Exploring Endocytosis and Intracellular Trafficking of the Human

Subscriber access provided by UNIV OF LOUISIANA

Article

Exploring Endocytosis and Intracellular Trafficking of the Human Serotonin Receptor 1A

G. Aditya Kumar, Parijat Sarkar, Md. Jafurulla, Shishu Pal Singh, Gunda Srinivas, Gopal Pande, and Amitabha Chattopadhyay Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.9b00033 • Publication Date (Web): 21 Mar 2019 Downloaded from http://pubs.acs.org on March 22, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Exploring Endocytosis and Intracellular Trafficking of the Human Serotonin1A Receptor

G. Aditya Kumar,† Parijat Sarkar,† Md. Jafurulla,† Shishu Pal Singh,‡ Gunda Srinivas,† Gopal Pande† and Amitabha Chattopadhyay†,*

†

CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500 007, India ‡ National Centre for Biological Sciences, UAS-GKVK Campus, Bellary Road, Bangalore 560 065, India

Abbreviations: 8-OH-DPAT, 8-hydroxy-2-(di-N-propylamino)tetralin; BCA, bicinchoninic acid; DiIC16, 1,1'-dihexadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate; GPCR, G protein-coupled receptor; GTP-γ-S, guanosine-5'-O-(3thiotriphosphate); MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; p-MPPF, 4-(2'-methoxy)-phenyl-1-[2'-(N-2''-pyridinyl)-p-fluorobenzamido]ethylpiperazine; p-MPPI, 4-(2'-methoxy)-phenyl-1-[2'-(N-2''-pyridinyl)-p-iodobenzamido]ethylpiperazine; SSRI, selective serotonin reuptake inhibitor; WAY-100635, N-(2-(1-(4-(2methoxyphenyl)-piperazinyl)-N-(2-pyridinyl)ethyl))cyclohexane-carboxamide

*Address correspondence to Amitabha Chattopadhyay, Tel: +91-40-2719-2578, Fax: +91-40-2716-0311, E-mail: [email protected]

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 52

ABSTRACT

G protein-coupled receptors (GPCRs) represent the largest class of receptors involved in signal transduction across cell membranes, and are major drug targets in all clinical areas.

Endocytosis of GPCRs offers a regulatory mechanism to sustain their

signaling within a stringent spatiotemporal regime. In this work, we explored agonistinduced endocytosis of the human serotonin1A receptor stably expressed in HEK-293 cells, and the cellular machinery involved in receptor internalization and intracellular trafficking. The serotonin1A receptor is a popular GPCR implicated in neuropsychiatric disorders such as anxiety and depression, and serves as an important drug target.

In spite of its

pharmacological relevance, its mechanism of endocytosis and intracellular trafficking is less understood. In this context, we have utilized a combination of robust population-based flow cytometric analysis and confocal microscopic imaging, to address the path and fate of the serotonin1A receptor during endocytosis. Our results, utilizing inhibitors of specific endocytosis pathways and intracellular markers, show that the serotonin1A receptor undergoes endocytosis predominantly via clathrin-mediated pathway, and subsequently recycles to the plasma membrane via recycling endosomes. These results would enhance our understanding on molecular mechanisms of GPCR endocytosis and could offer novel insight in the underlying mechanism of antidepressants which act via the serotonergic pathway. In addition, our results could be relevant in understanding cell (or tissue)-specific GPCR endocytosis.

Keywords:

GPCR; serotonin1A receptor; endocytosis; trafficking; clathrin-mediated endocytosis; recycling pathway

2 ACS Paragon Plus Environment

Page 3 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION

G protein-coupled receptors (GPCRs) are the largest class of molecules that transduce signals across the plasma membrane upon binding a diverse array of ligands.1-5 They are seven transmembrane domain proteins that mediate a repertoire of physiological responses, and have emerged as major drug targets spanning all clinical areas.4,6-8 In fact, ~40% of all current drug targets are GPCRs.8,9 As a consequence of the gamut of intricate cellular responses triggered by GPCRs, the downstream signaling mediated by these receptors is maintained within physiological levels by stringent regulatory mechanisms.10-13 Endocytosis is a major regulatory mechanism employed by GPCRs to sustain their downstream signaling within a stringent spatiotemporal regime.10,11 Endocytosis offers an effective means to decouple the receptor from its pool of extracellular ligands by sequestering the receptor into intracellular vesicular structures (endosomes).

GPCR

endocytosis and trafficking were initially identified as a mode of ligand-induced desensitization of receptor-mediated signaling.10,11 Interestingly, emerging literature on signaling from endosomal receptor pools has introduced a fresh perspective to the significance of endocytosis in the regulation of GPCR function.14-17 In this context, a detailed understanding of the mechanistic framework of internalization and intracellular trafficking of GPCRs assumes relevance. The serotonin1A receptor is a representative member of the GPCR family with a central role in neuronal development and function, and is an important drug target for a range of disorders of the central nervous system and even cancer.18-21 The serotonin1A receptor has an indispensable role in neurological function, and therefore has emerged as a major drug target in the development of therapeutics against neuropsychiatric disorders such as anxiety,22 depression,23 schizophrenia24 and Parkinson’s disease.24,25 Serotonin, the native ligand for the serotonin1A receptor, is intrinsically fluorescent26,27 and a widely studied monoamine neurotransmitter owing to its central role in the etiology and therapy of 3 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 52

anxiety, stress, depression and behavioral disorders.28,29 A popular class of anti-depressant drugs, termed selective serotonin reuptake inhibitors (SSRIs), selectively bind serotonin transporters and block the reuptake of serotonin from the synaptic cleft.30,31 This enhances the extracellular (synaptic) concentration of serotonin, thereby interfering with the homeostasis of the serotonin system.

Interestingly, several physiological responses

mediated by serotonin have been attributed to regulatory and downstream signaling events associated with the serotonin1A receptor,23,32 which highlights the importance of this subtype of serotonin receptors in these processes. Endocytosis of the serotonin1A receptor has been implicated as one of the major mechanisms of desensitization as a response to agonist exposure.33-35 In addition, the therapeutic action of popular antidepressants, such as fluoxetine, has been attributed to the desensitization of the serotonin1A receptor by endocytosis.36,37 Although endocytosis of the serotonin1A receptor and its functional consequences in receptor desensitization have been addressed earlier,33-37 the detailed mechanistic framework and the subsequent intracellular fate of the receptor are poorly understood. In our previous studies, we have extensively characterized the function,38-41 organization42-47 and dynamics42,46,48 of the serotonin1A receptor in native and heterologously expressed cellular systems using an array of biochemical, biophysical and computational approaches. In the present study, we monitored the agonist-induced endocytosis and the cellular machinery implicated in internalization and intracellular trafficking of the human serotonin1A receptor stably expressed in HEK-293 cells. Analysis of GPCR endocytosis is often limited by the methods used to quantify receptor internalization and intracellular trafficking.49 Keeping this in mind, in this work, we have utilized quantitative flow cytometry and confocal microscopic approaches to monitor the endocytosis of the serotonin1A receptor. Our results show that the serotonin1A receptor undergoes

agonist-induced

internalization

predominantly

via

clathrin-mediated

endocytosis. Upon internalization, the receptor traffics back to the plasma membrane along 4 ACS Paragon Plus Environment

Page 5 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

the endosomal recycling pathway. These results constitute one of the first comprehensive reports on the internalization and intracellular trafficking of the serotonin1A receptor. The insights provided by these results assume significance in our overall understanding of the mechanisms involved in endocytosis as a means of regulation of neurotransmitter GPCRs.

MATERIALS AND METHODS

Materials MgCl2, CaCl2, doxycyclin, sodium azide, sucrose, genistein, serotonin, p-MPPF, pMPPI, and WAY-100635 were obtained from Sigma Chemical Co. (St. Louis, MO). DMEM/F-12 (Dulbecco’s Modified Eagle Medium: nutrient mixture F-12 (Ham) (1:1)), fetal calf serum and hygromycin B were obtained from Invitrogen/Life Technologies (Grand Island, NY). [3H]8-OH-DPAT (specific activity 141 Ci/mmol) was purchased from MP Biomedicals (Santa Ana, CA). Bicinchoninic acid (BCA) assay reagent for protein estimation was from Pierce (Rockford, IL). GF/B glass microfiber filters were from Whatman International (Kent, UK). GTP-γ-S was purchased from Roche Applied Science (Mannheim, Germany). Anti-myc antibody Alexa Fluor 488 conjugate was from Millipore (Bedford, MA). Pitstop 2, anti-Rab4 [EPR3042] and anti-Rab11A [EPR7587(B)] rabbit monoclonal antibodies, goat anti-rabbit IgG Fc Alexa Fluor 568 conjugated were from Abcam (Cambridge, MA). Flp-In™ T-REx™ system, DiIC16, transferrin Alexa Fluor 568 conjugated, cholera toxin B Alexa Fluor 594 conjugated and LysoTracker red were purchased from Molecular Probes/Invitrogen (Eugene, OR). All other chemicals used were of the highest available purity. Water was purified through a Millipore (Bedford, MA) Milli-Q system and used throughout.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 52

Plasmid constructs and generation of HEK-293 cells stably expressing the serotonin1A receptor The cDNA clone for human N-terminus His-myc-tagged serotonin1A receptor (HISMYC-HTR1A-pDsRed-Monomer-Hyg-C1) was a kind gift from Dr. Sadashiva S. Karnik (Lerner Research Institute, Cleveland Clinic, OH).

