Ergostatrien-3β-ol from Antrodia camphorata Inhibits Diabetes and

Feb 19, 2015 - Department of Internal Medicine, Fengyuan Hospital, Ministry of Health and Welfare, Fengyuan District, Taichung City 42055,. Taiwan. âˆ...
0 downloads 10 Views 9MB Size
Download PDF
Article pubs.acs.org/JAFC

Ergostatrien-3β-ol from Antrodia camphorata Inhibits Diabetes and Hyperlipidemia in High-Fat-Diet Treated Mice via Regulation of Hepatic Related Genes, Glucose Transporter 4, and AMP-Activated Protein Kinase Phosphorylation Yueh-Hsiung Kuo,†,‡ Cheng-Hsiu Lin,§ and Chun-Ching Shih*,∥ †

Department of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung City 40402, Taiwan ‡ Department of Biotechnology, Asia University, Taichung City 41354, Taiwan § Department of Internal Medicine, Fengyuan Hospital, Ministry of Health and Welfare, Fengyuan District, Taichung City 42055, Taiwan ∥ Graduate Institute of Pharmaceutical Science and Technology, College of Health Science, Central Taiwan University of Science and Technology, No. 666 Buzih Road, Beitun District, Taichung City 40601, Taiwan ABSTRACT: This study was designed to explore the effects and mechanism of ergostatrien-3β-ol (EK100) from the submerged whole broth of Antrodia camphorata on diabetes and dyslipidemia in high fat diet (HFD)-fed mice for 12 weeks. The C57BL/6J mouse fed with a high fat diet (HFD) could induce insulin resistance and hyperlipidemia. After 8 week of induction, mice were receiving EK100 (at three dosages) or fenofibrate (Feno) or rosiglitazone (Rosi) or vehicle by oral gavage 4 weeks afterward. HFD-fed mice display increased blood glucose, glycated hemoglobin (HbA1c), total cholesterol (TC), triglyceride (TG), insulin, and leptin levels. These blood markers were significantly lower in EK100-treated mice, and finally ameliorated insulin resistance. EK100 treatment exhibited reduced hepatic ballooning degeneration and size of visceral adipocytes. Glucose transporter 4 (GLUT4) proteins and phosphorylation of Akt in skeletal muscle were significantly increased in EK100- and Rosi-treated mice. EK100, Feno, and Rosi treatment led to significant increases in phosphorylation of AMP-activated protein kinase (phosphoAMPK) protein in both skeletal muscle and liver. Moreover, EK100 caused a decrease in hepatic expressions of phosphenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6 Pase), and decreased glucose production. EK100 lowered blood TG level by inhibition of hepatic fatty acid synthesis by dampening sterol response element binding protein-1c (SREBP-1c) but increasing expression of peroxisome proliferator activated receptor α (PPARα). Moreover, EK100treated mice reduced blood TC levels by decreased hepatic expressions of SREBP2, which plays a major role in the regulation of cholesterol synthesis. EK100 increased high-density lipoprotein cholesterol (HDL-C) concentrations by increasing expressions of apolipoprotein A-I (apo A-I) in liver tissue. Our findings manifest that EK100 may have therapeutic potential in treating type 2 diabetes associated with hyperlipidemia in HFD-fed mice by regulation of GLUT4, PEPCK, G6 Pase, SREBP1c, SREBP2, apo AI, and AMPK phosphorylation. KEYWORDS: Antrodia camphorata, diabetes, hyperlipidemia, hypercholesterolemia, AMP-activated protein kinase phosphorylation, glucose transporter 4

■

INTRODUCTION Epidemiological analysis has predicted that the prevalence of Type 2 diabetes will reach 300 million by 2025. Type 2 diabetes mellitus represents greater than 90% of all cases1 and is characterized by hyperglycemia that involves either abnormalities in insulin secretion or insensitivity to insulin action at peripheral tissues, including adipose tissue, skeletal muscle, and liver tissues, which is known as insulin resistance. The development of insulin resistance is related to both genetic and environmental factors. The diet composition plays a key role in environmental factors.2 The fruiting body of Antrodia camphorata is a well-known traditional Chinese mushroom in Taiwan and belongs to Polyporaceae (Aphyllophorales). The fruiting body, cultured mycelia, and spores are medicinal parts. Due to its rareness and difficulty in cultivation, the A. camphorata is precious. © 2015 American Chemical Society

Currently, the A. camphorata is mainly obtained in the form of mycelia from submerged culture and used in the formation of nutraceuticals and functional foods. The fruiting body and cultured mycelia are composed of fatty acids, lignans, phenyl derivatives, sesquiterpenes, steroids, and triterpenoids.3 The fermented culture broth displayed cytotoxic activity,4 antiinflammation,5 and vasorelation.6 The filtrate in submerged culture showed protective activity against CCl4-induced hepatic toxicity and antioxidant property.7 However, the antidiabetic and antihyperlipidemic effects of ergosta-7,9(11),22-trien-3β-ol (ergostatrien-3β-ol; EK100; Figure 1) from the submerged Received: Revised: Accepted: Published: 2479

January 7, 2015 February 14, 2015 February 19, 2015 February 19, 2015 DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 1. Structure of ergostatrien-3β-ol (EK100).

type 2 diabetes. TZDs not only activate AMPK through a signal pathway that is different from metformin but also further activate AMPK.21 This influence in plasma adipocytokine concentration is associated with a decrease in accumulation in the liver and improvement in insulin resistance.21 Thus, Rosi was chosen as a positive control for comparison with the antidiabetic effects of EK100. Phosphorylation of Thr 172 of α subunits is essential for AMPK activity.22 Therefore, HFD-fed mouse models are chosen to address the effect and mode of action of EK100 on AMPK activity and GLUT4 content, and to compare with Rosi and Feno. As a possible molecular mechanism of EK100, the target gene expressions involved in antidiabetes and antihyperlipidemia in peripheral tissues were also investigated.

