Subscriber access provided by Northern Illinois University
Article
Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-quadruplex and Duplex DNA, showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches Snehasish Bhattacharjee, Sandipan Chakraborty, Pradeep Kumar Sengupta, and Sudipta Bhowmik J. Phys. Chem. B, Just Accepted Manuscript • DOI: 10.1021/acs.jpcb.6b06357 • Publication Date (Web): 04 Aug 2016 Downloaded from http://pubs.acs.org on August 6, 2016
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
The Journal of Physical Chemistry B is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 12
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
The Journal of Physical Chemistry
Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-quadruplex and Duplex DNA, showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches Snehasish Bhattacharjee†, Sandipan Chakraborty‡, Pradeep K. Sengupta†* and Sudipta Bhowmik†* †
Department of Biophysics, Molecular Biology & Bioinformatics, University of Calcutta, 92 Acharya Prafulla Chandra Road, Kolkata 700009, India. ‡ Department of Microbiology, University of Calcutta, 35 Ballygunge Circular Road, Kolkata 700019, India. ABSTRACT: Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than the G4 DNA. Molecular docking results also corroborate our spectroscopic results and it was found that both the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoids scaffolds.
INTRODUCTION Repetitive guanine (G)-rich sequences can form Gquadruplex (G4) structures consisting of π–π stacking of planar G-tetrads, which arises from the association of four guanines through cyclic Hoogsteen hydrogen bonding (Scheme 1a).1-3 The central cavity of G4 is occupied by cations (typically K+ or Na+), which stabilize the overall structure.2-4 The DNA G4 shows a structural diversity and differential thermodynamic properties depending on the length and sequence of the DNA strands, strand direction, loop orientation, and environmental factors, such as cations, molecular crowding etc.5-9 These G4 structures have been detected in human and other mammalian cells thus establishing their existence in vivo.10,11 There is now growing evidence that G4 structures can modulate different biological processes such as replication,12 telomere maintenance,13,14 and regulation of gene expression at the transcription15 and translation levels.16 G4 DNA structures have now emerged as promising targets for anticancer drugs because of their abundance in the human telomeres and promoter regions of several oncogenes.15,17 Various small molecules such as telomostatin,18 porphyrins,19 perylene,20 acridine,21 quindoline22 derivatives etc. have been investigated to evaluate their ability to interact with G4 DNA and observe their biological functions. Thus the detailed understanding of
the interaction between small molecules and G4 DNA structures from the biophysical chemistry perspective may lead a promising avenue in therapeutic intervention. Flavonoids are a group of polyphenolic compounds which are ubiquitous in higher plants where they are produced as secondary metabolites.23 Their chemical structures are based on a common diphenylpropane skeleton comprising two benzene rings [A (benzoyl ring) and B (cinnamoyl ring)] linked via a heterocyclic pyran or pyrone (with a double bond) ring (C) in the middle (Scheme 1b).24 Flavonoids are present in practically all dietary plant-based food and beverage items and therefore, they are consumed in considerable amounts through the human diet. Various studies have suggested the protective effects of flavonoids against many infectious and degenerative diseases such as cardiovascular diseases, cancers, and other age-related diseases.23,25 These low molecular weight substances have high pharmacological potency and low cytotoxicity which make them viable alternatives to conventional therapeutic drugs.23 While a large number of small molecular ligands are presently known for G4 DNA (comprising both telomeric and promoter sequences),26 the bulk of these compounds are of synthetic origin. In this context, the prospects of dietary flavonoids as potential G4 ligands are especially interesting, in relation to the quest for novel anticancer therapeutics. This is
ACS Paragon Plus Environment
The Journal of Physical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 2 of 12
lemons etc. and possesses diverse range of pharmacological activities.35,36 Fisetin differs from naringenin by the presence of an -OH group at the 3-position and a C2=C3 double bond in the C-ring (Scheme 1). The presence of the double bond in the C-ring of fisetin results in the planarity of A- and C-rings, whereas the C-ring of naringenin is not planar.37 Conjugation between the C2=C3 double-bond and C4=O on the C ring is responsible for antioxidant activity through formation of an electron delocalization system.37 The three-dimensional structure of flavonoids is important, because it affects the interaction with biomolecules. In the present work, we have explored the interactions of these two structurally closely similar compounds (which we chose as representatives of the two different classes of dietary bioflavonoids) with parallel G4 along with the double stranded DNA (duplex), using a combination of different spectroscopic and computational studies. The present research reveals that the structural differences between fisetin and naringenin lead to differential interaction of these compounds with different DNA structures. EXPERIMENTAL SECTION
Scheme 1. Structures of (a) G-quartet, (b) Flavonoid skeleton, (c) Fisetin and (d) Naringenin.
related to the facts that several such compounds with distinct structures are available in nature, and their low cytotoxicity presents an attractive feature. Moreover, several flavonoids possess exquisitely sensitive intrinsic fluorescence,27,28 which permits ‘label free’ fluorescence sensing of their interactions with G4 DNA, via spectroscopy or imaging. The binding activity of flavonoids to various nucleic acid structures and their proven antitumour activity in cancer cell lines established the significance of flavonoid-DNA interaction studies.29 Fisetin (Scheme 1c) is a naturally occurring flavonol present in different fruits, vegetables, nuts and wine30 and has been reported to exhibit anticancer,30 neuroprotective27,31 and other related therapeutic activities.32 On a different scenario, fisetin has remarkable spectroscopic importance, especially due to its ‘dual emission’ behavior, for which it has been the focus of increasing attention as an exquisitely sensitive natural fluorescent probe with promising potential.27,33,34 Another important natural bioflavonoid is naringenin (Scheme 1d) which is a flavanone, and unlike fisetin, it is non-fluorescent. It is widely distributed in grapes and various citrus fruits such as oranges,
Materials and Sample Preparation. Fisetin, naringenin, cmyc G4 DNA sequence 5′d(TGAGGGTGGGTAGGGTGGGTAA)-3′ and duplex DNA sequence 5′-d(CAATCGGATCGAATTCGATCCGATTG)-3′ were procured from Sigma Aldrich and were used as obtained. The solvents used were of spectroscopic grade. Stock solutions of fisetin and naringenin were prepared in methanol (because of low solubility in an aqueous medium), and the final experimental concentrations of all flavonoids were kept on the order of 10−6 M, methanol