Stable HEK-293 cell line with

tetracycline-inducible expression of N-terminus His-myc-tagged serotonin1A receptor was generated using Flp-In™ T-Rex™ system. Flp-In™ T-Rex™ system consists of Flp-In™ T-REx™-293 cells containing a Flp Recombination Target (FRT) site and expressing the tetracycline repressor, inducible expression vector pcDNA™5/FRT/TO and pOG44 FlpRecombinase expression vector. The cDNA sequence encoding HIS-MYC-HTR1A was subcloned from HIS-MYC-HTR1A-pDsRed-Monomer-Hyg-C1 into pcDNA™5/FRT/TO vector between KpnI and BamHI restriction sites after PCR amplification using the primers: KPNIHISF – 5' CCGCTAGGTACCATGCATCATCAC 3' and HTR1ABAMH1R – 5' TCATCAGGATCCTCACTGGCGGCAGAACTT 3'. The resultant construct pcDNA™5/FRT/TO/HIS-MYC-HTR1A after being verified by sequencing, was transfected into Flp-In™ T-REx™-293 cells along with pOG44 by lipofectamine-mediated transfection and stable colonies were selected using 0.5 mg/ml hygromycin B.

Cell culture HEK-293 cells stably expressing N-terminal myc-tagged serotonin1A receptors (HEK-5-HT1AR cells) were maintained in DMEM/F-12 medium with 10% fetal calf serum and 250 μg/ml hygromycin B in a humidified atmosphere with 5% CO2 at 37 °C. The culture medium was supplemented with 1 μg/ml doxycyclin for 24 h to induce receptor expression prior to the experiments.

Saturation binding assay


Page 7 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Cell membranes were prepared as described earlier,50 and the total protein content of the isolated membranes was estimated using the BCA reagent.51 Saturation binding assays were performed with increasing concentrations (0.1-10 nM) of the radiolabeled agonist [3H]8-OH-DPAT as described previously.50 Nonspecific binding was measured in the presence of 10 M unlabeled serotonin. Binding assays were carried out at room temperature (~25 °C). The concentration of the bound ligand (RL*) was determined from: RL* = 10-9  B/(V  SA  2220) M

(1)

where B is the bound radioactivity in disintegrations per minute (dpm), V is the assay volume in ml, and SA is the specific activity of the radioligand. Data obtained could be fitted best to a one-site ligand binding equation. Binding parameters (dissociation constant (Kd) and number of maximum binding sites (Bmax)) were calculated by nonlinear regression analysis of binding data using Graphpad Prism software, version 4.0 (San Diego, CA).

GTP-γ-S sensitivity assay G-protein coupling efficiency to serotonin1A receptors was measured utilizing GTPγ-S sensitivity assays as described previously.50 The concentration of GTP-γ-S leading to half-maximal inhibition of specific agonist binding (IC50) was calculated by nonlinear regression fitting of the data to a four parameter logistic function52: B = a[1+(x/I)s]-1 + b

(2)

where B is the binding of specific agonist in the presence of GTP-γ-S normalized to binding observed at lowest concentration of GTP-γ-S used, x is the concentration of GTP-γ-S, a is the range (ymax - ymin) of the fitted curve on the ordinate (y-axis), I is the IC50 concentration, b is the background of the fitted curve (ymin) and s is the slope factor.

Treatment with serotonin1A receptor ligands To monitor the effect of increasing exposure time with serotonin on the endocytosis of the serotonin1A receptor, cells were incubated with 10 μM serotonin for 15, 30, 45 or 60 7 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

min in serum-free DMEM/F-12 medium at 37 °C, and subsequently collected in chilled PBS to process further for flow cytometry. Similarly, in order to probe the effect of increasing concentrations of serotonin on receptor endocytosis, cells were incubated with 1 nM, 10 nM, 100 nM or 10 μM serotonin for 60 min at 37 °C. All other experiments were performed using 10 μM serotonin at an exposure time of 60 min, unless specified. To monitor the effect of specific antagonists and an inverse agonist on agonist-induced serotonin1A receptor endocytosis, cells were incubated with 10 μM WAY-100635 or pMPPF (specific antagonists), or 10 μM p-MPPI (inverse agonist) in the presence of 100 nM serotonin for 60 min at 37 °C.

Treatment with inhibitors of receptor-mediated endocytosis Inhibitors of receptor-mediated endocytosis such as low temperature, hypertonic medium and inhibitor of ATP synthesis were used to perform control experiments to validate our flow cytometric and confocal microscopic assays. Cells were treated with 10 μM serotonin for 60 min in serum-free medium on ice (low temperature), or in serum-free medium containing 0.35 M sucrose (hypertonic medium) or 10 mM sodium azide (inhibitor of ATP synthesis).

Chemical inhibition of clathrin and caveolin-mediated endocytosis In order to inhibit clathrin-mediated endocytosis, cells were treated with 20 μM Pitstop 2 in serum-free medium at 37 °C for 30 min prior to incubation with serotonin. Caveolin-mediated endocytosis was inhibited by incubating cells with 200 μM genistein in serum-free medium at 37 °C for 30 min prior to incubation with serotonin.

Flow cytometric analysis of receptor endocytosis Following treatment, HEK-5-HT1AR cells were collected in PBS on ice. The cells were fixed with 4% (v/v) formaldehyde for 30 min and stained with anti-myc antibody 8 ACS Paragon Plus Environment

Page 8 of 52

Page 9 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Alexa Fluor 488 conjugate (1:100 dilution) for 60 min on ice. Cells were washed and suspended in PBS containing 2% serum.

Plasma membrane receptor population was

quantified using a MoFlo XDP flow cytometer (Brea, CA) and data were acquired and analyzed using Summit analysis software version 5.4.0. Mode count values were obtained by flow cytometric analysis of 10,000 cells. Alexa Fluor 488 was excited at 488 nm and emission was collected using a 529/28 nm bandpass filter. Reduction in cell surface receptor population upon agonist-induced endocytosis was analyzed in terms of decrease in mode count values with respect to control cells reflected as a shift in the population of cells toward lower fluorescence intensity.

Confocal microscopic imaging of receptor endocytosis Cells were plated on poly-L-lysine coated glass coverslips and grown in DMEM/F12 medium with 10% serum. To obtain representative confocal microscopic images for receptor internalization, cells were treated with appropriate ligands, washed and immediately placed on ice.

Cell membranes were labeled with DiIC16 as described

previously53 with some modifications. Briefly, cells were incubated with 8 μM DiIC16 in buffer A (PBS containing 0.5 mM MgCl2 and 1 mM CaCl2) for 30 min on ice. Cells were washed with cold buffer A and fixed with 4% (v/v) formaldehyde and permeabilized with 0.5% (v/v) Triton X-100. Cells were then stained with anti-myc antibody Alexa Fluor 488 conjugate (1:100 dilution) for 60 min, washed and mounted. Images were acquired on a Zeiss LSM 510 Meta confocal microscope (Jena, Germany).

N-terminal myc-tagged

serotonin1A receptors were imaged by exciting anti-myc antibody Alexa Fluor 488 conjugate at 488 nm and collecting emission from 500-530 nm. In order to image cell membranes, DiIC16 was excited at 561 nm and emission was collected between 575-630 nm. Images of z-sections were acquired with a 63x/1.4 NA oil immersion objective under 1 airy condition and a fixed step size of 0.5 μm. Images shown are maximum intensity projections of 3 central sections of the acquired z-stack. 9 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Confocal microscopic imaging of receptor colocalization with transferrin and cholera toxin Cells were grown on glass coverslips in DMEM/F-12 medium with 10% serum. Cells were placed on ice and labeled with anti-myc antibody Alexa Fluor 488 conjugate for 60 min. Subsequently, cells were washed with cold buffer A to remove excess antibody and incubated for 60 min at 37 °C in serum-free medium containing 10 μg/ml transferrin Alexa Fluor 568 conjugate (or cholera toxin B Alexa Fluor 594 conjugate) and 10 μM serotonin. Cells were then transferred to ice and washed with cold buffer A. Cell surface bound antibodies were washed off by incubating with 150 mM NaCl, 50 mM acetic acid solution for 15 min. Cells were fixed with 4% (v/v) formaldehyde, washed with buffer A and mounted.

Images were acquired on a Leica SP8 confocal microscope (Wetzlar,

Germany). N-terminal myc-tagged serotonin1A receptors were imaged by exciting anti-myc antibody Alexa Fluor 488 conjugate at 488 nm and collecting emission between 500-560 nm. Transferrin Alexa Fluor 568 conjugate was excited at 561 nm and emission was collected between 570-640 nm. Cholera toxin B Alexa Fluor 594 conjugate was excited at 594 nm and emission was collected between 600-640 nm. Images of z-sections were acquired with a 63x/1.4 NA oil immersion objective under 1 airy condition and a fixed step size of 0.5 μm. Quantitative colocalization analysis was performed using a single section from a z-stack, as described below.

Confocal microscopic imaging of intracellular trafficking of the serotonin1A receptor Cells were grown on glass coverslips in DMEM/F-12 medium with 10% serum and treated with serotonin. Subsequently, cells were placed on ice, washed with cold buffer A, fixed with 4% (v/v) formaldehyde and permeabilized with 0.5% (v/v) Trition X-100. Early recycling endosome marker Rab4 (or late recycling endosome marker Rab11A) were labeled with anti-Rab4 (or anti-Rab11A) primary antibody (1:200 dilution) for 60 min


Page 10 of 52

Page 11 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

followed by labeling with goat anti-rabbit IgG Fc Alexa Fluor 568 secondary antibody (1:450 dilution) for 60 min.

