Bioconjugate Chem. 1994, 5, 268-272
268
Europium-Labeled Oligonucleotide Hybridization Probes: Preparation and Properties Patrik DahlBn, Liisa Liukkonen,+ Marek Kwiatkowski,* Pertti Hurskainen,’ Antti Iitia,+ Harri Siitari, Jyrki Ylikoski,s Veli-Matti Mukkala, and Tim0 Lovgrent Wallac Oy, P.O. Box 10, FIN-20101 Turku, Finland, Department of Biochemistry, University of Turku, FIN-20520 Turku, Finland, and Department of Medical Genetics, Biomedical Center, University of Uppsala, P.O. Box 589, S-75123 Uppsala, Sweden. Received August 20, 1993”
A chemical method for labeling of oligonucleotide probes with europium chelates is presented. A modified deoxycytidine phosphoramidite is used to introduce multiple reactive amino groups to the oligonucleotide during the synthesis phase. Upon deprotection and purification of the modified oligonucleotide, an isothiocyanate derivative of a stable Eu chelate is reacted with the primary amino groups. The labeling technology enables the coupling of a high number of Eu chelates to a single probe. The melting temperatures and hybridization efficiencies of the oligonucleotides are not significantly altered by the labeling process. However, hybridization kinetics of the oligonucleotides are affected by the introduction of multiple modified deoxycytidine residues. In a solid-phase hybridization assay, up to 107 target molecules can be detected.
INTRODUCTION
Synthetic oligonucleotides have become important tools in both research and diagnostic applications as probes for the detection of specific nucleic acid sequences. Oligonucleotides are easy to produce and use, and as a result of the recent development of highly efficient in vitro amplification methods, such as the polymerase chain reaction (PCR) (1, 21, oligonucleotides have become popular as hybridization probes. Most commonly, oligonucleotides are labeled with radioactive labels, such as 32P. However, due to the health hazards and short shelflives associated with radioactive labels, several alternative nonradioactive labeling methods have been developed. Oligonucleotides can be directly labeled with enzymes, fluorophores, or chemiluminescent markers (3-5). Indirect labeling procedures including biotin and hapten labels have also been described (6, 7). Time-resolved fluorometry (TRF) is a nonradioactive measurement technology that enables the sensitive detection of lanthanide chelates (for review see ref 8). The TRF technology has been used in DNA hybridization assays in a wide variety of applications (9-18). Several methods of directly labeling oligonucleotides with lanthanide chelates have been presented (13, 16, 17). Here we describe in detail a method for the preparation of Eu-labeled oligonucleotides. This method involves the use of a 1,6-diaminohexane-modifieddeoxycytidine phosphoramidite which is coupled in a multiple fashion to the oligonucleotide. Upon deprotection and purification of the modified oligonucleotide, the primary amino groups are labeled with Eu in a reaction with an isothiocyanate derivative of a stable Eu chelate (13). Thus a high number of Eu chelates can be conjugated to one oligonucleotide. We have investigated the effect of various degrees of
* T o whom correspondence should be addressed a t Wallac Oy. Tel. Int+358-21-678 439, Fax Int+358-21-678380. ‘University of Turku. t University of Uppsala. 0 Present address: Perkin-Elmer Oy, P.O. Box 34, FIN-02271 Espoo, Finland. Abstract published in Advance ACS Abstracts, April 15, 1994. 1043-1802/94/2905-0268$04.50/0
modifications on the dissociation temperatures (Td’S) and on the hybridization properties of the Eu-labeled probes. MATERIALS A N D METHODS
Synthesis of Diaminohexane-Modified Deoxycytidine Phosphoramidite. Diaminohexane-modified deoxycytidine phosphoramidite was synthesized as described earlier ( 4 )with some modifications. The hydroxyl groups of deoxycytidine hydrochloride (5.27 g, 20 mmol) were protected with 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (8.2 g, 26 mmol) in dry pyridine (200 mL). The protected deoxycytidine was tosylated (19) as follows. Toluene-4-sulfonyl chloride (6.1 g, 32 mmol) and dry diisopropylethylamine (5.5 mL, 32 mmol) were added. The reaction mixture was stirred a t room temperature overnight, and the red mixture was poured into saturated NaHC03 and extracted with CHCl3 (3 X 200 mL). The organic phase was evaporated and coevaporated with toluene. The residue was then purified by short silica gel (40-63 pm, Merck G60) column chromatography using 2 % ethanol in CHC13 in the mobile phase. The product, 4-N-(p-tolylsulfonyl)-3’,5’-0-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)deoxycytidine,has an Rj value of 0.60 using thin-layer chromatography on precoated silica gel plates (60F254, Merck) with a MeOH/CHC&, 10/90 (v/v), solvent system. Yield: 10.25 g (82%). IH-NMR (CDCls): 1.001.10 (m, 28 H); 2.26 (dd, J = 7.0, 13.1 Hz, 1 H); 2.42 (9, 3 H); 2.48-2.57 (m, 1 H); 3.75-3.79 (m, 1 H); 4.00 (dd, J = 2.7,13.4Hz,lH);4.14(d, J = 13.4Hz, 1 H);4.36-4.43 (m, 1 H); 5.98 (d, J = 6.1 Hz, 1 H); 7.30 (2 X d, J = 7.9 Hz, 4 H); 7.82 (d, J = 7.9 Hz, 2 H); 7.84 (d, J = 7.9 Hz, 2 H). Anal. Calcd for C28H45N307SSi2: C, 53.91; H, 7.28; N, 6.74; 0, 17.96; S, 5.13; Si, 8.98. Found: C, 53.79; H, 7.47; N, 6.56. The synthesis was continued by protecting the aliphatic primary amino group with trifluoroacetic anhydride and deprotecting the hydroxyl groups with tetrabutylammonium fluoride. Subsequently, the hydroxyl group in the 5’-position was protected with 4,4’dimethoxytrityl chloride, and the 3’-hydroxyl group was phosphitylated according to standard procedure (20) to give 4-N- [6-(trifluoroacetamido)hexyl]-5’-0-(4,4’@ 1994 American Chemical Society
Bioconjugate Chem., Vol. 5, No. 3, 1994 269
Europium-Labeled Oligonucleotide Probes
Biotinylation of Oligonucleotide N39C1. Ten nmol of the oligonucleotide N39C1 (5' NH2CAGCAGC-
-NHCOCF,
HN
TTCAGTCCCTTTCTCGTCGATGGTCAGCACAGC3')
YAYCH3
H3C CH3
CH,
Figure 1. Structure of the diaminohexane-modified deoxycytidine phosphoramidite. CCOO' N
s=c=N*cH*cH2