Glucose transporter 4 (GLUT4) is a key regulator of wholebody glucose homeostasis.8 Both insulin and exercise induce a translocation of glucose transporter GLUT4 from intracellular storage compartments toward the plasma membrane in adipocytes and skeletal muscle cells, allowing the cell to take up glucose.8,9 Impairment of GLUT4 expressions, GLUT4 translocation, and/or insulin signaling may affect insulinstimulated glucose uptake, which would result in insulin resistance and hyperglycemia.10 Thus, therapeutic strategies based on enhancing GLUT4 expressions may facilitate drug discovery. AMP-activated protein kinase (AMPK) is a key regulator of glucose and lipid metabolism. Because glucose and lipid metabolism is dysregulated in type 2 diabetes mellitius,11 AMPK modulators have been proposed to be promising therapies. Metformin is also known to activate AMPK and stimulate human skeletal muscle, promote GLUT4 membrane translocation, and stimulate insulin-independent glucose uptake.12 Thiazolidinediones (TZDs) such as rosiglitazone are antidiabetic peroxisome proliferator-activated receptor (PPAR) γ agonists. PPARγ activator like TZDs decrease blood glucose levels.13 Rosiglitazone does not stimulate insulin secretion. Rosiglitazone was approved for glycemic control in people with type 2 diabetes. Rosiglitazone directly targets insulin resistance and increases peripheral glucose uptake, thus improving glycemic control. The modes of action of rosiglitazone mainly contributed to the insulin-sensitizing effect and GLUT4 levels.14 Fenofibrate is an activator of PPARα15 and has been used for the management of hypertriglyceridemia for many years.16 PPARα is a key regulator of genes associated with lipid metabolism, which results in a decrease in circulating triglycerides and fatty acids via modulation of many target genes involved in lipogenesis, fatty acid oxidation, and energy expenditure.17 The model of C57BL/6J mouse that was fed a high fat-diet (HFD) is a robust and efficient model for early type 2 diabetes.18 The C57BL/6J mouse is susceptible not only to HFD-induced marked increases in adipose tissue mass but also to pronounced insulin resistance, hyperlipidemia, hyperinsulinemia, hypertriglycemia, and hypercholesterolemia.19 Metformin is a widely used antidiabetic agent in the treatment of type 2 diabetes mellitius.11 Metformin activates AMPK in both hepatocyte and skeletal muscle. 11,20 Nevertheless, metformin causes few adverse effects, including lactic acidosis, and this drug is regarded as a potential treatment for type 1 and

Chemicals. A hemoglobin A1c kit was obtained from BioSystems S.A. (Barcelona, Costa Brava, Spain). GLUT4, structural proteins GAPDH and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); phospho-AMPK was obtained from Abcam Inc. (Cambridge, MA, USA); phospho-Akt, total AMPK, and total Akt were from Cell Signaling Technology, Inc. (Danver MA, USA); the BCA protein assay kit was from Thermo Scientific (Rockford, IL, USA); and the ECL reagent kit was from GE Healthcare BioSciences (Buckinghamshire, UK). Secondary antibody antirabbit was from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Fungus Material. The freeze-dried powder of A. camphorata submerged whole broth was provided by the Biotechnology Center of Grape King Inc., Chung-Li City, Taiwan. Isolation and Determination of the Active Compound. The freeze-dried powder of A. camphorata of the submerged whole broth (1.6 kg) was extracted three times with methanol (16 L) at room temperature (1 day each). The methanol extract was evaporated in vacuo to obtain a brown residue, which was suspended in H2O (1 L) and then partitioned (three times) with 1 L of ethyl acetate. The EtOAc fraction (95 g) was chromatographed on silica gel and eluted with mixtures of hexane and EtOAc to increase polarity and further purified with high performance liquid chromatography (HPLC). EK100 (5.4 g) was eluted with 10% EtOAc in hexane, and recrystallization with EtOH.23 Experimental Animals. The experiments were conducted under the guidelines of the Institutional Animal Care and Use Committee of Central Taiwan University of Science and Technology. As previously described,24−26 four-week-old male C57BL/6J mice (n = 63) was purchased from the National Laboratory Animal Breeding and Research Center, Ministry of Science and Technology. After 1-week of acclimatization, mice were designed to initiate the study, and the study lasted for 12 weeks. First, mice were divided randomly into two groups (the control (CON) group (n = 9), which received a low-fat diet (Diet 12450B, Research Diets, Inc., New Brunswick, NJ, USA), and the high-fat diet (HFD)-fed group (n = 54), which was fed a 45% high-fat diet (Diet 12451, Research Diets, Inc.)). After 8 weeks of diet induction, HFD-treated mice were further randomly subdivided into six groups (n = 9 per group), receiving EK100 (10, 20, 40 mg/kg/day body wt) or fenofibrate (Feno; purchased from Sigma Chemical Co, St Louis, and administrated at a dose of 250 mg/kg/day body wt) or rosiglitazone (Rosi; 1% methylcellulose 10 mg/kg body weight, obtained from GlaxoSmithKline Product No: BRL49653 C) or vehicle by oral gavages one time per day for another 4 weeks and still on highfat diet. The CON group and high-fat control (HF) group were given with vehicle only. The low-fat diet consisted of fat 10%, whereas the high-fat diet (HFD) consisted of fat 45% (of total energy, % kcal). The compositions of the experimental diets are shown as described.24 At the end of the study, food was deprived from the animals (from 10 p.m. to 10 a.m.). On the next day, the mice were sacrificed, and blood and tissue were collected for analysis. Livers, skeletal muscles, and white adipose tissues (WATs) (including epididymal, mesenteric and retroperitoneal WAT) were excised and weighed, and then

whole broth of A. camphorata are not well-defined in high-fat diet (HFD)-induced diabetic mice.

■

2480

MATERIALS AND METHODS

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used in This Study Gene PEPCK

G6 Pase

Adiponectin

PPARα

SREBP1c

DGAT2

apo C-III

SREBP2

apo A-I

GAPDH

Primer sequence

PCR product (bp)

F: CTACAACTTCGGCAAATACC R: TCCAGATACCTGTCGATCTC (Seq No. NM_011044.2) F: GAACAACTAAAGCCTCTGAAAC R: TTGCTCGATACATAAAACACTC (Seq No. NM_008061.3) F:TCTTCTACAACCAACAGAATCA R:GTATCATGGTAGAGAAGGAAGC (Seq No. NM_009605.4) F: ACCTCTGTTCATGTCAGACC R: ATAACCACAGACCAACCAAG (Seq No. NM_011144) F: GGCTGTTGTCTACCATAAGC R: AGGAAGAAACGTGTCAAGAA (Seq No. NM_011480) F: AGTGGCAATGCTATCATCATCGT R: AAGGAATAAGTGGGAACCAGATCA (Seq No. NM_026384.3) F: CAGTTTTATCCCTAGAAGCA R: TCTCACGACTCAATAGCTG (Seq No. NM_023114.3) F: ATATCATTGAAAAGCGCTAC R: ATTTTCAAGTCCACATCACT (Seq No. AF289715.2) F: ACATATATAGACCAGGGAAGAA R: AAACTGGGACACATAGTCTCT (Seq No. NM_009692.3 F: TGTGTCCGTCGTGGATCTGA R: CCTGCTTCACCACCTTCTTGA (Seq No. NM_031144