Cells were washed with cold buffer A and serotonin1A

receptors were labeled with anti-myc antibody Alexa Fluor 488 conjugate for 60 min. To obtain images for receptor colocalization with lysosomes, cells were incubated with 0.2 μM LysoTracker red for 60 min in serum-free DMEM/F-12 medium. Cells were then fixed and stained with anti-myc antibody Alexa Fluor 488 conjugate. Images of z-sections were acquired with a 63x/1.4 NA oil immersion objective under 1 airy condition and a fixed step size of 0.5 μm on a Zeiss LSM 510 Meta confocal microscope (Jena, Germany). Nterminal myc-tagged serotonin1A receptors were imaged by exciting anti-myc antibody Alexa Fluor 488 conjugate at 488 nm and collecting emission between 500-530 nm. Rab4 and Rab11A were imaged by exciting the corresponding goat anti-rabbit IgG Fc Alexa Fluor 568 secondary antibody and lysosomes were imaged by exciting LysoTracker red at 561 nm and collecting emission between 575-630 nm. Quantitative colocalization analysis was carried out using a single section from a z-stack as described below.

Quantitative colocalization analysis Colocalization between fluorescence signals obtained in two channels was analyzed using Manders’ colocalization coefficient, M54 as: ∑ Ri, coloc M = ___________________ ∑ Ri

(3)

where Ri is the receptor associated fluorescence intensity of the ith pixel, and Ri, coloc is the receptor associated fluorescence intensity of the ith pixel when the intensity of the corresponding pixel in the other channel is greater than threshold. Threshold intensities of the two channels were determined using the Costes’ method for automated thresholding.55 Manders’ colocalization coefficient and Costes’ threshold were determined for a single


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 52

section from a z-stack of confocal images using the JACoP plug-in56 for ImageJ (National Institutes of Health, Bethesda).

MTT viability assay Viability of cells under various treatment conditions was assessed using MTT assay as described earlier.57

Statistical analysis Significance levels were analyzed using Student’s two-tailed unpaired t-test using Graphpad Prism software, version 4.0 (San Diego, CA).

Plots were generated using

OriginPro software, version 8.0 (OriginLab, Northampton, MA).

RESULTS Stable expression and pharmacological characterization of the serotonin1A receptor in HEK-293 cells HEK-293 cells stably expressing serotonin1A receptors (HEK-5-HT1AR) were generated upon transfection with a construct coding for the receptor with a myc-tag at its N-terminus (see Figure 1a and Materials and Methods for more details). This system allows us to fluorescently label the serotonin1A receptor with an anti-myc Alexa Fluor 488 conjugate antibody to quantitatively monitor receptor endocytosis and trafficking. Confocal microscopic imaging at a mid-plane section of HEK-5-HT1AR cells displayed a typical plasma membrane localization of the serotonin1A receptor (see Figure 1b). In order to check the functionality of serotonin1A receptors expressed in HEK-293 cells, we monitored binding of the specific agonist, [3H]8-OH-DPAT to membranes isolated from HEK-5-HT1AR cells. Figure 1c shows a representative saturation binding plot of [3H]8-


Page 13 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

OH-DPAT to serotonin1A receptors expressed in HEK-5-HT1AR cells.

Analysis of

saturation binding plots using eq 1 (see Materials and Methods for more details) yielded dissociation constant (Kd) of ~4.1 nM and maximum binding sites (Bmax) of ~1.5 pmol/mg of protein (see Table 1), which corresponds to ~9 x 104 receptors per cell.

Figure 1. Functional human serotonin1A receptor stably expressed in HEK-293 cells. (a) A schematic representation showing HEK-293 cells stably expressing the human serotonin1A receptor with a myc-tag (indicated in orange) at its N-terminus (HEK-5-HT1AR cells). (b) Representative confocal microscopic images of HEK-5-HT1AR cells showing the distribution of serotonin1A receptors labeled with anti-myc antibody Alexa Fluor 488 conjugate (green). The nucleus is stained with DAPI (blue). The scale bar represents 10 μm. (c) Saturation binding analysis of specific agonist ([3H]8-OH-DPAT) binding to serotonin1A receptors. A representative plot for [3H]8-OHDPAT binding to the serotonin1A receptor, with increasing concentrations (0.1-10 nM) of free [3H]8-OH-DPAT is shown. The curve is a nonlinear regression fit to the experimental data obtained using eq 1. (d) The efficiency of G-protein coupling to the serotonin1A receptor was monitored by the sensitivity of specific agonist binding to the receptor in the presence of GTP-γ-S, a non-hydrolyzable analog of GTP. Data points represent specific binding of [ 3H]8-OH-DPAT to the serotonin1A receptor in the presence of increasing concentrations of GTP-γ-S. Values are expressed as percentages of agonist binding obtained in the presence of lowest concentration of GTP-γ-S. The curve is a nonlinear regression fit to the experimental data obtained using eq 2. Data represent


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

means ± S.E. of duplicate points from four independent experiments. See Materials and Methods for other details.

Table 1 Specific [3H]8-OH-DPAT Binding and Efficiency of G-protein Coupling to Serotonin1A Receptors

(a) Saturation bindinga Kd

4.1 ± 0.6 nM

Bmax

1.53 ± 0.24 pmol/mg protein

(b) Efficiency of G-protein couplingb IC50

70.6 ± 2.7 nM

a

The binding parameters shown represent means ± S.E. from five independent experiments, while saturation binding data shown in Figure 1c is from a representative experiment. b

The IC50 shown represents mean ± S.E. from four independent experiments (data from Figure 1d).

Agonists to the serotonin1A receptor have been shown to activate the Gi/Go class of G-proteins in HEK-293 cells.58,59

We have previously demonstrated, utilizing a non-

hydrolyzable analog of GTP (GTP-γ-S), that agonist binding to serotonin1A receptors is sensitive to its coupling to G-proteins and exhibits a characteristic reduction upon disruption of G-protein coupling to the receptor.60 In order to test the ability of the serotonin1A receptor in HEK-5-HT1AR cells to efficiently couple G-proteins, we monitored the sensitivity of specific agonist binding to the receptor in the presence of GTP-γ-S. Figure 1d shows a characteristic reduction in the binding of [3H]8-OH-DPAT to serotonin1A 14 ACS Paragon Plus Environment

Page 14 of 52

Page 15 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

receptors with increasing concentrations of GTP-γ-S. Nonlinear regression analysis of such inhibition plots using eq 2 (described in Materials and Methods) yielded a half-maximal inhibition concentration (IC50) of ~71 nM. These results validate that the serotonin1A receptor in HEK-5-HT1AR cells is functional.

Monitoring serotonin1A receptor endocytosis: flow cytometry and confocal microscopy We monitored the internalization of the serotonin1A receptor using a quantitative flow cytometric assay.

Flow cytometry offers a statistically robust, population-based

method to quantitatively monitor the presence of fluorescently-tagged molecules in cells. In our assay, we measured agonist-induced endocytosis of the serotonin1A receptor by fluorescently labeling exclusively the cell membrane associated population of receptors in HEK-5-HT1AR cells with anti-myc antibody Alexa Fluor 488 conjugate.

To obtain

fluorescence signal specifically from cell membrane associated receptors, we fluorescently labeled the receptors subsequent to treatment with serotonin and after fixing (see Materials and Methods for details). Figure 2a shows a schematic representation of fluorescently labeled membrane-associated serotonin1A receptors with and without serotonin. Figure 2b shows a representative flow cytometric histogram with a shift in the modal (peak) channel toward lower value on the fluorescence axis, indicating reduction in the population of receptors on the cell surface upon induction of endocytosis in the presence of serotonin. The reduction in cell counts associated with the modal channel (referred as mode count) due to such a shift is indicative of receptor internalization. In parallel, we carried out confocal fluorescence microscopic imaging of the serotonin1A receptor under control and serotonin-treated conditions.

Figure 2c shows

representative confocal microscopic images of cells with membranes labeled with DiIC16 and serotonin1A receptors labeled with anti-myc antibody Alexa Fluor 488 conjugate, subsequent to permeabilization of cells (see Materials and Methods for more details). In the absence of serotonin, the serotonin1A receptors are predominantly located at the plasma 15 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

membrane. Upon treatment with serotonin, we observed internalization of the receptor (see Figure 2d), thereby validating our observations from flow cytometry. This combination of quantitative flow cytometric analysis and confocal microscopic imaging forms the basis of our analysis of serotonin1A receptor endocytosis.

Figure 2. Monitoring endocytosis of the serotonin1A receptor using flow cytometry and confocal microscopy. (a) A schematic representation of plasma membrane embedded N-terminal myc-tagged serotonin1A receptors labeled with anti-myc antibody Alexa Fluor 488 conjugate under


Page 16 of 52

Page 17 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

control condition and upon agonist-induced receptor endocytosis. The reduction in plasma membrane receptor population due to agonist-induced endocytosis provides quantitative information on the extent of endocytosis of the receptor. (b) An overlay of representative flow cytometric histograms corresponding to control and serotonin-treated cells as shown in panel (a). (c,d) Representative confocal microscopic images of (c) control (untreated) cells and (d) cells incubated with 10 μM serotonin for 60 min. Serotonin1A receptors were labeled with anti-myc antibody Alexa Fluor 488 conjugate (green) and the cell membrane was labeled with DiIC16 (red). The scale bar represents 10 μm. See Materials and Methods for other details.

Dependence of receptor internalization on serotonin concentration and exposure time In order to monitor the effect of exposure time with serotonin on the endocytosis of the serotonin1A receptor, we treated HEK-5-HT1AR cells with 10 μM serotonin with increasing time of exposure.

