Evaluation of ((4-Hydroxyphenyl) ethyl) maleimide for Site-Specific

Bioconjugate Chem. 2005, 16, 1547−1555

1547

Evaluation of ((4-Hydroxyphenyl)ethyl)maleimide for Site-Specific Radiobromination of Anti-HER2 Affibody Eskender Mume,† Anna Orlova,‡ Barbro Larsson,‡ Ann-Sofie Nilsson,‡ Fredrik Y. Nilsson,‡ Stefan Sjo¨berg,† and Vladimir Tolmachev*,§ Department of Chemistry, Organic Chemistry, Uppsala University, Uppsala, Sweden, Affibody AB, Bromma, Sweden, and Unit of Biomedical Radiation Sciences, Rudbecklaboratoriet, Uppsala University, S-751 85, Uppsala, Sweden. Received February 28, 2005; Revised Manuscript Received August 7, 2005

Affibody molecules are a new class of small phage-display selected proteins using a scaffold domain of the bacterial receptor protein A. They can be selected for specific binding to a large variety of protein targets. An affibody molecule binding with high affinity to a tumor antigen HER2 was recently developed for radionuclide diagnostics and therapy in vivo. The use of the positron-emitting nuclide 76 Br (T1/2 ) 16.2 h) could improve the sensitivity of detection of HER2-expressing tumors. A sitespecific radiobromination of a cysteine-containing variant of the anti-HER2 affibody, (ZHER2:4)2-Cys, using ((4-hydroxyphenyl)ethyl)maleimide (HPEM), was evaluated in this study. It was found that HPEM can be radiobrominated with an efficiency of 83 ( 0.4% and thereafter coupled to freshly reduced affibody with a yield of 65.3 ( 3.9%. A “one-pot” labeling enabled the radiochemical purity of the conjugate to exceed 97%. The label was stable against challenge with large excess of nonlabeled bromide and in a high molar strength solution. In vitro cell tests demonstrated that radiobrominated affibody binds specifically to the HER2-expressing cell-line, SK-OV-3. Biodistribution studies in nude mice bearing SK-OV-3 xenografts have shown tumor accumulation of 4.8 ( 2.2% IA/g and good tumor-tonormal tissue ratios.

INTRODUCTION

Radionuclide tumor targeting uses molecular recognition of tumor-associated structures for the selective delivery of diagnostic or therapeutic nuclides to tumor sites. Molecular recognition has mainly been associated with the use of monoclonal antibodies and their products or of peptide receptor ligands and their analogues. During last years, nonpeptide small molecular weight ligands for receptors and enzymes attracted attention as potential targeting agents as well. Development in this area has enabled the production of targeting molecules with excellent specificity and high binding affinity. Still, each approach has its disadvantages. Monoclonal antibodies are relatively bulky proteins, and this bulkiness limits blood clearance rate, extravasation, and tumor penetration. The use of receptor ligands is restricted in terms of target selection to receptors that are overexpressed in tumors. Sometimes, receptor ligands possess strong agonistic action, and efforts should be made in order to develop antagonistic analogues or provide high specific radioactivity of targeting conjugates. A possible alternative in creating new targeting vectors is to use phage display technology (1). One variant of phage display proteins, termed affibody molecules (2, 3), uses the domain scaffold of the immunoglobulin-binding Staphylococcal receptor protein A. This 58-amino acid* To whom correspondence should be addressed. Phone: + 46 18 471 34 14, FAX: + 45 18 471 34 32, e-mail: [email protected]. † Department of Chemistry, Organic Chemistry, Uppsala University. ‡ Affibody AB. § Unit of Biomedical Radiation Sciences, Rudbecklaboratoriet, Uppsala University.

long cysteine-free protein provides a robust framework, independent of disulfide bonds for its folding. The small size (about 7 kDa in monomeric and about 15 kDa in dimeric form) of affibody molecules enables fast blood clearance and good tumor penetration. Randomization of 13 solvent-accessible surface residues of the protein A domain was used to create a library containing about 109 members, enabling the isolation of high-affinity ligands for virtually any tumor-associated protein target. The selection of the affibody ZHER2:4, which binds with high specificity and affinity of 50 nM to the HER2/neu receptor, was recently reported by Wikman and coworkers (4). Dimerization of ZHER2:4 enabled to obtain affinity of 3 nM (22). This HER2/neu receptor is often overexpressed in a number of carcinomas, such as breast, ovarian, and urinary bladder cancer (5-7). The prognostic and predictive values of HER2/neu receptor overexpression are well documented (6, 8, 9), and HER2 imaging can provide important information that can influence patient management. Preliminary biodistribution and imaging data for ZHER2:4 derivatives labeled with 125 I (10) confirmed the utility of affibody molecules for tumor diagnostics. It is reasonable to assume that the use of positronemitting labels may improve quality of targeted diagnostics due to the better sensitivity and resolution of positron emission tomography (PET) in comparison to those of other radionuclide imaging modalities (11). A possible candidate radionuclide for labeling affibody molecules is 76Br. Its half-life of 16.2 h matches the fast kinetics of affibody molecules well, and it can easily be produced using cyclotrons available at PET centers (12). When a radionuclide is to be selected as a label, its labeling chemistry should be carefully considered. Though the radiobromination of proteins or peptides is not as