330

52

350

50

324

50.5

352

55

219

50

149

50

349

47

256

47

246

50.5

immediately stored in a freezer at −80 °C. Heparin (30 units/mL) (Sigma) was added to blood samples. Plasma samples were collected by centrifugation at 1600g for 15 min at 4 °C within 30 min, and plasma was obtained for insulin and leptin level analysis. Body Weight, Body Weight Gain, and Food Intake Analysis. Throughout the study, body weight and food intake were daily recorded at the same time. Body weight gain is defined as the difference between 1 day and the next day. The pellet food was weighed and placed in a cage food container. After 24 h, the remaining food was weighed and the crumbs were collected as much as possible. Based on the difference between 1 day and the next day, the daily food intake was calculated. Blood Glucose and Glycated Hemoglobin (HbA1c) Levels and Biochemical Analysis. Blood samples (0.8 mL) were collected from the retro-orbital sinuses of fasting mice, and glucose level was measured by the glucose oxidase method (model 1500; Sidekick Glucose Analyzer; YSI Inc., Yellow Springs, OH, USA). Percent HbA1c was detected with a Hemoglobin A1c kit (BioSystems S.A., Barcelona, Spain). Plasma triglycerides (TG), total cholesterol (TC), free fatty acids (FFA), high-density lipoprotein cholesterol (HDL-C), and lowdensity lipoprotein cholesterol (LDL-C) were determined using commercial assay kits (Triglycerides-E test, Cholesterol-E test, and FFA-C test, Wako Pure Chemical, Osaka, Japan; HDL-C-test and LDL-C-test, Roche Diagnostics GmbH, Indianapolis, USA) according to their instructions. A mouse insulin ELISA kit (Sibayagi, Gunma, Japan) and mouse leptin ELISA kit (Morinaga, Yokohama, Japan) were used to measure blood insulin and leptin levels, respectively. Histopathological Examination. A portion of the collected epididymal WAT and liver tissue was fixed with formalin (200 g/kg) neutral buffered solution and embedded in paraffin. Sections (8 μm) were cut and stained with hematoxylin and eosin. A microscope (Leica, DM2500) and Leica Digital camera (DFC-425-C) were used for microscopic examination and images taken, respectively.

99

Annealing temp (°C)

55

Hepatic Lipids Measurements. Hepatic lipids were extracted as previously described.25 Liver sample (0.375 g) was homogenized with 1 mL of distilled water for 5 min for the hepatic lipid extraction and analyzed using a triglycerides kit as used for serum lipids. Relative Quantization of mRNA Indicating Gene Expression Analysis. The experiment was performed as in a previously described protocol.24−27 Total RNA from the liver tissue was isolated with a Trizol reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s directions. Total RNA (1 μg) was reverse transcribed to cDNA with 5 μL of Moloney murine leukemia virus reverse transcriptase (Epicenter, Madison, WI, USA) as a previously described protocol.24−27 The polymerase chain reaction (PCR) was performed in a final 25 μL containing 1 U Blend Taq-Plus (TOYOBO, Japan), 1 μL of the RT first-strand cDNA product, 10 μM of each forward (F) and reverse (R) primer, 75 mM Tris-HCl (pH 8.3) containing 1 mg/L Tween 20, 2.5 mM dNTP, and 2 mM MgCl2. The primers are shown in Table 1. The products were run on 2% agarose gels and stained with ethidium bromide. The relative density of the band was evaluated using AlphaDigiDoc 1201 software (Alpha Innotech Co., San Leandro, CA, USA). All of the measured PCR products were normalized to the amount of cDNA of GAPDH in each sample. Western Blotting Analysis. Protein extractions and immunoblots for the determination of GLUT4, phospho-AMPK (Thr172), and phospho-Akt (Ser 473) proteins were carried out on frozen skeletal muscle and liver tissue from mice, which follows a previous paper.25−27 Additionally, GLUT4 was carried out on frozen skeletal muscle from mice, and the total membrane fractions were collected with buffer and centrifuged as a previously described.28−30 The protein contents of GLUT4, phospho-AMPK, phospho-Akt, total AMPK, and total Akt were detected by blotting. Western blotting had been determined as described elsewhere.25−28 Subsequently, antibodys were detected using horseradish peroxidase linked to a goat anti-IgG rabbit secondary 2481

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 2. continued

2482

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 2. Effects of ergostatrien-3β-ol (EK100) on (A) body weight, (B) food intake, (C) visceral fat, (D) blood glucose levels, (E) total cholesterol levels, (F) triglycerides levels, (G) leptin levels, and (H) insulin levels at week 12. Mice were fed with 45% high-fat diet (HF) or low-fat diet (CON) for 12 weeks. After 8 weeks of induction, the HF mice were treated with vehicle, or ergostatrien-3β-ol (EK100), or fenofibrate (Feno) or rosiglitazone (Rosi) accompanied by HF diet for 4 weeks. All values are means ± SE (n = 9). # P < 0.05, ## P < 0.01, and ### P < 0.001 compared with the control (CON) group; * P < 0.05, ** P < 0.01, and *** P < 0.001 compared with the high-fat plus vehicle (HF) group by ANOVA. Ergostatrien-3β-ol (EK100): K1:10, K2:20, K3:40 mg/kg body wt; Feno: fenofibrate (250 mg/kg body weight); Rosi: rosiglitazone (10 mg/kg body wt). WAT, white adipose tissue; visceral fat represented epididymal WAT plus retroperitoneal WAT.

Table 2. Absolute Tissue Weights, Liver Lipid, Blood HbA1c, and Other Parametersa in HFD-Mice Treated Orally with Ergostatrien-3β-ol (EK100) Parameter

HF+K1

HF+K2

HF+K3

HF+Feno

HF+Rosi

10b

20b

40b

250b

10b

0.736 ± 0.070* 0.244 ± 0.024* 0.243 ± 0.041* 1.351 ± 0.153*** 0.144 ± 0.013* 0.796 ± 0.041 0.37 ± 0.38*

0.924 ± 0.069 0.295 ± 0.009 0.249 ± 0.028* 0.569 ± 0.069 0.142 ± 0.012* 1.046 ± 0.033*** 0.69 ± 0.63*

0.813 ± 0.069* 0.257 ± 0.019* 0.244 ± 0.042* 0.737 ± 0.094 0.175 ± 0.018 0.816 ± 0.038 1.71 ± 0.56

65.4 ± 4.2** 43.7 ± 6.6***

63.8 ± 4.7** 48.4 ± 5.6***

65.1 ± 5.3** 44.5 ± 3.2***

1.03 ± 0.05** 5.1 ± 0.3*** 83.8 ± 1.6*** 86.8 ± 11.5**

0.94 ± 0.08** 6.4 ± 0.7** 80.3 ± 4.5** 105.8 ± 10.4

1.00 ± 0.09* 6.2 ± 0.4** 73.1 ± 5.8 86.7 ± 7.7**

CON

HF

EWAT MWAT RWAT Skeletal muscle BAT Liver (g) weight gain (g)