As shown in Figure 3a, we observed a time-dependent

reduction in the membrane receptor population upon incubation with serotonin, with ~43% reduction observed for 60 min incubation. We therefore used 60 min as the time of exposure for subsequent experiments in which the effect of agonist (serotonin) concentration on the internalization of the serotonin1A receptor was monitored (see Figure 3b). The figure shows that treatment of cells with increasing concentrations of serotonin resulted in increasing receptor internalization. At the highest concentration of serotonin used (10 μM), we observed maximum receptor internalization.

For all subsequent

experiments, we chose 10 μM serotonin with an exposure time of 60 min (unless stated otherwise). It is interesting to note that the concentrations of serotonin inducing maximal internalization of the serotonin1A receptor are several orders of magnitude higher relative to the dissociation constant of serotonin binding to the serotonin1A receptor. These conditions mimic the high local concentrations of serotonin generated in serotonergic synapses by SSRIs that are believed to mediate their anti-depressant therapeutic effects via the serotonin1A receptor.30,31


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Effect of exposure time and concentration of serotonin on serotonin 1A receptor endocytosis. HEK-5-HT1AR cells were incubated (a) with 10 μM serotonin with increasing exposure time, and (b) with increasing concentrations of serotonin for 60 min of exposure. Cells were then fixed and the plasma membrane receptor population was labeled with anti-myc antibody Alexa Fluor 488 conjugate. Values are normalized to mode count associated with control cells. Data represent means ± S.E. of at least three independent experiments (*, ** and *** correspond to significant (p < 0.05, p < 0.01, and p < 0.001) difference in mode count associated with cells incubated with serotonin relative to control cells). See Materials and Methods for other details.


Page 18 of 52

Page 19 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Effect of inhibitors of endocytosis on the internalization of the serotonin1A receptor As a control for our internalization assays, we monitored the endocytosis of the serotonin1A receptor under conditions that are known to inhibit endocytosis. For this, we treated HEK-5-HT1AR cells with serotonin (i) at low temperature (by incubating cells on ice during serotonin treatment), (ii) under hypertonic conditions (in media containing 0.35


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Effect of inhibition of receptor-mediated endocytosis on the internalization of the serotonin1A receptor. HEK-5-HT1AR cells were incubated with 10 μM serotonin for 60 min under conditions that inhibit endocytosis (incubation on ice or in presence of 0.35 M sucrose, or in presence of 10 mM sodium azide). (a) Quantitative flow cytometric estimates of plasma membrane receptor population under these conditions. Values are normalized to mode count associated with control cells. Data represent means ± S.E. of at least three independent experiments (*** corresponds to significant (p < 0.001) difference in mode count associated with cells incubated with serotonin relative to control cells). Representative confocal microscopic images of cells upon incubation with 10 μM serotonin: (b) on ice, (c) in presence of 0.35 M sucrose, and (d) in presence of 10 mM sodium azide. Panels (b-d) show myc-tagged serotonin1A receptors labeled with anti-myc antibody Alexa Fluor 488 conjugate (green) and cell membrane labeled with DiIC 16 (red). The scale bar represents 10 μm. See Materials and Methods for other details.

M sucrose) and (iii) in the presence of an inhibitor of ATP synthesis (sodium azide). Figure 4a shows that when cells were exposed to serotonin under conditions that inhibit receptor-mediated endocytosis, the mode count values were comparable to control, indicating absence of internalization of the serotonin1A receptor. Representative confocal microscopic images showing absence of intracellular receptor fluorescence under these conditions are shown in Figures 4b-d. Control experiments showed that HEK-5-HT1AR cells remained viable under conditions used to inhibit receptor-mediated endocytosis (see Figure S1). Results from these experiments further validate our flow cytometric and confocal microscopic assays for receptor endocytosis.

Agonist-mediated receptor endocytosis is inhibited by specific antagonists and inverse agonist From a pharmacological perspective, ligands are classified on the basis of the activity (downstream signaling) they generate when bound to the receptor. While neutral antagonists are a class of ligands that reduce agonist-mediated receptor activity to basal level, inverse agonists inhibit even the basal activity of a receptor.61 To study the effect of such specific ligands on serotonin-induced endocytosis of the serotonin1A receptor, we monitored receptor internalization in the presence of specific antagonists, WAY-10063562 and p-MPPF,63 and inverse agonist, p-MPPI.64 As shown in Figure 5a, we observed 20 ACS Paragon Plus Environment

Page 20 of 52

Page 21 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

inhibition of agonist-induced endocytosis of the serotonin1A receptor in the presence of its antagonists and inverse agonist.

Representative confocal microscopic images of cells

treated with serotonin in the presence of serotonin1A receptor antagonists and inverse agonist do not show receptor internalization (see Figures 5b-d). In view of the inhibitory effect of antagonists and inverse agonist on receptor-mediated signaling, these results indicate the functional role of agonist-induced internalization of the serotonin1A receptor as a regulatory mechanism to maintain downstream signaling.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 52

Figure 5. Agonist-induced endocytosis is inhibited in the presence of antagonists and inverse agonist. HEK-5-HT1AR cells were incubated with 100 nM serotonin for 60 min in the presence of specific serotonin1A receptor antagonists (WAY-100635 and p-MPPF) and inverse agonist (pMPPI). (a) Quantitative flow cytometric estimates of plasma membrane receptor population under these conditions. Values are normalized to mode count associated with control cells. Data represent means ± S.E. of at least three independent experiments (* corresponds to significant (p < 0.05) difference in mode count associated with cells incubated with serotonin relative to control cells). Representative confocal microscopic images of cells upon incubation with 100 nM serotonin in the presence of 10 μM (b) WAY-100635, (c) p-MPPF, and (d) p-MPPI. Panels (b-d) show myctagged serotonin1A receptors labeled with anti-myc antibody Alexa Fluor 488 conjugate (green) and cell membrane labeled with DiIC16 (red). The scale bar represents 10 μm. See Materials and Methods for other details.

The serotonin1A endocytosis

receptor

internalizes

predominantly

via

clathrin-mediated

The molecular mechanism and cellular machinery involved in the endocytosis of membrane receptors are diverse in nature. The most well characterized mechanisms of internalization are clathrin- and caveolin-mediated endocytosis.65 In order to decipher the mechanism implicated in the agonist-induced endocytosis of the serotonin1A receptor, we adopted two complementary approaches: (i) monitoring the effect of specific inhibitors of endocytic pathways, and (ii) quantitative colocalization of internalized receptors with known marker proteins specific to these pathways. Pitstop 2 is a specific inhibitor for clathrin-mediated endocytosis that competitively binds to the terminal domain of clathrin and prevents its interaction with accessory proteins.66 On the other hand, genistein is a tyrosine kinase inhibitor that blocks the phosphorylation of caveolin-1 to inhibit caveolinmediated endocytosis.67 We monitored the internalization of the serotonin1A receptor using flow cytometry upon inhibiting clathrin- and caveolin-mediated endocytosis using Pitstop 2 and genistein, respectively. Treatment with these inhibitors did not affect the viability of HEK-5-HT1AR cells (see Figure S1). As shown in Figure 6a, we observed inhibition of serotonin1A receptor endocytosis upon treatment with Pitstop 2. However, treatment with genistein did not result in a significant change in internalization of the receptor.


Page 23 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6. The serotonin1A receptor internalizes via clathrin-mediated endocytosis. (a) Cells were incubated with 10 μM serotonin for 60 min subsequent to treatment with specific inhibitors of clathrin-mediated endocytosis (Pitstop 2) or caveolin-mediated endocytosis (genistein). The panel shows quantitative flow cytometric estimates of plasma membrane receptor population under these conditions. Values are normalized to mode count associated with control cells. Data represent means ± S.E. of at least three independent experiments (*** and ** correspond to significant (p < 0.001 and p < 0.01) difference in mode count associated with cells incubated with serotonin, and serotonin in the presence of genistein, respectively, relative to control cells). Representative confocal microscopic images of HEK-5-HT1AR cells labeled with anti-myc antibody Alexa Fluor 488 conjugate (green) and (b) transferrin conjugated with Alexa Fluor 568, or (c) cholera toxin B conjugated with Alexa Fluor 594 (red) are shown. The scale bar represents 10 μm. (d) The extent of colocalization between serotonin1A receptor and transferrin (or cholera toxin) quantitatively estimated using Manders’ colocalization coefficient. Data represent means ± S.E. of at least eleven


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 52

independent measurements (*** corresponds to significant (p < 0.001) difference in Manders’ colocalization coefficient associated with the colocalization of serotonin1A receptor with cholera toxin relative to transferrin). See Materials and Methods for other details.

We further explored the mechanism of serotonin1A receptor endocytosis by quantitatively analyzing the colocalization of internalized receptors with markers specific for clathrin- and caveolin-mediated endocytosis. clathrin-mediated endocytosis.68

Transferrin receptor is a marker for

On the other hand, cholera toxin B undergoes

internalization via caveolin-mediated endocytosis.69 Figures 6b and c show representative confocal microscopic images depicting colocalization of the serotonin1A receptor with fluorescently labeled transferrin or cholera toxin B.

Quantitative estimates of

colocalization show significantly higher colocalization of the serotonin1A receptor with transferrin relative to cholera toxin B (see Figure 6d).

Taken together, these results

comprehensively demonstrate that the serotonin1A receptor internalizes predominantly via clathrin-mediated endocytosis.

