Fabrication of Inverted High-Density DNA Microarrays in a

Subscriber access provided by Nottingham Trent University

Biological and Medical Applications of Materials and Interfaces

Fabrication of Inverted High-Density DNA Microarrays in a Hydrogel Justin Costa, Paul Dentinger, Glenn H. McGall, Filip Crnogorac, and Wei Zhou ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b07755 • Publication Date (Web): 07 Aug 2019 Downloaded from pubs.acs.org on August 7, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Fabrication of Inverted High-Density DNA Microarrays in a Hydrogel Justin A. Costa*1,2, Paul M. Dentinger1,2, Glenn H. McGall1, Filip Crnogorac1, Wei Zhou1 * To whom correspondence should be addressed. Tel: 1 (650) 618-0111; Fax: (650) 618-0121; Email:[email protected] 1

Centrillion Technologies, 2500 Faber Place, Palo Alto, CA 94303, USA

2 These

authors contributed equally to this work

KEYWORDS Microarray, hydrogel, phosphoramidite, DNA synthesis, silanation, photoresist

ABSTRACT Current techniques for making high-resolution, photolithographic DNA microarrays suffer from the limitation that the 3’ end of each sequence is anchored to a hard substrate and hence unavailable for many potential enzymatic reactions. Here we demonstrate a technique that inverts the entire microarray into a hydrogel. This method preserves the spatial fidelity of the original pattern while simultaneously removing incorrectly synthesized oligomers that are inherent to all

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

other microarray fabrication strategies. First, a standard 5’-up microarray on a donor wafer is synthesized, in which each oligo is anchored with a cleavable linker at the 3’ end and an Acrydite phosphoramadite at the 5’ end. Following synthesis of the array, an acrylamide monomer solution is applied to the donor wafer, and an acrylamide-silanized acceptor wafer is placed on top. As the polyacrylamide hydrogel forms between the two wafers, it covalently incorporates the Acryditeterminated sequences into the matrix. Finally, the oligos are released from the donor wafer by immersion in an ammonia solution that cleaves the 3’-linkers, thus freeing the oligos at the 3’ end. The array is now presented 3’ up on the surface of the gel-coated acceptor wafer. Various types of on-gel enzymatic reactions demonstrate a versatile and robust platform that can easily be constructed with far more molecular complexity than traditional photolithographic arrays by endowing the system with multiple enzymatic substrates. We produce a new generation of microarray where highly ordered, purified oligos are inverted 3’-up, in a biocompatible soft hydrogel, and functional with respect to a wide variety of programable enzymatic reactions.


2

Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Modern high-density DNA microarrays combine in situ synthesis with photo-lithographic semiconductor manufacturing methods to provide arrays with densities of 108 discrete sequence features per cm2 or greater1–3. This approach uses near ultraviolet light as the 5’OH deprotection trigger4, in a “bottom up” fabrication strategy wherein each base is added sequentially upon exposure through a mask. Microarrays fabricated in this way have seen extensive use in a range of applications for molecular biology that include SNP genotyping5–8, cytogenetics9,10, nuclear proteomics11,12, and massively parallel analysis of the transcriptome13–18. Yet the versatility of microarrays belie the fact that virtually all of their associated assays are limited to detecting hybridization events by fluorescence, despite an extraordinary variety of enzymes that utilize DNA as a substrate. We theorized that fabricating an array in a hydrogel would create a unique environment and endow the platform with new enzymatic functionalities. There are several structurally inherent limitations to current high-resolution microarrays that largely restrict their use with enzymes. First, the array substrate is typically a hard, impermeable material such as quartz or silicon which can negatively impact the diffusion and interaction of enzymes with densely-packed oligos in close proximity to these surfaces; even when hydrophilic linking groups are added with the intention of “lifting” the oligos into a more favorable environment away from the surface19,20. Second, the length of oligos on microarrays that can be fabricated by sequential base addition is restricted due to the limited coupling yield efficiency of phosphoramadite chemistry. Even though the value of long, pure sequences has been established21– 23,

the coupling inefficiency during synthesis results in many truncated oligomer products

intermixed with the full-length sequences, and no straightforward method is available to selectively remove them24.