0.391 ± 0.016 0.197 ± 0.015 0.061 ± 0.006 0.462 ± 0.021 0.123 ± 0.009 0.827 ± 0.017 1.21 ± 0.23

1.103 ± 0.092### 0.341 ± 0.032### 0.391 ± 0.041### 0.744 ± 0.051 0.190 ± 0.010## 0.839 ± 0.025 3.96 ± 1.24#

total lipid (mg/g) triacylglycerol (μmol/g)

57.6 ± 2.8 35.6 ± 3.7

97.2 ± 6.0### 80.3 ± 7.3###

Absolute Tissue Weight (g) 0.853 ± 0.031* 0.774 ± 0.057* 0.276 ± 0.032 0.276 ± 0.032 0.281 ± 0.016* 0.283 ± 0.025* 0.781 ± 0.034 1.167 ± 0.045* 0.160 ± 0.007 0.143 ± 0.016* 0.813 ± 0.025 0.819 ± 0.025 1.30 ± 0.39 1.13 ± 0.20 Liver Lipids 72.4 ± 3.7** 68.0 ± 4.5** 57.3 ± 5.5** 44.5 ± 4.7***

FFA (meq/L) HbA1c (%) HDL-C (mg/dL) LDL-C (mg/dL)

0.99 ± 0.09 5.5 ± 0.6 84.9 ± 3.9 107.1 ± 7.7

1.35 ± 0.11## 9.3 ± 0.5### 65.3 ± 3.1### 130.5 ± 20.0

Blood 1.06 ± 0.10* 5.8 ± 0.7** 82.2 ± 3.9** 112.4.0 ± 7.4

Profiles 1.05 ± 0.09* 5.7 ± 0.5*** 83.0 ± 2.0*** 103.7 ± 10.8

a All values are means ± SE (n = 9). # P < 0.05, ## P < 0.01, and ### P < 0.001 compared with the control (CON) group; * P < 0.05, ** P < 0.01, and *** P < 0.001 compared with the high-fat plus vehicle (distilled water) (HF) group. Ergostatrien-3β-ol (EK100): K1:10, K2:20, K3:40 mg/kg body wt; Feno: fenofibrate (250 mg/kg body wt); Rosi: rosiglitazone (10 mg/kg body wt). BAT, brown adipose tissue; RWAT, retroperioneal white adipose tissue; MWAT, mesenteric white adipose tissue; FFA, plasm free fatty acid. bDose (mg/kg/day)

■

antibody and visualized using an ECL system. The density blotting was analyzed using Alpha Easy FC software (Alpha Innotech Corp., Randburg, South Africa). Structural proteins GAPDH and β-actin were obtained by stripping the nitrocellulose membrane proteins of liver and skeletal muscle, respectively. Statistical Analysis. All results were presented as mean and standard error. Whenever possible, data were subjected to analysis of variance, followed by Dunnett’s multiple range tests, using SPSS software (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered to be statistically significant.

RESULTS

Body Weight, Food Intake, and Tissue Weight. All group mice begin with similar mean body weights (18.9 ± 0.2 g). Mice on HFD for 12 weeks displayed significantly greater increases in body weight and body weight gain compared to CON littermates (Figure 2A and Table 2). Administration of K3 and Feno displayed resistance to bodyweight gain. HF mice consume high-fat diets much less than CON littermates (Figure 2B). All the EK100-, Feno- and Rosi-treated mice and HF mice consume high-fat diets similarly. Feeding a HFD displayed a

2483

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 3. Effects of ergostatrien-3β-ol (EK100) on (A) epididymal WAT and (B) liver tissue morphology in the low-fat (CON), high-fat (HF), HF + K1, HF + K2, HF + K3, or HF + Feno, or HF + Rosi groups. Pictures of hematoxylin and eosin-stained sections of (A) epididymal adipocytes (Magnification: 10 (ocular) × 20 (object lens)) from mice fed with EK100. The appearance of adipocyte is polyhedral and displayed the string-like cytosol surrounded by a vacuole (H&E stain); and (B) liver tissue (Magnification: 10 (ocular) × 20 (object lens)) from mice fed with EK100. The high-fat diet induced the hepatic ballooning degeneration in the HF group as compared with the CON group. The ballooning degeneration is a form of liver parenchymal cell death, and the nucleolus was squeezed into the other side of the named balloon (as the arrow indicates). Each presented image is typical and representative of nine mice. Ergostatrien-3β-ol (EK100): K1:10, K2:20, K3:40 mg/kg body wt; Feno: fenofibrate (250 mg/kg body wt); Rosi: rosiglitazone (10 mg/kg body wt).

marked increase in weights of absolute adipose tissues (epididymal, visceral fat, mesenteric and retroperitoneal WAT) (Table 2 and Figure 2C). The K1-, K2-, K3-, Feno-, and Rosi-treated mice displayed a decrease in weights of retroperitoneal WAT and visceral fat. The K1-, K2-, K3-, and Rosi-treated mice reduced weights of epididymal WAT. The K3- and Rosi-treated mice display less mesenteric WAT weights. The brown adipose tissue (BAT) mass was decreased in K2-, K3- and Feno-treated mice. The K2- and K3-treated mice showed an increase in skeletal muscle mass. Feno-treated mice showed a marked increase in liver weight (Table 2). Blood Glucose and HbA1c Levels. After 8 weeks on HFD, HF mice displayed the hyperglycemia evidence compared with the CON mice (P < 0.001). Administration

of K1, K2, K3, Feno, and Rosi significantly reduced blood glucose levels (P < 0.001, P < 0.001, P < 0.001, P < 0.001, P < 0.001, respectively) (Figure 2D). The percent of hemoglobin was evaluated nonenzymatically (percent HbA1c) as an integrated measure of long-term blood glucose regulation. Blood levels of HbA1c were significantly greater in the HF group than in the CON group. Treatment with K1, K2, K3, Feno, and Rosi decreased HbA1c levels in blood (Table 2). Blood Lipid and Hepatic Lipid. HFD caused increases in blood total cholesterol (TC), triglyceride (TG), and free fatty acid (FFA) (Figure 2E and F and Table 2). The K1-, K2-, K3-, and Rosi-treated mice lowered TC levels (P < 0.05, P < 0.01, P < 0.001, P < 0.05, respectively). The K1-, K2-, K3-, Feno-, and Rosi-treated mice decreased TG level. The K1-, K2-, K3-, 2484

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 4. Semiquantitative RT-PCR analysis on PEPCK, G6 Pase, adiponectin, SREBP1c, DGAT2, apo C-III, SREBP2, apo A-I, and PPARα mRNA expression in liver tissue of the mice receiving ergostatrien-3β-ol (EK100) by oral gavage for 4 weeks. All values are means ± SE (n = 9). # P < 0.05 and ### P < 0.001 compared with the control (CON) group; * P < 0.05, ** P < 0.01, and *** P < 0.001 compared with the high-fat plus vehicle (HF) group. Ergostatrien-3β-ol (EK100): K1:10, K2:20, K3:40 mg/kg body wt; Feno: fenofibrate (250 mg/kg body wt); Rosi: rosiglitazone (10 mg/ kg body wt). Total RNA (1 μg) isolated from tissue was reverse transcripted by MMLV-RT, 10 μL of RT products were used as templates for PCR. Signals were quantitated by image analysis; each value was normalized by GAPDH.