Intracellular trafficking and recycling of the serotonin1A receptor What is the intracellular fate of the serotonin1A receptor once it undergoes agonistinduced internalization ? To explore this aspect, we tracked the movement of the receptor along different routes of intracellular traffic by quantitatively monitoring its colocalization with specific endosomal markers at different time points of exposure to serotonin. Rab470,71 and Rab11A72,73 constitute a class of Rab GTPases74 that serve as marker proteins on endosomal membranes that specifically identify early and late recycling pathways of intracellular traffic, respectively.

As shown in Figure 7a, we observed a peak in

colocalization of the serotonin1A receptor with Rab4 positive endosomes after 15 min of exposure to serotonin. After 60 min of incubation with serotonin, it was washed off and receptor traffic was chased in medium without serotonin.

We observed a peak

corresponding to a significantly higher colocalization of the receptor with Rab11A positive 24 ACS Paragon Plus Environment

Page 25 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

endosomes after 30 min of chase (see Figure 7c). Representative confocal microscopic images corresponding to time points showing maximal colocalization of the serotonin1A receptor with Rab4 and Rab11A are shown in Figures 7b and d. Interestingly, the plasma membrane receptor population was restored to control levels when receptor traffic was chased for 60 min subsequent to treatment with serotonin (see Figure 8). These results show that the serotonin1A receptor recycles back to the plasma membrane.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. The serotonin1A receptor traffics by recycling. Cells were incubated with 10 μM serotonin for varying exposure times. The figure shows quantitative estimates of colocalization of the serotonin1A receptor with specific markers at different time points: (a) Rab4 (for early recycling endosome), (c) Rab11A (late recycling endosome), and (e) LysoTracker (for lysosome), analyzed using Manders’ colocalization coefficient. Data represent means ± S.E. of at least six independent measurements. The horizontal gray bar in panel (a,c,e) indicates the duration of incubation with serotonin. Representative confocal microscopic images showing colocalization between serotonin1A receptors (green) and (b) Rab4 after 15 min incubation with serotonin, (d) Rab11A after 30 min of chase post serotonin incubation, and (f) LysoTracker after 30 min of chase post serotonin incubation (red) are shown. Lines joining data points are provided merely as viewing guides. The scale bar represents 10 μm. See Materials and Methods for other details.

Figure 8. Plasma membrane population of the serotonin1A receptor is restored upon recycling. HEK-5-HT1AR cells were incubated with 10 μM serotonin for 60 min and chased for 60 min post serotonin incubation. Cells were fixed and the plasma membrane receptor population was labeled with anti-myc antibody Alexa Fluor 488 conjugate. Values are normalized to mode count associated with control cells. Data represent means ± S.E. of at least three independent experiments (*** corresponds to significant (p < 0.001) difference in mode count associated with cells incubated with serotonin relative to control cells). See Materials and Methods for other details.

In order to study whether the serotonin1A receptor undergoes lysosomal degradation, we monitored receptor colocalization with lysosomes labeled with LysoTracker red. As shown in Figures 7e and f, we did not observe any colocalization of the receptor with the lysosomal compartment, indicating that the serotonin1A receptor does not undergo lysosomal degradation during intracellular trafficking. 26 ACS Paragon Plus Environment

Page 26 of 52

Page 27 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

DISCUSSION

Endocytosis acts as a key regulatory feature that allows precise spatiotemporal control over GPCR signaling.10,11 Although the internalization of GPCRs in general,10-13 and the serotonin1A receptor in particular,33-37 has been previously studied, the details on the mechanistic framework and the cellular machinery involved in the internalization and intracellular trafficking of the serotonin1A receptor are relatively less studied. In this work, we utilized flow cytometric analysis of a population of HEK-293 cells stably expressing serotonin1A receptors to monitor agonist-induced internalization of the receptor. We further explored the cellular endocytic machinery that mediates this process and intracellular trafficking of the receptor upon internalization. Our results show that the serotonin1A receptor undergoes agonist (serotonin)-induced internalization via clathrin-mediated endocytosis and subsequently traffics along the intracellular endosomal recycling pathway (see Figure 9). These results constitute one of the first reports on the endocytosis and trafficking of the serotonin1A receptor using a quantitative, population-based flow cytometric assay, in combination with insights from confocal microscopic imaging and quantitative colocalization.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 52

Figure 9. Endocytosis and intracellular trafficking of the serotonin1A receptor. A schematic representation of agonist-induced endocytosis and intracellular trafficking of the serotonin1A receptor. The serotonin1A receptor undergoes internalization upon exposure to serotonin predominantly via clathrin-mediated endocytosis. Subsequent to internalization, the receptor traffics back to the plasma membrane along the recycling pathway. See text for more details.

Our results show that the agonist-mediated internalization of the serotonin1A receptor is inhibited in the presence of specific receptor antagonists and inverse agonist. We have previously shown concentration-dependent agonist-induced cAMP signaling by the serotonin1A receptor under conditions similar to our present study.42,75 In addition, we showed that agonist-induced signaling was inhibited in the presence of an inverse agonist (p-MPPI).48 Control over downstream signaling responses has recently emerged as an important functional consequence of receptor internalization. In this context, the ability of ligands to induce diverse downstream signaling responses due to their differential effects on receptor internalization assumes significance. For example, it has been reported that ligands with variable propensities toward inducing internalization of the glucagon-like peptide-1 receptor exhibit differential effects on insulin release and appetite reduction.76 Although a majority of GPCRs have been shown to internalize via clathrinmediated

endocytosis,11,77

caveolar

localization78,79

and

caveolin-mediated

internalization80,81 of GPCRs have been reported. Using inhibitors specific to clathrin- and caveolin-mediated endocytosis, we demonstrate that the serotonin1A receptor preferentially internalizes via clathrin-mediated endocytosis. These observations were reinforced by the higher colocalization of the receptor with transferrin receptor (marker for clathrin-mediated endocytosis) relative to cholera toxin B (marker for caveolin-mediated endocytosis), as quantified using Manders’ colocalization coefficient. The fate of an endocytosed receptor is governed by the intracellular trafficking route that it adopts subsequent to internalization. Using quantitative colocalization analysis with endosomal markers for early and late recycling, and lysosome, we observed that the serotonin1A receptor recycles back to the plasma membrane, and does not undergo lysosomal degradation. These results are in 28 ACS Paragon Plus Environment

Page 29 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

overall agreement with an earlier report in which endosomal pathway of the serotonin1A receptor was monitored.82 Insights from our studies on the intracellular trafficking and recycling of the serotonin1A receptor are relevant in terms of understanding the kinetics of regulation and resensitization of the receptor subsequent to agonist-induced internalization. Recycling of internalized receptors to the plasma membrane as a response to the reduction in the elevated levels of extracellular agonist acts as a feedback mechanism to restore receptor-mediated signaling from the plasma membrane to physiological levels. Endocytosis upon ligand stimulation allows GPCRs to access diverse pools of intracellular signaling effectors, distinct from those available at the plasma membrane, thereby enabling receptors to activate diverse downstream signaling pathways.11 Interestingly, evidence from recent studies on internalization of GPCRs such as the β2-adrenergic receptor and leutinizing hormone receptor has shown that GPCRs could signal along their routes of intracellular endosomal traffic.14-17 Such endosomal compartmentalization of GPCRs would lead to a change in spatiotemporal regime of their downstream signaling. In case of the serotonin1A receptor, activation of MEK and Erk1/2 signaling has been shown to be induced upon receptor internalization.83

These examples point toward an intricate spatiotemporal

regulation of GPCR signaling mediated via receptor endocytosis and reveal the immense potential for therapeutic interventions targeting specific signaling pathways.84 Importantly, dysregulated GPCR trafficking has been associated with several pathophysiological conditions such as nephrogenetic diabetes insipidus,85 retinitis pigmentosa86 and even cancer.87

In this context, a comprehensive understanding of

intracellular trafficking of essential neurotransmitter GPCRs such as the serotonin1A receptor assumes significance in the development of therapeutics that could modulate the kinetics of intracellular trafficking or reroute receptor traffic to specific endosomal compartments based on signaling requirements.88

We envision that the information

provided by our results would enrich our understanding of the mechanistic basis of 29 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 52

endocytosis in the regulation of neurotransmitter GPCRs, and could be crucial in the development of novel therapeutic strategies against neuropsychiatric disorders such as anxiety and depression. An intriguing aspect of the endocytosis of the serotonin1A receptor is that it is context-dependent in terms of cellular phenotype.

For example, agonist-induced

internalization was observed in receptors expressed in neurons derived from the dorsal raphe nucleus (autoreceptors), but not in hippocampal neurons (heteroreceptors).33,35 This raises the interesting question of the effect of cellular environment on receptor endocytosis. In our previous work, we have shown that membrane lipids (cholesterol and sphingolipids) can modulate GPCR function.89-94 It is therefore tempting to conjecture that the membrane lipid diversity of specific cell types,95 could be the basis of such context-dependent endocytosis. We plan to explore this aspect in our future work.


Page 31 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

ACKNOWLEDGMENTS

This work was supported by the Council of Scientific and Industrial Research (Govt. of India) and the Science and Engineering Research Board (Govt. of India) project (EMR/2016/002294). A.C. gratefully acknowledges support from SERB Distinguished Fellowship (Department of Science and Technology, Govt. of India). G.A.K and S.P.S. thank the Council of Scientific and Industrial Research and National Centre for Biological Sciences, respectively, for the award of Senior Research Fellowships. P.S. gratefully acknowledges the Council of Scientific and Industrial Research for the award of a Shyama Prasad Mukherjee Fellowship.