10.1021/bc050056o CCC: $30.25 © 2005 American Chemical Society Published on Web 10/27/2005

1548 Bioconjugate Chem., Vol. 16, No. 6, 2005 Scheme 1. Labeling of HPEM and Conjugation of the Labeled Product, 2, to His6-(ZHER2:4)2-Cysa

Mume et al. Scheme 2. Synthesis of HPEM, Chromatography Standard, 8a

1,

and

the

a Reagents and conditions: (i) 76Br-, Chloramine-T, MeOH/ HOAc, RT; (ii) His6-(ZHER2:4)2-Cys, pH 6.

well-studied as is radioiodination, some experience has been amassed pertaining to bromine-75, bromine-76, and bromine-77. Radiobromine can be attached to proteins either directly to tyrosine residues, using peroxidases (13-15) and Chloramine-T (16) as oxidants, or indirectly by labeling several precursors and subsequent coupling to the -amino groups of lysine residues (17-21). However, both lysines and tyrosines can appear in the binding regions of the selected affibody candidates, and their modification may therefore reduce the binding affinity. In fact, direct radioiodination of ZHER2:4 led to loss of HER2 binding (22), while some labeling methods directed to lysines decreased such binding. For this reason, it would be useful to develop a method for conjugating radiobromine to affibody molecules in a site-specific manner. The approach used in this study exploits the fact that cysteine residues have been excluded from the affibody selection library. This allows us to introduce, using genetic engineering, a unique cysteine residue at Cterminal of the selected affibody molecules and to use the thiol group for the coupling of a radiobrominated precursor. As a model, a dimeric cysteine-containing variant of ZHER2:4, (ZHER2:4)2-Cys, was created for this study. A maleimide derivative of tyramine, ((4-hydroxyphenyl)ethyl)maleimide (HPEM) (1) (see Scheme 1), was selected as a bifunctional linker for attaching radiobromine to the cysteine-containing affibody. Use of this compound for the radioiodination of radioimmunoconjugates was reported in an abstract (23), but no details concerning synthesis or characterization were provided. The present study explores the labeling chemistry of the indirect site-specific radiobromination of cysteinecontaining affibody molecules using HPEM and evaluates the tumor-targeting properties of cysteine-containing (ZHER2:4)2-Cys, both in vitro and in vivo. EXPERIMENTAL PROCEDURES

Material. Organic solvents were purchased from Merck (Darmstadt, Germany), and Chloramine-T (CAT) and sodium metabisulfite from Sigma Chemical Company (St. Louis, MO); all chemicals were of analytical grade or higher. Acetate buffer (0.1 M, pH 5) was prepared using sodium acetate and acetic acid (Merck, Darmstadt, Germany). Phosphate-buffered saline (PBS, 5 mM, pH 7.4) was prepared from Na2HPO4‚10H2O, NaH2PO4‚H2O, and NaCl, all of analytical grade (Merck, Darmstadt, Germany). High-quality Milli-Q water (resistance > 18 MΩ/cm) was used in preparing solutions and buffers. Solutions of CAT, sodium metabisulfite, and ((4-hydroxyphenyl)ethyl)maleimide were prepared immediately before use. Merck silica gel 60 (230-400 mesh) was used for column chromatography. Thin-layer chromatography

a Reagents and conditions: (iii) Br , AcOH, RT; (iv) maleic 2 anhydride, acetic anhydride, KOAc, THF; (v) Amberlyst-15, MeOH.