Targeted Gene mRNA Expressions in Liver Tissue. The HFD induced higher expression levels of phosphoenol pyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6 Pase), sterol regulatory element binding protein 1c (SREBP1c), acylcoenzyme A: diacylglycerol acyltransferase 2 (DGAT2), apolipoprotein C-III (apo C-III), and SREBP2 in the HF group than in the CON group. Administration of K1, K2, K3, Feno, and Rosi showed a decreased mRNA level of PEPCK, G6 Pase, SREBP1c, DGAT2, apo C-III, and SREBP2. K3- and Rosi-treated mice increased the mRNA level of adiponectin. The K1-, K2-, and K3-treated mice show increased mRNA levels of apolipoprotein A-I (apo A-I). Administration of K1, K2, K3, and Feno increased the mRNA level of PPARα (Figure 4). Western Blotting of GLUT4, phospho-Akt (Ser 473)/ total Akt, and Phospho- AMPK (Thr172) Proteins. The levels of GLUT4 and phospho-Akt/total Akt were lower in HF mice than in CON mice. K1-, K2-, K3-, Feno-, and Rosi-treated mice show increased muscular GLUT4 protein contents (P < 0.01, P < 0.01, P < 0.001, P < 0.05, P < 0.001, respectively). Administration of K1, K2, K3, and Rosi displayed higher levels of phospho-Akt/total Akt than in HF mice. The mice on HFD showed decreased phospho-AMPK in liver tissue and skeletal muscle. The protein contents of phospho-AMPK were

Feno-, and Rosi-treated mice showed decreased FFA concentrations. The K1-, K2-, K3-, and Feno-treated mice increased high-density lipoprotein cholesterol (HDL-C) levels (Table 2). The K3- and Rosi-treated mice displayed a decrease in low-density lipoprotein cholesterol (LDL-C) level. HFD caused increases in the total lipids of liver and concentrations of triacylglycerol, while treatment with K1, K2, K3, Rosi, and Feno displayed marked decreases in these phenomena (Table 2). Blood Leptin and Insulin Levels. Blood leptin and insulin levels were greater in the HF group than in the CON group (Figure 2G and H). The K1-, K2-, K3-, Feno-, and Rosi-treated mice displayed a decrease in blood leptin and insulin levels. Histopathology Examination. Feeding a HFD induced hypertrophy of adipocytes (the average areas of adipocytes in the HF group and CON group are 9604.2 ± 281.3 and 3797.5 ± 412.9 μm2, respectively), whereas mice treated with K1 (4204.0 ± 131.5 μm2), K2 (3535.7 ± 340.2 μm2), K3 (3458.9 ± 30.7 μm2), and Feno (4175.4 ± 322.9 μm2) showed significantly lower hypertrophy. The average area of the Rositreated mice is 5598.6 ± 162.7 μm2 (Figure 3A). Feeding a HFD induced ballooning degeneration of hepatocyte. Administration of K1, K2, K3, Feno, and Rosi decreased the ballooning degeneration (Figure 3B). 2485

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

Figure 5. Protein contents of GLUT4, phospho-AMPK (Thr172)/total AMPK, and phospho-Akt/total Akt in skeletal muscle and phospho-AMPK (Thr172)/total AMPK in liver tissue of the mice receiving ergostatrien-3β-ol (EK100) by oral gavage for 4 weeks. Protein was separated by 12% SDS-PAGE detected by Western blot. All values are means ± SE (n = 9). # P < 0.05 and ### P < 0.001 compared with the control (CON) group; * P < 0.05, ** P < 0.01, and *** P < 0.001 compared with the high-fat plus vehicle (HF) group. Ergostatrien-3β-ol: K1:10, K2:20, K3:40 mg/kg body wt; Feno: fenofibrate (250 mg/kg body wt); Rosi: rosiglitazone (10 mg/kg body wt).

resistant to HFD-induced hyperinsulinemia, suggesting EK100 displayed increased insulin sensitivity or efficiency. In the present study, Rosi and Feno caused reduced blood glucose level, consistent with earlier observations.13,29 Moreover, the level of blood glycosylated HbA1c, which is a maker of longterm control of blood glucose, is also significantly decreased. On the other hand, HFD caused an increase in circulating triglyceride and total cholesterol levels, which were consistent with earlier studies,19 while they were significantly lowered in EK100-treated mice. These data reinforce that EK100 is effective to improve insulin resistance and dyslipidemia in a mouse model of Type 2 diabetes and dyslipidemia. The

significantly increased in the K1-, K2-, K3-, Feno-, and Rositreated groups in liver tissue (P < 0.001, P < 0.001, P < 0.001, P < 0.01, P < 0.001, respectively) and in skeletal muscle (P < 0.001, P < 0.001, P < 0.001, P < 0.001, P < 0.001, respectively) (Figure 5).

■

DISCUSSION The present study demonstrated that EK100-treated mice displayed effectively lower blood glucose and circulating triglyceride levels. In this study, high-fat feeding induces hyperglycemia and hyperinsulinemia. EK100 treatment significantly decreased blood glucose levels and makes mice 2486