We sincerely thank Dr. Sadashiva S. Karnik (Lerner

Research Institute, Cleveland Clinic, OH) for the generous gift of the HIS-MYC-HTR1ApDsRed-Monomer-Hyg-C1 cDNA clone, and Dr. Mitradas M. Panicker (National Centre for Biological Sciences, Bangalore, India) for useful discussion. A.C. is a Distinguished Visiting Professor at Indian Institute of Technology, Bombay (Mumbai), and Adjunct Professor at RMIT University (Melbourne, Australia), Tata Institute of Fundamental Research (Mumbai) and Indian Institute of Science Education and Research (Kolkata), and an Honorary Professor at the Jawaharlal Nehru Centre for Advanced Scientific Research (Bangalore). We thank Suman Bandari for help with initial experiments, and members of the Chattopadhyay laboratory for their comments and discussions.

SUPPORTING INFORMATION

Figure S1: Effect of treatment conditions on HEK-5-HT1AR cell viability.

CONFLICT OF INTEREST

The authors declare no competing financial interests. 31 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES

1.

Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002) Seven transmembrane receptors, Nat. Rev. Mol. Cell. Biol. 3, 639-650.

2.

Rosenbaum, D. M., Rasmussen, S. G. F., and Kobilka, B. K. (2009) The structure and function of G-protein-coupled receptors, Nature 459, 356-363.

3.

Palczewski, K., and Orban, T. (2013) From atomic structures to neuronal functions of G protein-coupled receptors, Annu. Rev. Neurosci. 36, 139-164.

4.

Chattopadhyay, A. (2014) GPCRs: lipid-dependent membrane receptors that act as drug targets, Adv. Biol. 2014, 143023.

5.

Weis, W. I., and Kobilka, B. K. (2018) The molecular basis of G protein-coupled receptor activation, Annu. Rev. Biochem. 87, 897-919.

6.

Bosier, B., and Hermans, E. (2007) Versatility of GPCR recognition by drugs: from biological implications to therapeutic relevance, Trends Pharmacol. Sci. 28, 438-446.

7.

Cooke, R. M., Brown, A. J. H., Marshall, F. H., and Mason, J. S. (2015) Structures of G protein-coupled receptors reveal new opportunities for drug discovery, Drug Discov. Today 20, 1355-1364.

8.

Jacobson, K. A. (2015) New paradigms in GPCR drug discovery, Biochem. Pharmacol. 98, 541-555.

9.

Sriram, K., and Insel, P. A. (2018) G protein-coupled receptors as targets for approved drugs: how many targets and how many drugs? Mol. Pharmacol. 93, 251258.

10.

Ferguson, S. S. G. (2001) Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling, Pharmacol. Rev. 53, 124.


Page 32 of 52

Page 33 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

11.

Hanyaloglu, A. C., and von Zastrow, M. (2008) Regulation of GPCRs by endocytic membrane trafficking and its potential implications, Annu. Rev. Pharmacol. Toxicol. 48, 537-568.

12.

Magalhaes, A. C., Dunn, H., and Ferguson, S. S. G. (2012) Regulation of GPCR activity, trafficking and localization by GPCR-interacting proteins, Br. J. Pharmacol. 165, 1717-1736.

13.

Lane, J. R., Abdul-Ridha, A., and Canals, M. (2013) Regulation of G protein-coupled receptors by allosteric ligands, ACS Chem. Neurosci. 4, 527-534.

14.

Irannejad, R., Tomshine, J. C., Tomshine, J. R., Chevalier, M., Mahoney, J. P., Steyaert, J., Rasmussen, S. G. F., Sunahara, R. K., El-Samad, H., Huang, B., and von Zastrow, M. (2013) Conformational biosensors reveal GPCR signaling from endosomes, Nature 495, 534-538.

15.

Irannejad, R., Tsvetanova, N. G., Lobingier, B. T., and von Zastrow, M. (2015) Effects of endocytosis on receptor-mediated signaling, Curr. Opin. Cell Biol. 35, 137143.

16.

Bowman, S. L., Shiwarski, D. J., and Puthenveedu, M. A. (2016) Distinct G proteincoupled receptor recycling pathways allow spatial control of downstream G protein signaling, J. Cell Biol. 214, 797-806.

17.

Lyga, S., Volpe, S., Werthmann, R. C., Götz, K., Sungkaworn, T., Lohse, M. J., and Calebiro, D. (2016) Persistent cAMP signaling by internalized LH receptors in ovarian follicles, Endocrinology 157, 1613-1621.

18.

Pucadyil, T. J., Kalipatnapu, S., and Chattopadhyay, A. (2005) The serotonin1A receptor: a representative member of the serotonin receptor family, Cell. Mol. Neurobiol. 25, 553-580.

19.

Müller, C. P., Carey, R. J., Huston, J. P., and De Souza Silva, M. A. (2007) Serotonin and psychostimulant addiction: focus on 5-HT1A-receptors. Prog. Neurobiol. 81, 133178. 33 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

20.

Lacivita, E., Leopoldo, M., Berardi, F., and Perrone, R. (2008) 5-HT1A receptor, an old target for new therapeutic agents, Curr. Top. Med. Chem. 8, 1024-1034.

21.

Fiorino, F., Severino, B., Magli, E., Ciano, A., Caliendo, G., Santagada, V., Frecentese, F., and Perissutti, E. (2014) 5-HT1A receptor: an old target as a new attractive tool in drug discovery from central nervous system to cancer, J. Med. Chem. 57, 4407-4426.

22.

Akimova, E., Lanzenberger, R., and Kasper, S. (2009) The serotonin-1A receptor in anxiety disorders, Biol. Psychiatry 66, 627- 635.

23.

Kaufman, J., DeLorenzo, C., Choudhury, S., and Parsey, R. V. (2016) The 5-HT1A receptor in major depressive disorder, Eur. Neuropsychopharmacol. 26, 397-410.

24.

Ohno, Y. (2011) Therapeutic role of 5-HT1A receptors in the treatment of schizophrenia and Parkinson’s disease, CNS Neurosci. Ther. 17, 58-65.

25.

Miyazaki, I., and Asanuma, M. (2016) Serotonin 1A receptors on astrocytes as a potential target for the treatment of Parkinson’s disease, Curr. Med. Chem. 23, 686700.

26.

Chattopadhyay, A., Rukmini, R., and Mukherjee, S. (1996) Photophysics of a neurotransmitter: ionization and spectroscopic properties of serotonin, Biophys. J. 71, 1952-1960.

27.

Sarkar, P., Kumar, G. A., Pal, S., and Chattopadhyay, A. (2018) Biophysics of Serotonin and the Serotonin1A Receptor: Fluorescence and Dynamics, in Serotonin: the Mediator that Spans Evolution (Pilowsky, P., Ed.), Elsevier, pp. 3-22.

28.

Azmitia, E. C. (2007) Serotonin and brain: evolution, neuroplasticity, and homeostasis, Int. Rev. Neurobiol. 77, 31-56.

29.

Albert, P. R., Benkelfat, C., and Descarries, L. (2012) The neurobiology of depression

____

revisiting the serotonin hypothesis. I. Cellular and molecular

mechanisms, Phil. Trans. R. Soc. B 367, 2378-2381.


Page 34 of 52

Page 35 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

30.

Nutt, D. J., Forshall, S., Bell, C., Rich, A., Sandford, J., Nash, J., and Argyropoulos, S. (1999) Mechanisms of action of selective serotonin reuptake inhibitors in the treatment of psychiatric disorders, Eur. Neuropsychopharmacol. 3, S81-S86.

31.

Vaswani, M., Linda, F. K., and Ramesh, S. (2003) Role of selective serotonin reuptake inhibitors in psychiatric disorders: a comprehensive review, Prog. Neuropsychopharmacol. Biol. Psychiatry 27, 85-102.

32.

Blier, P., and Ward, N. M. (2003) Is there a role for the 5-HT1A agonists in the treatment of depression? Biol. Psychiatry 53, 193-203.

33.

Riad, M., Watkins, K. C., Doucet, E., Hamon, M., and Descarries, L. (2001) Agonistinduced internalization of serotonin-1A receptors in the dorsal raphe nucleus (autoreceptors) but not hippocampus (heteroreceptors), J. Neurosci. 21, 8378-8386.

34.

Zimmer, L., Riad, M., Rbah, L., Belkacem-Kahlouli, A., Le Bars, D., Renaud, B., and Descarries, L. (2004) Toward brain imaging of serotonin 5-HT1A autoreceptor internalization, Neuroimage 22, 1421-1426.

35.

Bouaziz, E., Emerit, M. B., Vodjdani, G., Gautheron, V., Hamon, M., Darmon, M., and Masson, J. (2014) Neuronal phenotype dependency of agonist-induced internalization of the 5-HT1A serotonin receptor, J. Neurosci. 34, 282-294.

36.

Riad, M., Zimmer, L., Rbah, L., Watkins, K. C., Hamon, M., and Descarries, L. (2004) Acute treatment with the antidepressant fluoxetine internalizes 5-HT1A autoreceptors and reduces the in vivo binding of the PET radioligand [18F]MPPF in the nucleus raphe dorsalis of rat, J. Neurosci. 24, 5420-5426.

37.

Descarries, L., and Riad, M. (2012) Effects of the antidepressant fluoxetine on the subcellular localization of 5-HT1A receptors and SERT, Phil. Trans. R. Soc. B 367, 2416-2425.

38.

Pucadyil, T. J., and Chattopadhyay, A. (2004) Cholesterol modulates ligand binding and G-protein coupling to serotonin1A receptors from bovine hippocampus, Biochim. Biophys. Acta 1663, 188-200. 35 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

39.