(TLC) was performed using Merck Silica 60 F254 gel, and compounds were visualized with UV (254 nm) or by developing the plates with ninhydrin/acetic acid (0.4/4 w/w% in n-butanol) followed by heating. Tetrahydrofuran (THF) was dried according to standard methods. Instrumentation. Radioactivity measurements were carried out with an ultrapure germanium detector (ORTEC, Oak Ridge, TN) connected to a 8192-channel, PC-based multichannel analyzer (The Nucleus Inc., Oak Ridge, TN). The detector was calibrated for energy and efficiency with a standard 152Eu source. Dead-time losses were always below 10% during measurements. Alternatively, the radioactivity was measured with the automatic 1480 WIZARD 3” Gamma Counter (Wallac) equipped with 3-in. NaI(Tl) well detector using a measurement protocol with an energy window of 300-2047 keV. The 1 H and 13C spectra were recorded in CDCl3 (7.26 ppm 1 H, 77.0 ppm 13C) on a Varian Unity 400 spectrometer operating at 400 and 100.6 MHz, respectively, or on a Varian Unity 500 spectrometer operating at 500 and 125 MHz, respectively. Melting points were determined on a Buchi capillary melting point apparatus and are uncorrected. High-resolution mass spectroscopy (HRMS) was conducted at the Organisch Chemisches Institut der Universitaet Muenster, Germany, for compounds 1-7 and on a Thermoquest GCQ GC/MS instrument, using the electron impact (EI), direct inlet mode for compound 8. High-performance liquid chromatography (HPLC) was conducted with a Gilson Model 322 pump and UV/VIS152 detector. HPLC chromatography was carried out using an ODS C-18 HPLC column 150 × 20 mm ID, 5 µm at a flow rate of 5 mL/min. Spectrophotometer analysis of the HPLC effluent was performed by means of UV detection at 254 nm. Distribution of radioactivity along the TLC and instant thin-layer chromatography (ITLC) strips was measured using the Cyclone Storage Phosphor System and analyzed with the OptiQuant image analysis software. Size-exclusion chromatography was performed on disposable NAP-5 columns (Amersham Pharmacia Biotech AB, Uppsala; Sweden) according to the manufacturer’s instructions. Synthesis of HPEM (1) and of the Chromatography Standard, 1-[2-(3-Bromo-4-hydroxyphenyl)ethyl]-1H-pyrrole-2,5-dione (8) (Scheme 2). 4-(2Aminoethyl)-2-bromophenol (5). A solution (0.7 M) of bromine in carbon tetrachloride (1.51 g, 9.46 mmol) was added dropwise to a stirred solution of tyramine (0.649 g, 4.73 mmol) in 15 mL acetic acid over 13 min. Analysis by means of nuclear magnetic resonance (NMR) indicated that the tyramine was fully consumed after 20 min at RT. The solvent was evaporated, and the residue was

Thiol-Specific Radiobromination of Affibody Molecules

dissolved in 0.5 g K2CO3/MeOH and stirred for 10 min; thereafter the salt was filtered off and the mixture was concentrated under a vacuum. The crude product was filtered through a short plug of silica to afford a white solid of bromide 5 along with a dibromide, (4-(2-aminoethyl)-2,6-dibromophenol). This was further purified by RP-HPLC, holding 100% (0.05% formic acid in water) for 5 min, followed by a gradient of 100% (0.05% formic acid in water)/0% acetonitrile (0.05% formic acid in acetonitrile), changing to 100% acetonitrile (0.05% formic acid in acetonitrile) over 35 min, to give 0.394 g of compound 5 as white crystals, mp ) 152-155 °C, in 41% yield. 1H NMR (CD3OD): δ 7.39 (d, 1H, benz), 7.07 (dd, 1H, benz), 6.87 (d, 1H, benz), 3.10 (t, 2H, NCH2), 2.84 (t, 2H, CH2); 13 C NMR (CD3OD): δ 153.5, 133.1, 129.1, 128.8, 116.4, 109.9, 40.7, 32.2. HRMS(m/z): calcd for [C8H10BrNO + H+], 216.0019; found, 215.9988. 4-[2-(2,5-Dioxo-2,5-dihydro-1H-pyrrol-1-yl)ethyl]phenyl Acetate (6). Maleic anhydride (0.452 g, 4.63 mmol) was added to a stirred solution of tyramine (0.529 g, 3.86 mmol) in 50 mL of dry THF at 40 °C. The solution mixture was stirred overnight at 40 °C under an argon atmosphere. The solvent was then evaporated under reduced pressure. Acetic anhydride (125 mL) and potassium acetate (1.47 g, 15.3 mmol) were added to the white solid residue, and the mixture was stirred at 90 °C for 1 h. After this, the black reaction mixture was stirred at RT overnight. The solvent was evaporated under reduced pressure, and the residue was dissolved in CH2Cl2 and then washed three times with water and once with saturated NaHCO3. The organic phase was dried over anhydrous Na2SO4 and filtered, and then the solvent was removed under reduced pressure. The resulting crude product was purified by flash chromatography (10:1%, CH2Cl2:Et2O as the mobile phase) to afford 0.660 g of 6 as white crystals, mp ) 96-97 °C, in 66% yield. 1H NMR (CDCl3): 7.21 (2H, m, AA′ part of AA′XX′, benz), 7.01 (2H, m, XX′ part of AA′XX′, benz), 6.66 (s, 2H, CHdCH-), 3.75 (t, 2H, NCH2), 2.90 (t, 2H, CH2), 2.28 (s, 3H, COCH3); 13 C NMR (CDCl3): δ 170.7, 169.6, 149.7, 135.6, 134.3, 130.0, 121.9, 39.2, 34.1, 21.3. HRMS(m/z): calcd for [C14H13NO4 + Na+], 282.0737; found, 282.0711. 2-Bromo-4-[2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)ethyl]phenyl Acetate (7). Compound 7 was synthesized using the same procedure as for compound 6, except that 4-(2aminoethyl)-2-bromophenol (0.135 g, 0.63 mmol) replaced tyramine and a temperature of 60 °C and a reaction time of 11 h were used. The crude product was purified using flash chromatography using neat CHCl3 as a mobile phase to produce 7 with some impurities; this was then further purified using RP-HPLC, holding 100% (0.05% formic acid in water) for 5 min, followed by a gradient of 100% (0.05% formic acid in water)/0% acetonitrile (0.05% formic acid in acetonitrile), changing to 100% acetonitrile (0.05% formic acid in acetonitrile) over 60 min, to provide 0.098 g of 7, as a white solid, in 46% yield. 1H NMR (CDCl3): δ 7.47 (d, 1H, benz), 7.18 (dd, 1H, benz), 7.05 (d, 1H, benz), 6.68 (s, 2H, CHdCH), 3.74 (t, 2H, NCH2), 2.88 (t, 2H, CH2), 2.34 (s, 3H, COCH3); 13C NMR (CDCl3): δ 170.7, 168.8, 147.2, 137.6, 134.3, 133.8, 129.1, 123.9, 116.4, 38.9, 33.9, 21.0. HRMS(m/z): calcd for [C14H12BrNO4 + Na+], 359.9842; found, 359.9834. 1-[2-(4-Hydroxyphenyl)ethyl]-1H-pyrrole-2,5-dione (1). Amberlyst-15 (0.400 g) was added to a stirred solution of compound 6 (0.300 g, 1.16 mmol) in MeOH (30 mL), and the mixture was stirred at 55 °C for 4 h. The starting material was fully consumed according to TLC. The catalyst was filtered off and washed with MeOH/CH2Cl2 (2 × 3 mL). The filtrate was concentrated under reduced