3


Page 4 of 28

Perhaps the greatest constraint with current photolithographic microarrays is the directional orientation of sequences, which are almost universally synthesized using Dimethoxytrityl (DMT) blocking phosphoramidite chemistry in the conventional 3’→5’ direction. This leaves the 3’ end of the array sequences attached to the surface (3’ down) and unable to participate in enzymatic reactions requiring a free 3’-hydroxyl group25. Arrays of inversely oriented (3’ up) oligonucleotides can be fabricated photolithographically using “reverse” direction (5’→3’) synthesis, but the required reagents are costly, cycle yields are lower, and the inability to purify the synthesized sequences makes it impractical for making arrays of oligos longer than 40 bases. Alternatively, microarrays have been fabricated using a “top-down” approach where the molecules are synthesized conventionally in 5’ up orientation with a linker at the 5’end, then cleaved and reacted to a substrate to produce oligos that are 3’up either by spotting or on beads5,21,26–31. However, arrays manufactured in this manner lose the scale, precision, and density achieved by the photolithographic, “bottom up” fabrication strategy. One might consider using the photoamidite method of direct 5’→ 3’ synthesis to realize a 3’ up array32,33. However, we have confirmed the known lower yields of photoamidites vs. DMT-chemistry, and others have reported further inefficiencies, making pure oligos greater than 50 bases of the correct sequence virtually unachievable by this method. One could also invert the oligos in situ by cyclization34, although this approach is chemically complex, low yield, and requires large quantities of reactants. This study presents our solution to the problems of synthesizing high density, inverted, enzyme compatible microarrays on a hydrogel substrate. Uniting the two microfabrication strategies, we first use conventional 3’→ 5’ synthesis (bottom up); then covalently anchor into a polyacrylamide hydrogel only the sequences which were not capped and therefore received the correct Acrydite phosphoramidite anchor (top down). After cleavage at the 3’ end to separate the


4

Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


two wafers, the resulting array of purified oligonucleotides are now inverted with the 3’ up on the surface of a hydrogel, while retaining the spatial register of sequences from the original pattern. Beyond the obvious advantages of being relatively inexpensive, scalable, and compatible with current machines and methods used for synthesizing microarrays, we believe that this capability will enable a new generation of high-density photolithographic arrays with unique applications that leverage the diverse biochemistry of nucleic acid enzymes35.


5


Page 6 of 28

Methods Cleavable Silane Synthesis. 2-Hydroxyethyl (methyl-(3-trimethoxysilanylpropyl)amino] propionate was synthesized as follows. Methylaminopropyltrimethoxysilane (MAPTMS) was cooled in an ice bath under nitrogen with stirring. Hydroxyethylacrylate (HEA) was added dropwise while stirring over 30 min, and the reaction was left stirring under nitrogen for 24 hours at room temperature (RT), and stored undiluted. Chip and Gel Preparation. Substrates were cleaned in Nano-strip® (KMG), rinsed and exposed to a 3 wt.% solution of silanating reagent in 5% water in ethanol for 4 hours, washed, dried, and held in a desiccator for at least 24 hours before RT atmospheric storage and use. For donor wafers, the silanating reagent was the cleavable silane described above unless otherwise stated, and for the acceptor wafer, 3acrylamidopropyl trimethoxy silane (Gelest). Silane coated, 2x3 inch slides were placed into an ABI (Applied Biosystems) 394 synthesizer with a custom flow cell inserted in place of the column in the flow path. The flow cell consisted of the substrate vacuum-held to an o-ring face seal. Reagents flowed into the cell as per normal synthesis. Exposures on the ABI apparatus were done on the 2x3 inch substrates and were performed with a custom exposure tool utilizing a 365 nm lamp housing with exposure through a proximity mask (Compugraphics, Fremont, CA). When specified, full 6-inch wafers were prepared in a similar manner with a similarly-modified flow cell connected to a Dr. Oligo (Biolytic, Fremont, CA) synthesizer. 6-inch wafers were exposed in vacuum contact on a Neutronix Quintel 8008AL (NxQ, Morgan Hill, CA) aligned exposure tool in a cleanroom in Palo Alto, CA, or when stated, a similar vacuum contact aligned exposure tool in Taiwan, ensuring intimate mask and wafer contact. Photoamidites (i.e. photo-T) were utilized and exposed as described elsewhere25. Typical wafers had 5 dimethoxytrityl-blocked T’s (DMT-T’s) placed on the bottom near the substrate uniformly across the wafer prior to the cleavable moieties of either one or two each. Universal Cleavable Linkers (UCL, AM Chemicals, Oceanside, CA) and then the sequence of interest were synthesized 3’ -> 5’. After the sequence of interest (AM1 5’-TACGATTCAGCCGATACAGC), another 4DMT-T’s were placed followed by patterning of the last T (either photo-T, or in the case of high-resolution demonstration a DMT-T with photoresist) of interest followed by AcryditeTM