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry physiological relevance of these findings is supported by the increased skeletal muscular GLUT4 contents and activation of AMPK in both skeletal muscle and liver tissue. To ascertain whether EK100 regulates glucose utilization, we evaluated the membrane protein contents of GLUT4 in skeletal muscle because glucose uptake is primarily mediated by skeletal muscle. Levels of GLUT4 movement to the plasma membrane were assessed, as it is an essential step for insulin-responsive glucose in skeletal muscle that becomes defective in insulin resistance.8 All EK100-treated mice display an enhancement of muscular GLUT4 protein; moreover, EK100 (K3) and Rosi treatment displayed approximately 2.7-fold and 2.1-fold enhancement, respectively, implying that EK100 treated mice are indeed hypersensitive to insulin and exhibit antidiabetic activity. Rosi has been shown to act as an insulin sensitizer. The apparent insulin sensitivity of EK100-treated mice prompted our interest in EK100 regulation of GLUT4 and Akt. There are two principal mechanisms involved in promoting tranlocation of GLUT4 to the plasma membrane, including insulin signaling through the phosphatidylinositol 3′ kinase (PI3-kinase)/Akt pathway and the AMPK pathway.8 Previous findings showed that a mutation in the gene encoding Akt2/PK Bβ resulted in severe insulin resistance,30 establishing Akt2/PK Bβ as a key protein in the maintenance of euglycemia. To explore the mechanism of enhanced GLUT4 proteins by EK100, we measured phosphorylation of Akt levels in skeletal muscle. We observed that EK100 manifested elevated phosphorylation of Akt levels in skeletal muscle, implying that the enhanced GLUT4 proteins by EK100 appear to be in part mediated by the insulin signaling pathway through increased phosphorylation of Akt. The phosphorylation of the AMPK pathway is another major regulator of GLUT4 translocation during exercise or in response to some antidiabetic agents such as AICAR and metformin.8 In this study, we found that EK100-treated mice manifest elevated phosphorylation of AMPK levels in both skeletal muscle and liver tissue. Metformin is used for the treatment of type 2 diabetes due to increased skeletal muscular glucose uptake and reduced hepatic glucose production.11,20 The present results demonstrated that EK100-treated mice were protected from HFD-induced hyperglycemia by AMPK activities and GLUT4 proteins. Whether skeletal muscular activation of AMPK by EK100 is responsible for overall GLUT4 regulation, the potential mechanisms require further investigation of the phosphorylation of AS160. PEPCK and G6 Pase are key rate-limiting enzymes of gluconeogenesis.31 The liver of diabetic rats showed a significant increase in the activities of G6 Pase.31 Overexpression of PEPCK enzyme in mice results in symptoms of type 2 diabetes. The published research further showed that activation of AMPK in turn inhibited the expression of the hepatic gluconeogenic genes PEPCK and G6 Pase.32 Activation of AMPK has been implicated in metformin action in hepatocytes.11 Metformin decreases hyperglycemia primarily by suppressing glucose production by the liver (hepatic gluconeogenesis).20 EK100-treated mice elicited decreased expressions of PEPCK and G6 Pase. Thus, the antidiabetic effect of EK100 is possibly partly due to down-regulation of PEPCK and G6 Pase. Collectively, this study demonstrated that EK100 caused glucose lowering by AMPK activation in both liver tissue and skeletal muscle, besides its ability to increase glucose uptake in skeletal muscle, possibly by down-regulations of PEPCK to inhibit hepatic glucose production.

Our second goal was to determine the molecular mechanism of EK100-mediated hypolipidemic effects. Fenofibrate, a PPARα agonist, has been recommended to reduce circulating triglycerides.17 In this study, Feno displayed a decrease of the circulating TG level by 47.9%, while Rosi decreased the circulating TG level less. EK100 showed a moderate reduction in levels of TG. PPARα agonist is known to down-regulate numerous genes involved in lipid synthesis. PPARα ligands (such as fibrates) reduce the expression of apo C-III gene,33 thus resulting in a hypotriglyceridemic effect. PPARα has been shown to regulate lipid metabolism and fatty acid oxidation. SREBP-1c plays a key role in the activation of lipogenic enzyme expression, fatty acid synthesis and triglyceride accumulation,34 and it plays the role of PPARα in SREBP- mediated regulation of lipogenic genes.35 In this study, EK100-treated mice displayed an increase in expressions of PPARα but a reduction in SREBP1c and DGAT2 mRNA. DGAT2 is known to catalyze the final step in the synthesis of triglycerides.36 Therefore, the down-regulation of DGAT2 seems to be responsible for the hepatic triglyceride output, thus resulting in a decrease in blood TG. These findings further confirmed that EK100 displayed hypolipidemic activity partly via regulation of genes associated with fatty acid oxidation and lipogenesis. K3-treated mice showed reduced body weight, which primarily reflects decreased fat accumulation with reduced weight of epididymal adipose tissue (EWAT) as well as decreased weight of visceral fat. Although their body weight was lower, K3-treated mice show increased skeletal muscle mass. These findings were consistent with an earlier report,37 which revealed that increased Akt signaling resulted in muscle hypertrophy, increased insulin sensitivity, and resistance to HFD-induced weight gain. Akt activation is a common feature of the diverse model of increased insulin sensitivity. Both reduced obesity and increased Akt signaling may elicit the improved insulin sensitivity of the K3-treated mice. Histology investigation has revealed that EK100 treatment lowered the area of adipocytes. Because circulating TG level is fluctuating and liver is the major organ responsible for metabolizing fat, presumably EK100 reflected the movement of fat from adipose tissue to liver by increasing hepatic lipid metabolism, which led to reduced adipocyte size and nearly invisible liver lipid droplets. It was observed that EK100 decreased blood TC and TG levels while it increased HDL-C concentrations. Moreover, only K3-treated mice displayed a decrease in LDL-C levels. PPARα agonists are known to reduce LDL-C and increase HDL-C. In this study, Feno-treated mice reduced adiposity17 and displayed no changes in total cholesterol (TC) and LDL-C levels, but increased HDL-C concentrations, consistent with an earlier study.38 The difference between EK100 and Feno is that EK100-treated mice show significantly decreased TC levels whereas Feno-treated mice display unchanged levels in this manifest hypercholesterolemia animal model. An additional mechanism that plays a role in the hypolipidemic effect was also examined. In this study, EK100treated mice displayed reduced blood TC levels and decreased SREBP2 expression, since SREBP2 plays a major role in the regulation of cholesterol synthesis,39 implying that the potential mechanism of EK100 was involved in SREPB2 on the inhibitory action of cholesterol synthesis. PPARα ligands are used widely to lower serum TG and to increase HDL-C in patients with obesity and dyslipidemia.40 In this study, EK100 enhanced both HDL-C levels and apo A-I expression. HDL-C 2487