Paila, Y. D., Murty, M. R. V. S., Vairamani, M., and Chattopadhyay, A. (2008) Signaling by the human serotonin1A receptor is impaired in cellular model of SmithLemli-Opitz syndrome, Biochim. Biophys. Acta 1778, 1508-1516.

40.

Shrivastava, S., Pucadyil, T. J., Paila, Y. D., Ganguly, S., and Chattopadhyay, A. (2010) Chronic cholesterol depletion using statin impairs the function and dynamics of human serotonin1A receptors, Biochemistry 49, 5426-5435.

41.

Jafurulla, M., Rao, B. D., Sreedevi, S., Ruysschaert, J.-M., Covey, D. F., and Chattopadhyay, A. (2014) Stereospecific requirement of cholesterol in the function of the serotonin1A receptor, Biochim. Biophys. Acta 1838, 158-163.

42.

Pucadyil, T. J., and Chattopadhyay, A. (2007) Cholesterol depletion induces dynamic confinement of the G-protein coupled serotonin1A receptor in the plasma membrane of living cells, Biochim. Biophys. Acta 1768, 655-668.

43.

Ganguly, S., Clayton, A. H. A., and Chattopadhyay, A. (2011) Organization of higher-order oligomers of the serotonin1A receptor explored utilizing homo-FRET in live cells, Biophys. J. 100, 361-368.

44.

Paila, Y. D., Kombrabail, M., Krishnamoorthy, G., and Chattopadhyay, A. (2011) Oligomerization of the serotonin1A receptor in live cells: a time-resolved fluorescence anisotropy approach, J. Phys. Chem. B 115, 11439-11447.

45.

Prasanna, X., Sengupta, D., and Chattopadhyay, A. (2016) Cholesterol-dependent conformational plasticity in GPCR dimers, Sci. Rep. 6, 31858.

46.

Ganguly, S., and Chattopadhyay, A. (2010) Cholesterol depletion mimics the effect of cytoskeletal destabilization on membrane dynamics of the serotonin1A receptor: a zFCS study, Biophys. J. 99, 1397-1407.

47.

Chakraborty, H., Jafurulla, M., Clayton, A. H. A., and Chattopadhyay, A. (2018) Exploring oligomeric state of the serotonin1A receptor utilizing photobleaching image correlation spectroscopy: implications for receptor function, Faraday Discuss. 207, 409-421. 36 ACS Paragon Plus Environment

Page 36 of 52

Page 37 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

48.

Pucadyil, T. J., Kalipatnapu, S., Harikumar, K. G., Rangaraj, N., Karnik, S. S., and Chattopadhyay, A. (2004) G-protein-dependent cell surface dynamics of the human serotonin1A receptor tagged to yellow fluorescent protein, Biochemistry 43, 1585215862.

49.

Hislop, J. N., and von Zastrow, M. (2011) Analysis of GPCR localization and trafficking, Methods Mol. Biol. 746, 425-440.

50.

Kalipatnapu, S., Pucadyil, T. J., Harikumar, K. G., and Chattopadhyay, A. (2004) Ligand binding characteristics of the human serotonin1A receptor heterologously expressed in CHO cells, Biosci. Rep. 24, 101-115.

51.

Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid, Anal. Biochem. 150, 76-85.

52.

Higashijima, T., Ferguson, K. M., Sternweis, P. C., Smigel, M. D., and Gilman, A. G. (1987) Effects of Mg2+ and the βγ-subunit complex on the interactions of guanine nucleotides with G proteins, J. Biol. Chem. 262, 762-766.

53.

Kalipatnapu, S., and Chattopadhyay, A. (2004) A GFP fluorescence-based approach to determine detergent insolubility of the human serotonin1A receptor, FEBS Lett. 576, 455-460.

54.

Manders, E. M. M., Verbeek, F. J., and Aten, J. A. (1993) Measurement of colocalization of objects in dual-colour confocal images, J. Microsc. 169, 375-382.

55.

Costes, S. V., Daelemans, D., Cho, E. H., Dobbin, Z., Pavlakis, G., and Lockett, S. (2004) Automatic and quantitative measurement of protein-protein colocalization in live cells, Biophys. J. 86, 3993-4003.

56.

Bolte, S., and Cordelières, F. P. (2006) A guided tour into subcellular colocalization analysis in light microscopy, J. Microsc. 224, 213-232.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

57.

Roy, S., Kumar, G. A., Jafurulla, M., Mandal, C., and Chattopadhyay, A. (2014) Integrity of the actin cytoskeleton of host macrophages is essential for Leishmania donovani infection, Biochim. Biophys. Acta 1838, 2011-2018.

58.

Malmberg, Å., and Strange, P. G. (2000) Site-directed mutations in the third intracellular loop of the serotonin 5-HT1A receptor alter G protein coupling from Gi to Gs in a ligand-dependent manner, J. Neurochem. 75, 1283-1293.

59.

Giulietti, M., Vivenzio, V., Piva, F., Principato, G., Bellantuono, C., and Nardi, B. (2014) How much do we know about the coupling of G-proteins to serotonin receptors? Mol. Brain 7, 49.

60.

Harikumar, K. G., and Chattopadhyay, A. (1999) Differential discrimination of Gprotein coupling of serotonin1A receptors from bovine hippocampus by an agonist and an antagonist, FEBS Lett. 457, 389-392.

61.

Tate, C. G. (2012) A crystal clear solution for determining G-protein-coupled receptor structures, Trends Biochem. Sci. 37, 343-352.

62.

Forster, E. A., Cliffe, I. A., Bill, D. J., Dover, G. M., Jones, D., Reilly, Y., and Fletcher, A. (1995) A pharmacological profile of the selective silent 5-HT1A receptor antagonist, WAY-100635, Eur. J. Pharmacol. 281, 81-88.

63.

Kung, H. F., Stevenson, A., Zhuang, Z.-P., Kung, M.-P., Frederick, D., and Hurt, S. D. (1996) New 5-HT1A receptor antagonist: [3H]p-MPPF, Synapse 23, 344-346.

64.

Barr, A. J., and Manning, D. R. (1997) Agonist-independent activation of Gz by the 5-hydroxytryptamine1A receptor co-expressed in Spodoptera frugiperda cells. Distinguishing inverse agonists from neutral antagonists, J. Biol. Chem. 272, 3297932987.

65.

Doherty, G. J., and McMahon, H. T. (2009) Mechanisms of endocytosis, Annu. Rev. Biochem. 78, 857-902.

66.

von Kleist, L., Stahlschmidt, W., Bulut, H., Gromova, K., Puchkov, D., Robertson, M. J., MacGregor, K. A., Tomilin, N., Pechstein, A., Chau, N., Chircop, M., Sakoff, 38 ACS Paragon Plus Environment

Page 38 of 52

Page 39 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

J., von Kries, J. P., Saenger, W., Kräusslich, H.-G., Shupliakov, O., Robinson, P. J., McCluskey, A., and Haucke, V. (2011) Role of the clathrin terminal domain in regulating coated pit dynamics revealed by small molecule inhibition, Cell 146, 471484. 67.

Aoki, T., Nomura, R., and Fujimoto, T. (1999) Tyrosine phosphorylation of caveolin1 in the endothelium, Exp. Cell Res. 253, 629-636.

68.

Hopkins, C. R., and Trowbridge, I. S. (1983) Internalization and processing of transferrin and the transferrin receptor in human carcinoma A431 cells, J. Cell Biol. 97, 508-521.

69.

Eidels, L., Proia, R. L., and Hart, D. A. (1983) Membrane receptors for bacterial toxins, Microbiol. Rev. 47, 596-620.

70.

van der Sluijs, P., Hull, M., Zahraoui, A., Tavitian, A., Goud, B., and Mellman, I. (1991) The small GTP-binding protein rab4 is associated with early endosomes, Proc. Natl. Acad. Sci. U.S.A. 88, 6313-6317.

71.

van der Sluijs, P., Hull, M., Webster, P., Mâle, P., Goud, B., and Mellman, I. (1992) The small GTP-binding protein rab4 controls an early sorting event on the endocytic pathway, Cell 70, 729-740.

72.

Ullrich, O., Reinsch, S., Urbé, S., Zerial, M., and Parton, R. G. (1996) Rab11 regulates recycling through the pericentriolar recycling endosome, J. Cell Biol. 135, 913-924.

73.

Ren, M., Xu, G., Zeng, J., De Lemos-Chiarandini, C., Adesnik, M., and Sabatini, D. D. (1998) Hydrolysis of GTP on rab11 is required for the direct delivery of transferrin from the pericentriolar recycling compartment to the cell surface but not from sorting endosomes, Proc. Natl. Acad. Sci. U.S.A. 95, 6187-6192.

74.

Hutagalung, A. H., and Novick, P. J. (2011) Role of Rab GTPases in membrane traffic and cell physiology, Physiol. Rev. 91, 119-149.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

75.

Ganguly, S., Pucadyil, T. J., and Chattopadhyay, A. (2008) Actin cytoskeletondependent dynamics of the human serotonin1A receptor correlates with receptor signaling, Biophys. J. 95, 451-463.

76.

Jones, B., Buenaventura, T., Kanda, N., Chabosseau, P., Owen, B. M., Scott, R., Goldin, R., Angkathunyakul, N., Corrêa Jr., I. R., Bosco, D., Johnson, P. R., Piemonti, L., Marchetti, P., Shapiro, A. M. J., Cochran, B. J., Hanyaloglu, A. C., Inoue, A., Tan, T., Rutter, G. A., Tomas, A., and Bloom, S. R. (2018) Targeting GLP-1 receptor trafficking to improve agonist efficacy, Nat. Commun. 9, 1602.