6

Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Glen Research, Sterling, VA) addition. The 2x3 inch substrates were then manually cut into ~1 cm squares. Unless otherwise stated, a 5% tetramethylenediamine (TEMED, Aldrich, Milwaukee, WI) was prepared, a weighed 4.8 wt.% solution of potassium persulfate (Aldrich), saturated, and a 5% acrylamide solution with 5% bi-functional group (Bio-Rad, Hercules, CA, 161-0144) were prepared separately and outgassed for a minimum of 10 minutes and not exceeding 1 hour under nitrogen. 200 l of TEMED was added to 10 ml of the acrylamide solution. Then, 250 l of KPS was added and quickly stirred all without exposure to the atmosphere. Approximately 20 l of the reaction mixture was removed and added to the acylamide-silane coated substrate in air and the patterned, donor wafer pieces of either 1 cm squares or 7.5 mm x 7.5 mm die (diced from the 6inch wafers) were inverted on top. No attempt was made to exclude oxygen at this point and polymerization presumably progressed after the free radicals overwhelmed the dissolved oxygen between the sandwiched wafers. As a result, the edges of the polymerized gel were rough as the oxygen-affected polymerization altered the gel properties. The wafer “sandwich” with crosslinked pieces was placed in concentrated ammonia for 18 hours unless otherwise noted. For full 6-inch wafer gel transfer, approximately 300 l of the polymerization mixture was applied to the as-synthesized, 5’ up donor wafer and the quartz acceptor substrate laid on top, so the uniform wicking of the polymerization mixture could be observed. Typically, when the 2x3 inch substrates is diced into 8-10 mm pieces and inverted, the donor wafer pieces separated and floated from the gel by the force of the solution movement from the orbital shaker. Where the full complement of release chemistries was not used, either because of compatibility concerns with manufacturing wafers, or early experiments where it wasn’t yet clear the level of cleavable moieties required, gentle nudging was required. The wafer sandwiches sat in the ammonia until release before a solution of ethylene diamine: water (50:50, Aldrich Milwaukee, WI) was applied for 1-3 hours to finish the deprotection and ensure the complete, UCL reduction to 3’ OH. The gel wafers were then washed with water, followed by 4X SSC buffer (Aldrich) and were ready for hybridization. Hybridization was done with 25 nM of the complementary sequence, labelled at the 5’ end with Cy3 (IDT, Coralville, IA) overnight at 45 oC and allowed to cool for greater than 1 hour. The gel wafer was washed 3 times in 4X SSC, with the last held in wash solution for at least 5 minutes before imaging on a fluorescence microscope (Keyence BZ-X710 Itasca, IL).