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

insulin action and glucose tolerance. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2000, 279, R1334−R1340. (3) Geethangili, M.; Tzeng, Y. M. Review of pharmacological effects of Antrodia camphorata and its bioactive compounds. Evidence-Based Compl. Altern. Med. 2011, 2011, No. 212641. (4) Yeh, C. T.; Rao, Y. K.; Yao, C. J.; Yeh, C. F.; Li, C. H.; Chuang, S. E.; Luong, J. H.; Lai, G. M.; Tzeng, Y. M. Cytotoxic triterpenes from Antrodia camphorata and their mode of action in HT-29 human colon cancer cells. Cancer Lett. 2009, 285, 73−79. (5) Huang, G. J.; Huang, S. S.; Lin, S. S.; Shao, Y. Y.; Chen, C. C.; Hou, W. C.; et al. Analgesic effects and the mechanisms of antiinflammation of ergostatrien-3beta-ol from Antrodia camphorata submerged whole broth in mice. J. Agric. Food Chem. 2010, 58, 7445−7452. (6) Wang, G. J.; Tseng, H. W.; Chou, C. J.; Tsai, T. H.; Chen, C. T.; Lu, M. K. The vasorelation of Antrodia camphorata mycelia: Involvement of endothelial Ca2+-NO-cAMP pathway. Life Sci. 2003, 73, 2769−2783. (7) Song, T. Y.; Yen, G. C. Protective effects of fermented filtrate from Antrodia camphorata in submerged culture against CCl4-induced hepatic toxicity in rats. J. Agric. Food Chem. 2003, 51, 1571−1577. (8) Huang, S.; Czech, M. P. The GLUT4 glucose transporter. Cell Metab. 2007, 5, 237−252. (9) Bryant, N. J.; Govers, R.; James, D. E. Regulated transport of the glucose transporter GLUT4. Nat. Rev. Mol. Cell Biol. 2002, 3, 267− 277. (10) Watson, R. T.; Pessin, J. E. Intracellular organization of insulin signaling and GLUT4 translocation. Recent Prog. Horm. Res. 2001, 56, 175−193. (11) Zhou, G.; Myers, R.; Li, Y.; Chen, Y.; Shen, X.; Fenyk-Melody, J.; Wu, M.; Ventre, J.; Doebber, T.; Fujii, N.; Musi, N.; Hirshman, M. F.; Goodyear, L. J.; Möller, D. E. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 2001, 108, 1167− 1174. (12) Musi, N.; Hirshman, M. F.; Nygren, J.; Svanfeldt, M.; Bavenholm, P.; Rooyackers, O.; Zhou, G.; Williamson, J. M.; Ljunqvist, O.; Efendic, S.; Möller, D. E.; Thorell, A.; Goodyear, L. J. Metformin increases AMP-activated protein kinase activity in skeletal muscle od subjects with type 2 diabetes. Diabetes 2002, 51, 2074− 2081. (13) Rangwala, S. M.; Lazar, M. A. Peroxisome proliferator-activated receptor gamma in diabetes and metabolism. PPAR gamma, glucose homeostasis. Trends Pharmacol. Sci. 2004, 25, 331−336 Review.. (14) Martinez, L.; Berenguer, M.; Bruce, M. C.; Le MarchandBrustel, Y.; Govers, R. Rosiglitazone increases cell surface GLUT4 levels in 3T3-L1 adipocytes through an enhacement of endosomal recycling. Biochem. Pharmacol. 2010, 79, 1300−1309. (15) Kersten, S.; Desvergne, B.; Wahli, W. Roles of PPARs in health and disease. Nature 2000, 405, 421−424. (16) Farnier, M.; Bonnefous, F.; Debbas, N.; Irvine, A. Comparative efficacy and safety of micronised fenofibrate and simvastatin in patients with primary type IIa or IIb hyperlipidemia. Arch. Int. Med. 1994, 154, 441−449. (17) Srivastava, R. A. K.; Jahagirdar, R.; Azhar, S.; Sharma, S.; Bisgaier, C. L. Peroxisome proliferator-activated receptor-αselective ligand reduces adiposity, improves insulin sensitivity, and inhibits atherosclerosis in LDL receptor-deficient mice. Mol. Cell. Biochem. 2006, 285, 35−50. (18) Winzell, M. S.; Ahrèn, B. The high-fat diet mouse: a model for studying mechanisms and type 2 diabetes. Diabetes 2004, 53 (Suppl. 3), S215−219. (19) Petro, A. E.; Cotter, J.; Cooper, D. A.; Peters, J. C.; Surwit, S. J.; Surwit, R. S. Fat, carbohydrate and calories in the development of diabetes and obesity in the C57BL/6J mouse. Metabolism 2004, 53, 454−457. (20) Viollet, B.; Guigas, B.; Sanz Garcia, N.; Leclerc, J.; Foretz, M.; Andreelli, F. Cellular and molecular mechanisms of metformin: an overview. Clin. Sci. (London) 2012, 122, 253−270.

is positively associated with a decreased risk of coronary heart disease (CHD). Since apo A-I has been reported to be synthesized by liver cells41 and the major apolipoproteins of HDL-C are apo A-I and apo A-II,42 the observed increase in HDL-C level by EK100 was presumably mediated by enhanced hepatic apo A-I production. These data are important because they suggest that EK100 treatment resulted in elevated HDL-C concentration, a known physiological consequence that may be useful in cardiovascular events. In conclusion, EK100 exhibited not only lowered blood glucose levels accompanied by decreased HbA1c and ameliorated insulin resistance but also diminished blood TC and TG levels. EK100 exerted significantly increased GLUT4 protein in skeletal muscle, which enhanced glucose uptake; moreover, EK100 increased phosphorylation of AMPK in liver and reduced PEPCK and G6 Pase expressions, which decreased hepatic glucose production, leading to exertion of an antihyperglycemic effect. On the other hand, EK100 enhanced hepatic expressions of PPARα (fatty acid oxidation) and reduced SREBP1c (lipogenesis), thus resulting in lowering circulating TG levels. Moreover, EK100 reduced hepatic expressions of SREBP2 while it enhanced apo A-I and thus contributed to a decrease in blood TC and a rise in the plasma HDL-C level. Our results reinforce that EK100 will have therapeutic potential in treating type 2 diabetes associated with hyperlipidemia.

■

AUTHOR INFORMATION

Corresponding Author

* (C.-C.S.) Phone: +886-4-22391647 ext. 3978. Fax: +886-422394256. E-mail: [email protected]. Funding

Financial support for this study was partly by CMU under the Aim for Top University Plan of the Ministry of Education, Taiwan, and partly by Taiwan Ministry of Health and Welfare Clinical Trial and Research Center of Excellence (MOHW103TDU-B-212-113002). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED AMPK, AMP-activated protein kinase; apo A-I, apolipoprotein A-I; apo C−III, apolipoprotein C-III; BAT, brown adipose tissue; CON, control; DGAT, acyl-coenzyme A:diacylglycerol acyltransferase; EWAT, epididymal white adipose tissue; fenofibrtae, Feno; FFA, free fatty acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; G6 Pase, glucose-6-phosphatase; GLUT4, glucose transporter 4; HbA1c, glycated hemoglobin; HDL-C, high-density lipoprotein cholesterol; HF, high-fat control; LDL-C, low-density lipoprotein cholesterol; PEPCK, phosphenolpyruvate carboxykinase; PPAR, peroxisome proliferator-activated receptor; Rosi, rosiglitazone; RT-PCR, reverse transcription-polymerase chain reaction; SREBP, sterol regulatory element binding protein; TC, total cholesterol; TG, triglyceride; WAT, white adipose tissue