Bioconjugate Chem., Vol. 16, No. 6, 2005 1549

pressure. The resulting crude product was purified using flash chromatography with a dichloromethane-diethyl ether gradient (100% CH2Cl2:0% Et2O to 90% CH2Cl2: 10% Et2O) as a mobile phase to give 0.244 g of 1 as white crystals, mp ) 144-145 °C, in 97% yield. 1H NMR (CDCl3): 7.05 (2H, m, AA′ part of AA′XX′, benz), 6.75 (2H, m, XX′ part of AA′XX′, benz), 6.65 (s, 2H, CHdCH), 3.72 (t, 2H, NCH2), 2.82 (t, 2H, CH2); 13C NMR (CDCl3): δ 170.9, 154.5, 134.3, 130.3, 130.2, 115.6, 39.5, 33.8. HRMS(m/z): calcd for [C12H11NO3 + Na+], 240.0631; found, 240.0613. 1-[2-(3-Bromo-4-hydroxyphenyl)ethyl]-1H-pyrrole-2,5dione (8). Compound 8 was synthesized using the same procedure as was used for compound 1, except that compound 7 (34 mg, 0.10 mmol) was used as the starting material. The crude product was purified by means of flash chromatography using neat CHCl3 as a mobile phase to give 26 mg of compound 8, as a white solid, in 87% yield. 1H NMR (CDCl3): δ 7.32 (d, 1H, benz), 7.10 (dd, 1H, benz), 6.95 (d, 1H, benz), 6.69 (s, 2H, CHdCH), 3.73 (t, 2H, NCH2), 2.83 (t, 2H, CH2); 13C NMR (CDCl3): δ 170.7, 151.2, 134.3, 132.3, 131.7, 129.8, 116.3, 39.2, 33.6. MS(m/z): calcd for [C12H10BrNO3 + H+], 295.99; found, 294.52. Production of (ZHER2:4)2-Cys. The selection of a novel affibody ligand, denoted ZHER2:4, binding to HER2, was previously described (10). The dimeric form of ZHER2:4, from now on called (ZHER2)2, was constructed by subcloning the gene fragment encoding the ZHER2 protein (10) into the expression vector pAY81-ZHER2. The fragment was then digested with XhoI (ER0691, Fermentas, Vilnius, Lithuania) and SalI (ER0641, Fermentas) and ligated into the pAY81-ZHER2 vector, previously restricted with SalI to form pAY321 (22). In the present study, a C-terminal cysteine was introduced to form the clone pAY393 (pAY243-(ZHER2)2-Cys) in the following way. A PCR product of the affibody molecule was generated from plasmid pAY321 (pAY81-(ZHER2)2) with forward primer AFFI-77 (5′gccgctcgaggtagacaacaaattcaacaaag), introducing a XhoI restriction site, and reverse primer AFFI-223 (5′gatctgctgcagttagcatttcggcgcctgagcatcatttag), introducing a C-terminal cysteine and a PstI restriction site downstream. Using as template a dimer consisting of two repetitive monomers, the PCR generated a monomeric and a dimeric version of the affibody molecule corresponding to ZHER2. The dimer band was extracted from a preparative agarose gel using the QIAquick gel extraction kit (QIAGEN GmbH, Germany). The affibody fragment, (ZHER2)2-Cys, and the expression vector, pAY243, were digested using XhoI and PstI, purified with the QIAquick PCR purification kit (QIAGEN GmbH, Germany), subsequently ligated with T4 DNA ligase, and transformed into the Escherichia coli strain BL21(DE3). The cells were plated on TBAB plates supplemented with 50 µg/mL kanamycin, and positive clones containing the introduced (ZHER2)2-Cys fragment were verified by means of DNA sequencing on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Escherichia coli strain RRI∆M1510 was used as bacterial host during the cloning procedure. The resulting vector, pAY393 (pAY243-(ZHER2)2-Cys), encodes the bivalent affibody, (ZHER2)2, fused to a C-terminal cysteine for thiol coupling and an N-terminal hexahistidyl (His6) tag, allowing purification by immobilized metal ion affinity chromatography (IMAC). The bivalent affibody protein was expressed as an His6tagged fusion protein in E. coli strain BL21(DE3) and recovered by means of IMAC purification on a TALON Metal Affinity Resin (8901-2, BD Biosciences, CA) column