7


Page 8 of 28

Laser perforation and dicing The sandwiched wafers were mounted on dicing tape (Nitto DU-300), and the top wafer (donor wafer) diced into 7.5 x 7.5 mm squares. The tool used was DISCO 2H6T dicing saw, spindle speed 26,000 rpm, feed rate = 1 mm / s, using a resin bonded diamond blade (Thermocarbon) of 0.3 mm width. The cut depth was 0.715 mm which would cut through the top wafer (donor wafer) and just touch the bottom wafer (acceptor wafer). Laser perforation was performed by Potomac Photonics, Inc. A 6 in wafer sandwich with the silicon top wafer was perforated at 1.75 mm intervals defining 7.5 x 7.5 mm chips. Hole diameter is estimated at 0.2 mm. The bottom (acceptor) wafer in this approach is quartz material which is transparent to the laser light (Nd:YAG, wavelength 1064 nm), such that the perforation process stops at the QZ wafers interface (after drilling a hole through the donor Si wafer). The process takes about 45 mins to make ~6000 holes covering the whole wafer. Probe extension assays. 5’CTGTCTCTTATACACATCTGAGCTGAATTCATAACTTCGTATAGCATACATTATAC GAAGTTATGCTGTATCGGCTGAATCGTA, the 84-base Template Oligo was ordered from IDT and hybridized to the inverted array for 2 hours in 2X SSC buffer at 45 oC. The array was then washed in 1X SSC buffer for 15 minutes at RT, then two more times in 0.5X SSC for 15 minutes each at RT. Extension was done using the DNA polymerase Klenow Large Fragment (New England Biolabs, Ipswitch, MA) under standard conditions at 37oC for 1 hour. The array was then washed in 1X SSC and submerged in a solution of 0.2 N NaOH for 10 minutes with shaking to strip away the template oligo, and finally equilibrated with 5 ml of 1X SSC. The Cy3 labeled probe targeting the Mosaic End sequence was then hybridized to the array and washed as before, then imaged on the Keyence BZ-X710. Patterning and transfer using the Centrillion Photoresist. To demonstrate high resolution, the AM1 oligo was prepared on 2x3 in substrate except that a 6-fluorescein phosphoramidite (6-FAM, Glen Research) was added in line, and the photo-T was replaced with DMT-T, and the DMT group left intact. The wafer was spin coated with the Centrillion Photoresist at 2500 rpm for 1 min., baked in a convection oven at 50 oC for 5 minutes, exposed at 36 mJ / cm2 and let sit at RT for 4 minutes. The Centrillion Photoresist is a proprietary


8

Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


formulation that generates spatially defined photoacid in the matrix upon exposure through a mask. The resist was stripped in PGMEA and isopropanol. The substrate was blown dry with nitrogen and put back in the synthesizer for an Acrydite, inverted onto a gel, and imaged on the Keyence microscope using the FITC channel.


9


Page 10 of 28

Results Fabrication of inverted microarrays in a hydrogel. The first step in the fabrication process is to prepare a cleavable donor substrate onto which the DNA can be patterned and later released. Towards this end, a monolayer of 2Hydroxyethyl (methyl-(3-trimethoxysilanylpropyl)amino] propionate was coated onto a 2x3 inch silicon substrate (Figure S1). This is a cleavable silane that undergoes ester hydrolysis in concentrated base; a convenient arrangement as concentrated base is used during final deprotection of the synthesized oligos on the array (Figure S1). In addition to using a cleavable silane, we also incorporate a universal cleavable linker amidite, or UCL, in-line early during synthesis to the growing DNA chains. This amidite also undergoes reduction and cleavage in basic conditions, leaving the nucleotide just 5’ to the UCL reduced to a 3’ hydroxyl. This combination of cleavable silane and amidite ensures that during the final deprotection step there is complete release of the oligos from the surface of the donor substrate (see Figure S2 for chemical structures). After the donor substrate was prepared, a foundational layer of 5 Thymine bases were synthesized on it using Dimethoxytrityl (DMT) blocking chemistry36, followed by addition of a UCL (Figure 1A). The 20-base sequence AM1 (5’-TACGATTCAGCCGATACAGC), was synthesized using photolytic blocking chemistry as is typical for microarrays and described elsewhere23. For the penultimate synthesis step we used a photoreactive amidite and selectively exposed the array to ultraviolet light through a resolution test pattern mask. In this way, only the photo-amidites which are exposed through the mask get deblocked and can react with the final phosphoramidite, Acrydite. The Acrydite adds a terminal 5’ methacryl group to the ends of the


