Animal Care and Experiment Committee of Ninth People’s Hospital. C57BL/6 mice were randomly divided into 5 groups and the sterilized materials were implanted subcutaneously. The mice were sacrificed at the third day, and the implanted materials with skin were harvested. After being fixed, dehydrated and embedded in polymethylmethacrylate (PMMA), all samples were sectioned using a Leica SP1600 observed microtome (Leica, Hamburg, Germany) and observed after stained with Stevenol blue and Picrofuchsin staining. 2.6 Bone Marrow Stromal Cells (BMSCs) culture Four-week-old male SPF grade SD rats were sacrificed by neck dislocation. Bone marrow was obtained by rinsing the bone marrow cavity with DMEM medium after cutting off the epiphysis at both ends of the femur or tibia bone. The collected bone marrow washing fluid was centrifuged at 1800 rpm for 10 minutes. The cell suspension was seeded into a culture



dish, and the culture conditions were 37 ℃ and 5% CO2. Passage 2 to passage 4 of the BMSCs were used in this study. 2.7 Cell viability assay BMSCs were seeded at a density of 5×105 cells per well on different samples in 12-well plates. 24 hours later, the Calcein-AM/PI Double Stain Kit (yeasen, China) was applied to detect the cells viability. The cells were incubated in the 2 μM Calcein-AM and 2 μM PI solution （ final concentration ） for 30 min at 37 ℃. The cells were observed and photographed under a fluorescence microscope. The experiment was done in triplicate. 2.8 Alkaline phosphatase (ALP) staining and activity After seeding BMSCs at a density of 5×105 cells per well were incubated on different samples in 12-well plates. Cells on the materials were fixed and stained by BCIP/NBT Alkaline Phosphatase Color Development Kit (Beyotime, China) according to the manufacturer’s protocol. Then photographed by a scanner. For the quantitative ALP activity assay, the cell lysates were incubated with p-nitrophenyl phosphate (p-NPP, Sigma) at 37 °C for 30 min, and the optical density (OD) values were detected at 405 nm. Total protein content was assessed using a Pierce BCA Protein Assay Kit (Thermo Scientific, USA) according to the manufacturer’s protocol. The ALP activity is presented as OD values per milligram of total proteins. All experiments were performed in triplicate. 2.9 Immunofluorescent staining


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BMSCs were seeded at a density of 5×105 cells per well on different samples in 12-well plates. Then cells were fixed with paraformaldehyde at the 1st day to detect the cell spreading and at the 7th day to detect the expression of OCN. β-actin was stained with TRITC-phalloidin (yeasen, China,1:200 dilution) for 20 min. OCN antibody (proteintech, USA) was with dilution ratio of 1:200 carried out at 4 ℃ overnight; then stained by Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa fluor 594 (Invitrogen). The nuclei were stained with DAPI (sigma, USA,1 ug/mL) in 5 minutes. The cells were observed and photographed under a fluorescence microscope. 2.10 Preparation of ionic products from coating alloys The extract solution was prepared according to the International Standard Organization (ISO/EN10993-12). Briefly, the surface modificated samples were immersed in Dulbecco's modified Eagle medium (DMEM, Gibco, Grand Island, NY, USA) at a ratio of the surface area to the volume of the extraction medium of 3 cm2/mL and maintained at 37 °C for 24 h. The obtained extracts were 10x diluted with the DMEM for further use. 2.11 RNA isolation and gene expression by quantitative real-time PCR (qRT-PCR) analysis BMSCs at a density of 5×105 cells per well were incubated in the environment of the extract solutions in 12-well plates, and the total RNA was extracted with TRIzol reagent (Invitrogen) at 7th day. The cDNA was generated using a PrimeScript first Strand cDNA Synthesis kit (Takara, Japan) according to the manufacturer’s protocol. The expression of



the osteogenic-related genes osterix (OSX), osteocalcin (OCN), and ALP were detected by the Bio-Rad Quantitative Real-Time PCR system (Bio-Rad, MyiQ, USA). The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization, and the DMEM group was used as a control. The specific primer sequences used in this study are listed in Table 2 and were synthesized by Sangon Biotech, China. The experiment was done in triplicate. Table 2. Primer pairs used for qRT-PCR. gene

prime sequence (F, forward; R, reverse)

product length(bp)

accession number

F:CGTCCTCTCTGCTTGAGGAA

118

NM_181374.2

83

NC_005101.4

90

XM_006253120.2

111

NM_017008.4

OSX R:TTTCCCAGGGCTGTTGAGTC F:ATTGTGACGAGCTAGCGGAC OCN R:GCAACACATGCCCTAAACGG F:ACCGCAGGATGTGAACTACT ALP R:GAAGCTGTGGGTTCACTGGT F:CAGGGCTGCCTTCTCTTGTG GAPDH R:AACTTGCCGTGGGTAGAGTC

2.12 Bacteria response to surfaces Escherichia coli (E. coli ATCC 25922) and Staphylococcus aureus (S. aureus ATCC 6538) was used for antibacterial tests. E. coli and S. aureus are cultured in LB broth or LB agar plates. The samples were placed in the 12-well plates and incubated in 1 mL of bacteriacontaining medium (106 CFU/mL) at 37 ℃ for 24 hours. The bacteria attached on the sample surface were separated after rapid vortex mixing for 5 min, and the bacterial


Page 10 of 34

Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


suspension was diluted with 10-fold series dilution, and every 100 µL of bacterial samples were plated onto LB agar plates. After 12 hours of culture, photos were taken and the number of colonies was counted. The samples incubated with bacteria-containing medium for 24 hours were collected for bacterial live/dead staining. Samples were rinsed with PBS, then stained by the LIVE/DEAD BacLight Bacterial Viability Kit (Invitrogen, USA) according to the manufacturer’s protocol. The experiments were done in triplicate. The stained sample was placed on a cover glass and observed under a Laser Scanning Confocal Microscope. 2.13 Statistical analysis Statistically significant differences (*p

Enhancing Corrosion Resistance, Osteoinduction and Antibacterial

Recommend Documents