77.

Wolfe, B. L., and Trejo, J. (2007) Clathrin-dependent mechanisms of G proteincoupled receptor endocytosis, Traffic 8, 462-470.

78.

Bhatnagar, A., Sheffler, D. J., Kroeze, W. K., Compton-Toth, B., and Roth, B. L. (2004) Caveolin-1 interacts with 5-HT2A serotonin receptors and profoundly modulates the signaling of selected Gαq-coupled protein receptors, J. Biol. Chem. 279, 34614-34623.

79.

Ostrom, R. S., and Insel, P. A. (2004) The evolving role of lipid rafts and caveolae in G protein-coupled receptor signaling: implications for molecular pharmacology, Br. J. Pharmacol. 143, 235-245.

80.

Janoshazi, A., Deraet, M., Callebert, J., Setola, V., Guenther, S., Saubamea, B., Manivet, P., Launay, J.-M., and Maroteaux, L. (2007) Modified receptor internalization upon coexpression of 5-HT1B receptor and 5-HT2B receptor, Mol. Pharmacol. 71, 1463-1474.

81.

Cho, D. I., Min, C., Jung, K. S., Cheong, S. Y., Zheng, M., Cheong, S. J., Oak, M. H., Cheong, J. H., Lee, B. K., and Kim, K. M. (2012) The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes, Br. J. Pharmacol. 166, 659-675.


Page 40 of 52

Page 41 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

82.

Fichter, K. M., Flajolet, M., Greengard, P., and Vu, T. Q. (2010) Kinetics of Gprotein-coupled receptor endosomal trafficking pathways revealed by single quantum dots, Proc. Natl. Acad. Sci. U.S.A. 107, 18658-18663.

83.

Della Rocca, G. J., Mukhin, Y. V., Garnovskaya, M. N., Daaka, Y., Clark, G. J., Luttrell, L. M., Lefkowitz, R. J., and Raymond, J. R. (1999) Serotonin 5-HT1A receptor-mediated Erk activation requires calcium/calmodulin-dependent receptor endocytosis, J. Biol. Chem. 274, 4749-4753.

84.

Thomsen, A. R. B., Jensen, D. D., Hicks, G. A., and Bunnett, N. W. (2018) Therapeutic targeting of endosomal G-protein-coupled receptors, Trends Pharmacol. Sci. 39, 879-891.

85.

Bernier, V., Lagacé, M., Bichet, D. G., and Bouvier, M. (2004) Pharmacological chaperones: potential treatment for conformational diseases, Trends Endocrinol. Metab. 15, 222-228.

86.

Holingsworth, T. J., and Gross, A. K. (2012) Defective trafficking of rhodopsin and its role in retinal degenerations, Int. Rev. Cell Mol. Biol. 293, 1-44.

87.

Dorsam, R. T., and Gutkind, J. S. (2007) G-protein-coupled receptors and cancer, Nat. Rev. Cancer 7, 79-94.

88.

Ghosh, E., Srivastava, A., Baidya, M., Kumari, P., Dwivedi, H., Nidhi, K., Ranjan, R., Dogra, S., Koide, A., Yadav, P. N., Sidhu, S. S., Koide, S., and Shukla, A. K. (2017) A synthetic intrabody-based selective and generic inhibitor of GPCR endocytosis, Nat. Nanotechnol. 12, 1190-1198.

89.

Pucadyil, T. J., and Chattopadhyay, A. (2006) Role of cholesterol in the function and organization of G-protein coupled receptors, Prog. Lipid Res. 45, 295-333.

90.

Paila, Y. D., and Chattopadhyay, A. (2010) Membrane cholesterol in the function and organization of G-protein coupled receptors, Subcell. Biochem. 51, 439-466.

91.

Jafurulla, M., and Chattopadhyay, A. (2013) Membrane lipids in the function of serotonin and adrenergic receptors, Curr. Med. Chem. 20, 47-55. 41 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

92.

Jafurulla, M., and Chattopadhyay, A. (2015) Sphingolipids in the function of G protein-coupled receptors, Eur. J. Pharmacol. 763, 241-246.

93.

Sengupta, D., and Chattopadhyay, A. (2015) Molecular dynamics simulations of GPCR-cholesterol interaction: an emerging paradigm, Biochim. Biophys. Acta 1848, 1775-1782.

94.

Sengupta, D., Prasanna, X., Mohole, M., and Chattopadhyay, A. (2018) Exploring GPCR-lipid interactions by molecular dynamics simulations: excitements, challenges and the way forward, J. Phys. Chem. B 122, 5727-5737.

95.

van Meer, G., and de Kroon, A. I. P. M. (2011) Lipid map of the mammalian cell, J. Cell Sci. 124, 5-8.


Page 42 of 52

Page 43 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Only


Biochemistry

(a)

(b)

Anti-myc antibody Alexa Fluor 488

(c)

DAPI

Merge

(d)

1.0 1.0

SPECIFIC [3H]8-OH-DPAT B (%) BINDING

BOUND [ H]8-OH-DPAT (nM)

BOUND [3 3H]8-OH-DPAT (nM)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Page 44 of 52

Figure 1 Kumar et al.

0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0 0

2 4 6 8 33 FREE (nM) FREE[ [H]8-OH-DPAT H]8-OH-DPAT (nM)

10

100 100 80 80

Equ

60 60

Adj

40 40

B B

20 20

00 12


B B 1E-11 11

1E-7 10 1E-9 9 8 7 6 A -log [GTP-γ-S] (M)

1E-5 5

4

Page 45 of 52

(a)


(b) 400

CONTROL

CELL BCOUNTS

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Biochemistry

Unstained Control Serotonin

300

200

100

0

0

50 100 150 ALEXA FLUOR 488 A FLUORESCENCE

SEROTONIN Serotonin1A receptor Anti-myc antibody Alexa Fluor 488

(c) CONTROL

(d) SEROTONIN

DiIC16


Merge


Biochemistry

100 100

**

**

80 80

B

NORMALIZED MODE COUNT

(a)

***

60 60

40 40 0 0

15

20

30

40

45

60

60

A

TIME (MIN)

(b) 120 120

NORMALIZED B MODE COUNT

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Page 46 of 52


100 100

80 80

**

* ***

60 60

40 40

20 20

0

11nM nM

100nM 10 nM 100 nM 10 μM A SEROTONIN CONCENTRATION


Page 47 of 52


(a) 120 120

B MODE COUNT NORMALIZED

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Biochemistry

100 100 80 80

***

60 60 40 40 20 20

SEROTONIN ICE

-

+ -

+ A +

+ -

+ -

SUCROSE

-

-

-

+

-

AZIDE

-

-

-

-

+

(b) ICE

(c) SUCROSE

(d) AZIDE

DiIC16



Merge

Biochemistry

(a) 100 100

NORMALIZEDBMODE COUNT

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Page 48 of 52


80 80

*

60 60

40 40

SEROTONIN WAY-100635

-

+ -

+ A +

+ -

+ -

p-MPPF

-

-

-

+

-

p-MPPI

-

-

-

-

+

(b) WAY-100635

(c) p-MPPF

(d) p-MPPI

DiIC16



Merge

Page 49 of 52


(a) 100 100

NORMALIZEDBMODE COUNT

80 80

** ***

60 60

40 40

20 20

0

SEROTONIN

Control -

Serotonin +

PITSTOP 2

-

-

GENISTEIN

-

-

A

PitStop + 2

Genistein +

+

-

-

+

(d)

(b)

0.8 0.8

Merge

0.6 0.6

(c)

Anti-myc Cholera Toxin B antibody Alexa Fluor 594 Alexa Fluor 488

***

M

Anti-myc Transferrin antibody Alexa Fluor 568 Alexa Fluor 488

B

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Biochemistry

0.4 0.4

Merge


0.2 0.2

Transferrin TRANSFERRIN

A

Cholera toxin CHOLERA TOXIN B

Biochemistry

Rab4

(a)

(b)

0.5 0.5

B

M

0.6 0.6

0.4 0.4

0.3 0.3

Anti-myc antibody Alexa Fluor 488 0 0

15 15

30 30

A

45 45

Rab4 Alexa Fluor 568

Merge

Rab11A Alexa Fluor 568

Merge

Anti-myc LysoTracker Red antibody Alexa Fluor 488

Merge

60 60

Rab11A

(c)

(d)

M

B

0.6 0.6

0.4 0.4

0.2 0.2

Anti-myc antibody Alexa Fluor 488 0 0

30 30

60 60

A

90 90

120 120

LysoTracker Red

(e)

(f)

0.4 0.4

0.2 0.2

B

M

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Page 50 of 52


0.0 0.0

0 0

30 30

60 60

A

90 90

120 120

TIME (MIN) ACS Paragon Plus Environment

Page 51 of 52


100 100

NORMALIZED B MODE COUNT

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Biochemistry

80 80

***

60 60

40 40

20 20

0

CONTROL

A SEROTONIN 60 MIN

SEROTONIN 60 MIN + CHASE 60 MIN


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

Page 52 of 52


Serotonin

Endosomal recycling

Clathrin-mediated endocytosis

Late recycling endosome

Early recycling endosome

Serotonin1A receptor Clathrin Rab4; early recycling endosome marker Rab11A; late recycling endosome marker


Exploring Endocytosis and Intracellular Trafficking of the Human

Recommend Documents