10

Page 11 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


oligos on the array so that they can covalently react with acrylamide monomers during polymerization of the hydrogel (Figure S2). A

second

silicon

wafer

was

modified

by

addition

of

3-

Methacryloxypropyltrimethoxysilane to produce acrylamide groups on the surface of the acceptor substrate (Figure 1B, S2). In a separate reaction, an acrylamide monomer solution was prepared in water and applied to the surface of the donor wafer, while the acceptor wafer was immediately inverted and placed on top forming the sandwich (Figure 1C). Capillary forces spread the monomer solution evenly prior to polymerization to cover either an individual die or 6-inch wafers depending on the scale of synthesis desired. Polymerization occurs over 60 minutes, covalently incorporating the acrylamide groups on the acceptor and the Acrydite moieties on the 5’ ends of the oligos into the polyacrylamide hydrogel. Cleavage of the silane on the donor wafer is achieved by submerging the sandwich in concentrated ammonia. For a 1cm2 assembly, 10-18 hours is necessary for cleavage of the donor silane and separation of the sandwich. For six-inch wafers, the donor substrate must be subject to a laser perforation process along the dicing streets prior to the ammonia bath in order to facilitate mass transfer of concentrated base to all regions of the wafer for cleavage (Figure 1D, E). After release, the gel coated acceptor wafers were subsequently submerged in a 1:1 ethylenediamine (EDA):Water mixture for an additional 3 hours to complete deprotection and ensure that the universal cleavable linker is fully reduced to the 3’ alcohol. The inverted array is then rinsed and ready for analysis (Figure 1F).


11


Page 12 of 28

Figure 1. Fabrication of an inverted microarray in a hydrogel. A) Oligos were synthesized 5’ up on a donor substrate with cleavable silane, 5 Thymine residues, a universal cleavable linker (UCL), the AM1 sequence, and a 5’ Acrydite. B) A second acrylamide coated acceptor substrate is prepared, and (C) the acrylamide solution (yellow) is poured onto the donor substrate while the acceptor is inverted and placed on top. D) Wafers up to 6 inches are perforated by laser to facilitate diffusion of ammonia to the cleavable moieties. E) After exposure to concentrated ammonia for 18 hours with agitation, the wafers separate. F) The transferred array is now 3’ up on the gel coated acceptor wafer.

Microarrays are transferred with high fidelity to a hydrogel. To verify successful transfer of the oligos into the gel, a fluorescently tagged compliment to the AM1 sequence was hybridized and imaged at 10X magnification (Figure 2A). The resolution


12

Page 13 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


test pattern mask used has a 5.5 mm field, with 500 m between fields, exhibits a stepped assortment of precise spatial frequency objects, and is modelled on the U.S. Air Force resolution test chart MIL-STD-150A. Feature fidelity and hybridization signal intensity were maintained across the 7.5 mm piece shown. Figure 2B shows an inset from 2A, illustrating that the achieved spatial resolution after transfer is high, with 4.5, 4, and 3.5 m line and space patterns shown. Finally, to ensure that the process is compatible with all standard microarray fabrication requirements, a full 6-inch wafer was prepared with the cleavable silane. Again, a foundational layer of 5 Thymine bases were synthesized followed by two UCLs, the 20 base AM1 sequence, and the Acrydite moiety via the photo-amidite and mask. Laser perforation along the dicing streets of the donor wafer (see methods) facilitates mass transfer of the ammonia to all areas of the wafer with cleavable silane. Figure 2C shows the gel after transfer and hybridization with fluorescent probe, with 3- and 8-micron features readily identified. This demonstrates that the whole fabrication process can be scaled up, and further refinements are on-going for commercial production. We conclude that photolithographically defined arrays of oligos can be transferred into a hydrogel coated acceptor wafer at relevant die geometries while maintaining high spatial pattern fidelity. Diffusion of ammonia through the perforated donor is clearly sufficient to enable chemical cleavage of the moieties synthesized below the photo-defined sequence, proving the chemistry utilized is compatible with commercial microarray fabrication techniques.


13


Page 14 of 28

Figure 2. Demonstration of patterned DNA in a polyacrylamide hydrogel. A fluorescently labeled probe was hybridized to the synthesized AM1 oligos in the gel (A). The Centrillion resolution test pattern from the mask is readily observed demonstrating successful transfer of AM1 oligos via a single patterning step. (B) Magnified inset from A demonstrates transfer fidelity and high resolution of the DNA pattern. Shown are line and space patterns from 4.5-3.5 m. (C) 3m and 8m square features from a 6-inch wafer demonstrate the scalability of the process.

Transferred oligos are 3’up and enzymatically functional. If the transferred oligos are 3’-up with reactive hydroxyl groups, they should be responsive to polymerase extension reactions. To test this, an 84 base template oligo containing the reverse complement of AM1 was hybridized to the array and extended with Klenow DNA polymerase (Figure 3A).