■

REFERENCES

(1) O’Rahilly, S.; Turner, R. C.; Matthews, D. R. Impaired pulsatile secretion of insulin in relatives of patients with non-insulin-dependent diabetes. N. Engl. J. Med. 1988, 318, 1225−1230. (2) Thresher, J. S.; Podolin, D. A.; Wei, Y.; Mazzeo, R. S.; Pagliassotti, M. J. Comparison of the effects of sucrose and fructose on 2488

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489

Article

Journal of Agricultural and Food Chemistry

targeted disruption of the SREBP-1 gene. J. Clin. Invest. 1997, 100, 2115−2124. (40) Staeles, B.; Fruchart, J. C. Therapeutic roles of peroxisome proliferator-activated receptor agonists. Diabetes 2005, 54, 2460−2470. (41) Eggerman, T. L.; Hoeg, J. M.; Meng, M. S.; Tombragel, A.; Bojanovski, D.; Brewer, H. B., Jr. Differential tissue-specific expression of human apoA-I and apoA-II. J. Lipid Res. 1991, 32, 821−828. (42) Gordon, D. J.; Probstfield, J. L.; Garrison, R. J.; Neaton, J. D.; Castelli, W. P.; Knoke, J. D.; Jacobs, D. R., Jr.; Bangdiwala, S.; Tyroler, H. A. High-density lipoprotein cholesterol and cardiovascular disease: four prospective American studies. Circulation 1989, 79, 8−15.

(21) Fryer, L. G.; Parbu-Patel, A.; Patel, A. The anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. J. Biol. Chem. 2002, 277, 25226− 25232. (22) Stein, S. C.; Woods, A.; Jones, N. A.; Davison, M. D.; Carling, D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem. J. 2000, 345, 437−443. (23) Shao, Y. Y.; Chen, C. C.; Wang, H. Y.; Chiu, H. L.; Hseu, T. H.; Kuo, Y. H. Chemical constituents of Antrodia camphorata submerged whole broth. Nat. Prod. Res. 2008, 22, 1151−1157. (24) Shih, C. C.; Lin, C. H.; Lin, W. L. Effects of Momordica charantia on insulin resistance and visceral obesity in mice on high-fat diet. Diabetes Res. Clin. Pract. 2008, 81, 134−143. (25) Shih, C. C.; Lin, C. H.; Wu, J. B. Eriobotrya japonica improves hyperlipidaemia and reverses insulin resistance in high-fat-fed mice. Phytother. Res. 2010, 24, 1769−1780. (26) Shih, C. C.; Ciou, J. L.; Lin, C. H.; Wu, J. B.; Ho, H. Y. Cell suspension culture of Eriobotrya japonica regulates the diabetic and hyperlipidemic signs of high-fat-fed mice. Molecules 2013a, 18, 2726− 2753. (27) Wu, J. B.; Kuo, Y. H.; Lin, C. H.; Ho, Y. H.; Shih, C. C. Tormentic acid, a major component of suspension cells of Eriobotrya japonica, suppresses high-fat diet-induced diabetes and hyperlipidemia by glucose transporter 4 and AMP-activated protein kinase phosphorylation. J. Agric. Food Chem. 2014, 62, 10717−10726. (28) Shih, C. C.; Lin, C. H.; Lin, W. L.; Wu, J. B. Momordica charantia extract on insulin resistance and the skeletal muscle GLUT4 protein in fructose-fed rats. J. Ethnopharmacol. 2009, 123, 82−90. (29) Damci, T.; Tatliagac, S.; Osar, Z.; Ilkova, H. Fenofibrate treatment is associated with better glycemic control and lower serum leptin and insulin levels in type 2 diabetic patients with hypertriglyceridemia. Eur. J. Inter. Med. 2003, 14, 357−360. (30) George, S.; Rochford, J. J.; Wolfrum, C.; et al. A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science 2004, 304, 1325−1328. (31) Berg, J. M.; Tymoczko, J. L.; Stryer. L. Glycolysis and glyconeogenesis. In Stryer Biochemistry; Berg, J. M., Tymoczko, J. L., Eds.; Freeman: New York, 2001; pp 425−464. (32) Mithieux, G.; Guignot, L.; Bordet, J. C.; Wiernsperger, N. Intrahepatic mechanisms underlying the effect of metformin in decreasing basal glucose production in rats fed a high-fat diet. Diabetes 2002, 51, 139−143. (33) Staels, B.; Dallongeville, J.; Auwerx, J.; Schoonjans, K.; Leitersdorf, E.; Fruchart, J.-C. Mechanism of action of fibrates on lipid and lipoprotein metabolism. Circulation 1998, 98, 2088−2093. (34) Shimano, H.; Yahagi, N.; Amemiya-Kudo, M.; Hasty, A. H.; Osuga, J.; Tamura, Y.; Shionoiri, F.; Iizuka, Y.; Ohashi, K.; Harada, K.; Gotoda, T.; Ishibashi, S.; Yamada, N. Sterol regulatory elementbinding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J. Biol. Chem. 1999, 274, 35832−35839. (35) Patel, D. D.; Knight, B. L.; Wiggins, D.; Humphreys, S. M.; Gibbons, G. F. Disturbances in the normal regulation of SREBPsensitive genes in PPAR alpha-deficient mice. J. Lipid Res. 2001, 42, 328−337. (36) Cases, S.; Stone, S. J.; Zhou, P.; Yen, E.; Tow, B.; Lardizabal, K. D.; Voelker, T.; Farese, R. V., Jr. Cloning of DGAT2, a second mammalian diacylglycerol acyltransferase, and related family members. J. Biol. Chem. 2001, 276, 38870−38876. (37) Izumiya, Y.; Hopkins, T.; Morris, C.; Sato, K.; Zeng, L.; Viereck, J.; Hamilton, J. A.; Ouchi, N.; LeBrasseur, N. K.; Walsh, K. Fast/ Glycolytic muscle fiber growth reduces fat mass and improves metabolic parameters in obese mice. Cell Metab. 2008, 7, 159−172. (38) Srivastava, R. A. K. Fenofibrate ameliorates diabetic and dyslipidemic profiles in KKAy mice partly via down-regulation of 11βHSD1, PEPCK and DGAT2. Comparison of PPARα, PPARγ, and liver x receptor agonists. Eur. J. Pharmacol. 2009, 607, 258−263. (39) Shimano, H.; Shimomura, I.; Hammer, R. E.; Herz, J.; Goldstein, J. L.; Brown, M. S.; Horton, J. D. Elevated levels of SREBP-2 and cholesterol synthesis in livers of mice homozygous for a 2489

DOI: 10.1021/acs.jafc.5b00073 J. Agric. Food Chem. 2015, 63, 2479−2489