1550 Bioconjugate Chem., Vol. 16, No. 6, 2005

under denaturing conditions, as described earlier (22). Renaturation of the purified fusion protein, the bivalent affibody, was performed by gel filtration using PD-10 columns, equilibrated with PBS (10 mM phosphate, 154 mM NaCl, pH 7.1), according to the manufacturer’s protocol (Amersham Biosciences, Uppsala, Sweden). Protein concentration was calculated from absorbance measurements made at 280 nm using the extinction coefficient (30440 M-1 cm-1). The purified protein was further analyzed by SDS-PAGE on a Tris-Glycine 16% homogeneous gel, using a Novex system (Novex, CA). Radiobromine Production. A mixture of bromine radioisotopes was used for the radiobromination study. These nuclides were produced by irradiating copper(II) selenide of natural isotopic composition with 40-MeV protons. Radioactivity measurements of the irradiated targets and produced radiobromine were carried out using gamma-spectroscopy, as it was described in the Instrumentation section. The proton bombardment induces the bromine isotopes 77Br, 76Br, and 82Br, as well as a number of radioisotopes of copper, zinc, selenium, and arsenic, in the target material. Radiobromine was separated from the target by dry distillation coupled with on-line thermochromatography purification (12) and was obtained as a no-carrier-added bromide solution in 200400 µL of ultrapure Milli-Q water. No radioactive nuclides other than bromine isotopes were found in the product. Typical production batch contained 290 MBq 77 Br, 228 MBq 76Br, and 6 MBq 82Br at the end of separation. Measurements of specific radioactivity were not performed for this preparation. Earlier, we produced 76 Br using the same technique. The specific activity of the product was about 40 times lower than theoretical value, 200 GBq/µmol (24). Presence of fairly long-lived 77 Br (T1/2 ) 57 h) enabled the use of the radioactivity of a single batch for up to several days after radionuclide production. Radiobromination of ((4-Hydroxyphenyl)ethyl)maleimide (HPEM). The precursor molecule was radiobrominated using CAT as oxidant. An initial series of experiments was performed using 0.1% acetic acid in water, 1% acetic acid in methanol, and 5% acetic acid in methanol as reaction media. Typically, 3 µL of radiobromide were mixed with 10 µL of solvents and 5 µL of HPEM solution in methanol (varying concentrations), and CAT was added in 10 µL of water (varying concentrations). The reaction proceeded for a predetermined time and then was quenched by a double excess of sodium metabisulfite in 10 µL of water. Since the use of 5% acetic acid in methanol provided the best yields, this solvent was selected for further experiments. Labeling-yield dependence on the amount of added CAT and HPEM, and on reaction time, was determined by varying one parameter at a time. Typical reaction conditions were as follows: 5 µL of HPEM solution in 5% acetic acid in methanol was mixed with 3 µL of 76,77Br in Milli-Q water in an Eppendorf tube (1.5 mL). To this mixture was added 10 µL of CAT solution in 5% acetic acid in methanol. The HPEM amount varied between 0.031 and 20 µg (0.144 and 92 nmol), and the CAT amount varied between 0 and 80 µg (283 nmol). The tube was agitated throughout the reaction time, which ranged from 5 to 20 min. The reaction was terminated by adding 10 µL of sodium metabisulfite solution in water, given in double molar excess to CAT. All experiments were made at least in duplicate. Varying CAT Amount. When the amount of CAT was varied, the amount of added HPEM remained constant at 5 µg and the reaction time was 5 min.