After extension, the template oligo was stripped away with NaOH, the array was

washed in saline sodium citrate (SSC) buffer, and finally hybridized with a probe complementary to the last 20 bases on the 3’ ends of the newly extended molecules. Figure 3B shows the hybridization results of the fluorescent probe hybridized to the newly synthesized region of the array. The resolution test pattern is readily observed demonstrating efficient addition of 64 bases to the 3’ ends of the oligos on the array. The ability to copy long template DNA sequences onto the 3’ ends of densely patterned arrays is another interesting facet of our platform. It allows significant molecular complexity to be easily added en masse to all features on an array simultaneously. As an example, the template oligo used in Figure 3 was designed to encode: 1) the canonical LoxP sequence for Cre-mediated


14

Page 15 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


recombination between the array and any floxed DNA target37,38, 2) the EcorI restriction sequence, 3) the AluI restriction sequence, and finally, 4) the 19 base Mosaic End sequence recognized by Tn5 transposase39. Photolithographically synthesizing an array with this many sequence motifs using standard phosphoramidite chemistry would result in a very high number of truncated molecules. In contrast, by using only selectively purified oligos from the transfer and then extending them by polymerase, we generate a microarray with very few errors in the oligos. To demonstrate that the inverted and extended array can function as a substrate for enzymes other than a polymerase, we exposed the array from Figure 3B to the restriction enzyme EcorI for 1 hour at 37 oC. When imaged, the template pattern was virtually undetectable suggesting that the enzyme had made an internal cut at the recognition sequence, liberating the 3’ Alu1 and Mosaic End sequence with hybridized fluorescent probe (Figure 3C). To ensure that cleavage was selective and not the result of nonspecific degradation of the array in the gel, a second Cy3 labelled probe was hybridized to the original AM1 sequence (Figure 3D). As the resolution test pattern was again readily observed, we conclude that digestion with EcorI is specific to the internal restriction sequence, leaving the Acrydite registered sequences 5’ of the restriction site intact. The stability of the gel40 and quality of the array pattern seem unaffected by these manipulations, and further analysis shows the arrays are robust and reproducible (Figure S3). Additional experiments putting the arrays through extension reactions at elevated temperature with more difficult substrates like fluorescent nucleotides have also been successful (Figure S4).


15


Page 16 of 28

Figure 3. Transferred oligos are 3’ up and enzymatically functional. A) The inverted array was hybridized with a template oligo and extended by Klenow DNA polymerase and imaged. B) After extension, the template oligo was stripped away with 0.2M NaOH, and a Cy3 probe targeting the newly synthesized Mosaic End sequence was added. C) Exposure of the array to the restriction enzyme Ecor1 demonstrates nearly complete digestion of the extended oligos on the array. D) Finally, probing with the complement to AM1 demonstrates that the patterned DNA from the original array is intact. Recently, our group and others41,42 have proposed using arrays to elucidate the positional information of biomolecules by attaching unique oligos patterned on arrays to samples of interest in situ; then analysing the results using commercial sequencing readouts. As the spatial resolution of the biomolecules is naturally limited to the number of unique oligos that can be patterned into a given area, sub-micron resolution of patterned features will be of paramount importance for future

applications.

However,

DMT

chemistry

is

not

directly

compatible

with

photolithographically based microarray synthesis, as each feature cannot be spatially de-blocked or photolytically defined without a special photoresist43.


16

Page 17 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


As photoresists offer the ability to pattern DNA at very high resolutions using simple DMT chemistry, we decided to test the spatial resolution of our gel inversion process using a proprietary photoresist formulation. The Centrillion Photoresist uses photoacid generator chemistry in a polymer matrix to spatially deblock the protecting DMT groups2,3. A quartz substrate with cleavable silane was spin coated with the Centrillion Photoresist, and DMT chemistry was used to synthesize the AM1 sequence as before. This time, an in-line fluorescein amidite was added to the oligos just after the AM1 sequence to make the array fluorescent. The last Thymine base on the as-synthesized, 5’ end was left with the DMT blocking group on, and the photoresist was exposed through the mask. After addition of the Acrydite, gel transfer was performed as described earlier with separation of the donor and acceptor pieces in approximately 18 hours. Figure 4 shows the image of the resulting transferred array of fluorescent oligos into the gel. The 1.3 and 1.0 m line and space patterns are resolved, approaching the optical limits of the microscope used (Keyence, 40X, NA 0.6). We conclude that any lateral “blur” from the gel inversion process above the diffraction limit of 0.4 m is negligible, and that our method is compatible with photoresist chemistry.


17


Page 18 of 28

Figure 4. Photoresist high-resolution microarray in a gel. Fluorescent image of transferred oligos with photographic resolution defined by the photoresist process demonstrating 1.3 and 1 m line and space patterns. This is approaching the limit of the imaging tool used. The spatial limit of the inversion process is likely better than this. Discussion One major concern for this fabrication scheme was the ability to release the oligos after copolymerization with the gel. Release prior to complete gel formation would cause a loss of probes and/or positional commitment. Indeed, we tested physical removal of the donor wafer prior to full chemical release and found high feature fidelity at the edges, and poor fidelity and signal in the center suggesting physical breaks were occurring in the gel or perhaps part-way through the synthesized DNA. Conversely, full release of the cleavable moieties provided good signal and feature fidelity across the wafer. However, chemical release of the polymerized sandwich brings about the substantial mass transfer problem of how to get chemical reagents to the desired interface for release.


18

Page 19 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Critical to our success defeating the mass transport problem was the introduction of laser perforation along the dicing streets prior to submersion of the sandwich in ammonia. The presence of the hydrogel should ensure that Fickian diffusion is the only mechanism of getting the concentrated base for cleavage from the edge to the center of the die44. At a D=1.64x10-5 cm2/s in water, the characteristic time for ammonia to reach the center of a 1 cm die is approximately 13 minutes. But this only ensures dilute ammonia solution at that point, and deprotections in ammonia are typically hours long under concentrated conditions. As such, our efforts developing cleavable moieties capable of total reduction in minutes with dilute ammonia are ongoing. Exploiting varying temperature gradients may also be a practical option for controlling the rate and completion of cleavage. Conditions were chosen to theoretically react all monomers during the polymerization process45,46, but we suspect transfer efficiency of oligos into the gel is relatively low despite similar fluorescent hybridization intensities comparing 3-up arrays (acceptor) to 5’-up arrays (donor). This semi-quantitative comparison between the two is not valid because of the glut of truncated, capped sequences on the donor wafer that cannot be transferred to the gel as they do not receive the Acrydite moiety. Transfer also lowers the overall charge field of the oligos in the gel, and as hybridization yields are roughly inversely proportional to surface oligo concentration in this range47, it is entirely possible one would detect similar signals due to increased hybridization efficiency in the gel. Consequently, efforts to more thoroughly quantify transfer by HPLC are ongoing, and we have already had some success using in-gel PCR to amplify and tune the array density. The power of these arrays lies in their ease of manipulation and versatile arrangements. As polymerase reactions function in the hydrogel system, these arrays can be constructed in single or


19


Page 20 of 28

double stranded configurations. The long template oligo we used for extension in Figure 3 contained both EcorI and AluI sites (both enzymes have been shown to cut single as well as double stranded DNA48) and was included as an example to give the investigator the option of generating sticky or blunt array ends if desired. As another example, the template oligo also included a Mosaic Ends sequence that is recognized by the Tn5 transposase. This enzyme has already been used to construct genomic DNA sequencing libraries on a hydrogel surface with Mosaic End oligos randomly dispersed in the gel49. Because the complexity of the oligos on the array can be added to by polymerase, it should make the arrays adaptable to a variety of assays. It is of interest to compare microarrays fabricated by our technique with some of the other state of the art approaches in use. Mechanical spotting (3’ up) of DNA arrays is one method in wide spread use that traditionally has several advantages over photolithographically synthesized arrays. For example, pre-purified oligos that are significantly longer can be attached to a wide variety of surfaces with simple amino or biotin modifications, overcoming the length and directionality limitations of arrays synthesized in-situ (our approach also solves this). However, spot inhomogeneity and spot density are significant limitations of this method compared to photolithographic techniques50. Furthermore, spotting is an intrinsically serial method, so it has reliability issues and does not offer advantages in massively parallel, high-throughput synthesis and manufacturing. Alternatively, bead arrays have recently gained in popularity, with the Illumina Bead Array being the most commonly used today51. However, bead arrays also suffer from density issues (center-on-center each Illumina bead is 5.7 m apart); and because of the manufacturing process, each bead array is unique51 requiring each chip to be de-coded individually to interpret the data30. In contrast, photolithographic masks produce far more uniform arrays in a pre-designed arrangement of oligos.