Mume et al.

Varying ((4-Hydroxyphenyl)ethyl)maleimide Amount. When the amount of HPEM was varied the amount of added CAT remained constant at 40 µg and the reaction time was 15 min. Blank experiments were performed, when 5% acetic acid in methanol was used instead of HPEM. Varying Reaction Time. When the reaction time was varied the amount of added HPEM remained constant at 5 µg and the amount of added CAT was 40 µg. Silica gel 60 F254 TLC plates (20 × 100 mm, elution path 80 mm, E. Merck, Darmstadt, Germany) were used for analysis. Neat acetonitrile was used for elution. For the analysis, 1-2 µL of the reaction mixture was applied on a TLC plate, which was then left to evaporate spontaneously before being developed in freshly prepared eluent. Conjugation of Radiobrominated ((4-Hydroxyphenyl)ethyl)maleimide to His6-(ZHER2:4)2-Cys. Before labeling, affibody solution was treated with dithiothreitol (DTT, E. Merck, Darmstadt, Germany) in order to reduce spontaneously formed disulfide bonds. Typically, 0.5 mL of stock affibody solution (1 mg/mL in citrate-phosphate buffer, pH 4.5) was mixed with 10 µL of DTT (1 M solution in water, freshly prepared) and incubated for 40 min at 37 °C. Thereafter, the mixture was applied to NAP-5 size-exclusion columns, preequilibrated, and eluted with well-degassed 0.1 M acetate buffer, pH 6.0; the first 900 µL of the high-molecular-weight (HMW) fraction were used for labeling. Reduced affibody was used for labeling within 10-15 min after reduction. ((4-Hydroxyphenyl)ethyl)maleimide was radiobrominated for conjugation as previously described. A small sample (0.5 µL) of the reaction mixture was taken for radio-TLC analysis. (ZHER2:4)2-Cys was added in an equimolar amount to HPEM, and the mixture was incubated at RT. At predetermined times (10 and 30 min), aliquots were taken, and the overall labeling yield was determined by size-exclusion chromatography as the ratio of radioactivity in the HMW fraction to the sum of the radioactivity in the HMW fraction, in the low-molecular-weight fraction (LMW) and on the column. Conjugation yield was calculated by correcting overall labeling yield for the yield of HPEM radiobromination. All experiments were performed in duplicate. Radiochemical purity of the labeled affibody was controlled using the ITLC SG strip (Pall Life Sciences, New York, NY) eluted with 70% acetone in water. To verify that the labeling was associated with HPEM, blank experiments were performed in duplicate. In this case, 5% acetic acid in methanol was used instead of the HPEM solution, but all manipulations were the same as in the case of HPEM labeling. To verify that coupling of radiobrominated ((4-hydroxyphenyl)ethyl)maleimide is directed to SH-group of cysteine, a control experiment was performed using subclone (ZHER2:4)2, which does not contained cysteine. All other manipulations were the same as for (ZHER2:4)2-Cys. Stability Test. The in vitro stability of radiobromine binding to (ZHER2:4)2-Cys was assessed by using 8 M urea to achieve high ion strength and 1 M NaBr to challenge with an excess of nonradioactive bromine. The labeling was performed according to the method described above. To Eppendorf tubes (1.5 mL) containing 1 mL of each of the stability test solutions was added 100 µL of radiobrominated (Z HER2:4)2-Cys. The tubes were shaken vigorously for 15 s. The NaBr and urea solutions were kept at RT for 1.5 h of gentle agitation, and a fraction of 100 µL was taken for analysis. The samples were analyzed using size-exclusion chromatography, and the portion of

Thiol-Specific Radiobromination of Affibody Molecules

radioactivity in the LMW fraction was assumed to have resulted from release of the label. All tests were performed in duplicate. Binding Specificity of Labeled Conjugates to HER2-Expressing Cells. Binding specificity of the obtained conjugates was tested on HER2-expressing SKOV-3 ovarian cancer cells. Labeled conjugate was added to two groups of Petri dishes (3-4 dishes, L 3.5 cm, 2-5 × 105 cells per dish). One group of dishes in each experiment was presaturated with a 1000-fold excess of nonlabeled affibody 10 min before the labeled affibody was added. Cells were incubated with labeled conjugate for 2 h at 37 °C; the incubation media was then collected. Cell dishes were washed 6 times with cold serum-free medium and then treated with 0.5 mL of trypsin-EDTA solution (0.05% trypsin, 0.02% EDTA in buffer, Flow Irvine, UK) for 10 min at 37 °C. When cells were detached, 1 mL of complete medium was added to every dish and the cells were resuspended. Of this cell suspension, 0.5 mL was used for cell counting and 1 mL for radioactivity measurements, along with 1 mL of the corresponding incubation medium. Biodistribution Studies. The animal study was approved by the local Ethics Committee for Animal Research. Female outbreed BALB/c nu/nu mice (10-12 weeks old at arrival) were acclimatized for one week at the Rudbeck Laboratory animal facility before subcutaneous (sc) injection of ∼5 × 106 SK-OV-3 cells in the left hind leg. Xenografts were allowed to become established for two months. Groups of four animals were used for the biodistribution study. All mice were subcutaneously injected with ∼50 µL (approximately 100 kBq, 0.8 µg) of radiolabeled affibody. After 4 h, the mice were anesthetized and sacrificed by heart puncture. Blood was collected using heparinized syringes (heparin 5000 IE/mL, from Leo Pharma, Ko¨penhamn, Denmark), while organs (heart, lung, liver, spleen, pancreas, kidney, stomach, muscle, and brain) and tumors were excised, and their radioactivity content was measured. Percent of injected dose per gram tissue (%IA/g) was calculated by dividing the radioactivity in a tissue by the average radioactivity in three control syringes, minus the radioactivity left in the syringe after injection and divided by the organ weight. Since results of biodistibution study have demonstrated unusually low uptake of radioactivity in kidneys, a control experiment was performed with no-cysteinecontaining clone (ZHER2:4)2, which has been indirectly radiobrominated using N-succinimidyl 4-bromobenzoate (PBrB-(ZHER2:4)2). Labeling was done according to Ho¨glund and co-workers (18). Study protocol was the same as for HPEM-labeled affibody, but no-tumor-bearing nude mice were used in this study. RESULTS

The synthesis of HPEM (1) and the chromatography standard 1-[2-(3-bromo-4-hydroxyphenyl)ethyl]-1H-pyrrole-2,5-dione (8) was carried out as outlined in Scheme 2 (see Material and Methods). Electrophilic bromination of commercially available tyramine (4) with bromine in carbon tetrachloride in the presence of acetic acid gave bromide, 5, along with the dibromide, (4-(2-aminoethyl)2,6-dibromophenol). Compound 5 (yield 41%) was isolated by reverse phase (RP). Tyramine (4) and 4-(2-aminoethyl)-2-bromophenol) (5) were reacted with maleic anhydride in dry tetrahydrofurane (THF) above room temperature (RT). The crude product was purified using column chromatography to give a 66% yield of compound

Bioconjugate Chem., Vol. 16, No. 6, 2005 1551

Figure 1. Dependence of bromination yield on amount of CAT. Other conditions: HPEM 5 µg; reaction time 5 min.

Figure 2. Dependence of bromination yield on amount of HPEM. Note the logarithmic scale. Other conditions: CAT 40 µg; reaction time 15 min.

6. Compound 7 (yield 46%) was isolated using RP-HPLC. The aryl acetates, 6 and 7, were converted to the corresponding phenols, 1 and 8, respectively, by means of methanolysis in the presence of Amberlyst-15, using the methodology developed by Das and co-workers (25). After completion of the reaction, Amberlyst-15 was easily removed from the reaction mixture by filtration to give a high yield of the parent phenols. The following solutions were evaluated as reaction media for radiobromination of HPEM: 0.1% acetic acid in water, 1% acetic acid in methanol, and 5% acetic acid in methanol. The use of 0.1% acetic acid in water provided yields of about 40%, and increasing either amount of oxidant or reaction time resulted in no increase of labeling yield. The use of acidified methanol solutions enabled us to obtain, while using the same reactant concentration, yields of about 60% using 1% acetic acid in methanol and of about 70% using 5% acetic acid in methanol. Further experiments were performed using 5% acetic acid in methanol as a solvent. Influence of oxidant amount on HPEM radiobromination efficiency is shown in Figure 1. The use of 10 µg of CAT provided a maximum labeling efficiency of 83 ( 0.4% when 5 µg of HPEM was radiobrominated for 5 min. Increasing the amount of oxidant to 40 µg did not increase yield. Further increase of CAT even decreased the yield somewhat (Figure 1), presumably due to the overoxidation of radiobromine. Dependence of radiobromination yield on amount of substrate showed two distinct segments (Figure 2). Up to approximately 5 µg of HPEM, labeling yield increased proportionally to the amount of substrate. Thereafter, even a 4-fold increase in the amount of HPEM caused no significant improvement in labeling yield. An important feature of this is that the ascendant part of the curve

1552 Bioconjugate Chem., Vol. 16, No. 6, 2005

Figure 3. Dependence of bromination yield on reaction time. Other conditions: CAT 40 µg; HPEM 5 µg.

is rather shallow, with yields exceeding 50% even with the use of sub-microgram amounts of substrate. No peak corresponding to brominated HPEM was observed when neat 5% acetic acid in methanol was added to the reaction mixture instead of to the HPEM solution. This blank experiment confirms our interpretation of the radio-TLC data. Electrophilic radiobromination of HPEM seems to be a rather rapid reaction at RT (Figure 3). For 5 µg of HPEM, the maximum yield of 75.9% was obtained in 5 min. Prolongation of reaction time did not increase the yield. Coupling to the affibody molecule was performed without intermediate purification of radiobrominated HPEM. Freshly prepared reduced His6-(ZHER2:4)2-Cys in acetate buffer, pH 6.0, was added to the reaction mixture and incubated at RT. With approximately equimolar amounts of HPEM and His6-(ZHER2:4)2-Cys, conjugation yield was 29.3 ( 2.4% after 10 min of incubation and 65.3 ( 3.9% after 30 min. According to ITLC analysis, the radiochemical purity of the conjugate was >97%. Blank experiments, where no HPEM was added into the reaction mixture, or no-cysteine-containing affibody variant His6-(ZHER2:4)2 was used, did not show any labeling. It can be concluded that labeling was HPEM-mediated and cysteine-specific. Stability of the label was tested by challenge with a high concentration of cold sodium bromide and by exposure to a high molar strength solution (8 M urea). After separating the test mixture on a NAP-5 size-exclusion column, radioactivity in the LMW fraction was 3.8 ( 0.9% for the sodium bromide test and 2.2 ( 0.35% for the urea test. Given the results of the ITLC testing (radiochemical purity of 98%), we can conclude that radiobromine was stably attached to affibody. To ensure that the HER2 binding capacity of the affibody was retained after labeling, the labeled affibody was incubated with SK-OV-3 cells, which express HER2/ neu antigen (as described in Experimental Procedures). The data concerning the cell-binding test are given in Figure 4. It was found that 41.6 ( 5.3% and 0.64 ( 0.02% of added radioactivity was bound to the nonblocked and blocked cells, respectively (p < 0.001). The results of the test demonstrated the specific binding of the antibody to antigen-expressing cells, since it can be displaced by nonradioactive antibody. Biodistribution of radiobrominated affibody dimer in nude mice with grafted HER2-expressing SK-OV-3 tumors was performed at 4 h postinjection (pi). Radioactivity uptake in the tumors was 4.88 ( 1.59% IA/g. The blood level of radioactivity was low at 0.54 ( 0.03% IA/ g. Radioactivity accumulation in other organs and tissues

Mume et al.

Figure 4. Antigen binding test. The test was performed on the ovarian cancer cell line, SK-OV-3. For presaturation of antigens, a 1000-fold molar excess of nonradioactive affibody was added. Cells were incubated with radiobrominated (ZHER2: 4)2 for 2 h and then washed six times. Data are presented as mean values from three dishes and maximum errors. Table 1. Biodistribution of *Br-HPEM-His6-(ZHER2:4)2-cys and *Br-benzoyl-His6-(ZHER2:4)2 in Nude Mice, 4 h pia,b HPEM-(ZHER2:4)2-Cys

PBrB-(ZHER2:4)2

p value

0.54 ( 0.03 0.44 ( 0.11 0.56 ( 0.07 1.32 ( 0.31 0.36 ( 0.06 0.27 ( 0.09 1.04 ( 0.17 0.76 ( 0.69 4.88 ( 1.59 0.17 ( 0.05 0.14 ( 0.04

0.34 ( 0.05 0.30 ( 0.18 0.45 ( 0.10 0.22 ( 0.03 0.29 ( 0.04 0.27 ( 0.10 7.43 ( 1.64 0.39 ( 0.06 no tumors 0.20 ( 0.09 0.11 ( 0.02

0.0004

blood heart lung liver spleen pancreas kidney stomach tumor muscle brain

0.0004 0.0003

a Biodistribution of *Br-HPEM-His -(Z 6 her2:4)2-cys was performed on BALB/c nu/nu mice bearing SK-OV-3 xenograft. Average tumor weight was 0.029 ( 0.12 g. Biodistribution of *Br-PBrB-His6(ZHER2:4)2 was performed on tumor-free animals of the same strain. b Each data point represents an average from four animals, ( standard deviation, and expressed as percent of injected radioactivity per gram of organ or tissue.

was also low, typically