20

Page 21 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In summary, we have demonstrated a new type of photolithographic DNA microarray that is patterned into a hydrogel with the oligos in the 3’ up configuration. The array is virtually error free and the oligos can be added to by polymerase, effectively permitting a wide range of enzymatic substrate sequences to be programmed into the system for future applications development. The fabrication strategy is compatible with existing machines and tools for synthesizing microarrays, relatively cheap to produce, and scalable to six-inch wafer processing. Positional fidelity of the array within the gel is high, and the synthesis can be integrated with photoresist acid generator chemistry to produce features in the sub-micron range. We conclude that this fabrication process is a powerful tool for extending the applicability of DNA microarrays, potentially enabling applications such as genomic sequencing library construction via chip-based barcodes, and indexed DNA based data storage.


21


Page 22 of 28

The authors declare that the main data supporting the findings of this study are available within the article and its files. Extra data may be available from the corresponding author upon request. Corresponding Author Justin A. Costa. Tel: 1 (650) 618-0111; Fax: (650) 618-0121; email: [email protected] Centrillion Technologies, 2500 Faber Place, Palo Alto, CA 94303, USA

Author Contributions JAC co-conceived the process, co-wrote the manuscript, provided the technical basis and motivation for 3’ up arrays and the project in general, executed some of the gel transfer experiments and performed all initial proof of concept experiments indicating 3’up was done. PMD co-conceived the process and solely the process to scale to 6-inch wafers, executed most of the gel and transfer experiments, and co-wrote the manuscript. GHM conceived and synthesized the cleavable silane and brought decades of technical experience in microarray synthesis. FC had done substantial inversion work prior to these efforts, and had demonstrated the inefficiencies of other methods, performed additional sequencing validation of the current method, and helped write the manuscript. WZ provided substantial prior work perspective and applied multiple new applications that additionally challenged this new method in both efficacy and validity.

Funding Sources This research work was in-part supported through the National Human Genome Research Institute of the National Institutes of Health under Award Number R43HG008582.


22

Page 23 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Competing Interests The authors declare competing financial interests in the form of stock ownership, patents, or employment through Centrillion Technologies.

Acknowledgements The authors would like to acknowledge Isabelle Senteno and Darren J. Crandall for additional work patterning AM1 through the resolution test pattern mask and quantifying oligo concentration after transfer, and Jessica C. Huynh and Kendall Hoff for helping with many experiments that did not make it into the manuscript. We also thank Janet Warrington, Maurizio Righini, and Sampson Mao for meticulous proofreading. Abbreviations DMT, Dimethoxytrytl; UCL, universal cleavable linker; SSC, saline sodium citrate.


23


Page 24 of 28

References (1)

Fodor, S.; Read, J.; Pirrung, M.; Stryer, L.; Lu, A.; Solas, D. Light-Directed, Spatially Addressable Parallel Chemical Synthesis. Science 1991, 251 (4995), 767–773. https://doi.org/10.1126/science.1990438. (2) McGall, G. H.; Christians, F. C. High-Density Genechip Oligonucleotide Probe Arrays. Adv. Biochem. Eng. Biotechnol. 2002, 77, 21–42. (3) Barone, A. D.; Beecher, J. E.; Bury, P. A.; Chen, C.; Doede, T.; Fidanza, J. A.; McGall, G. H. PHOTOLITHOGRAPHIC SYNTHESIS OF HIGH-DENSITY OLIGONUCLEOTIDE PROBE ARRAYS. Nucleosides Nucleotides Nucleic Acids 2001, 20 (4–7), 525–531. https://doi.org/10.1081/NCN-100002328. (4) Pease, A. C.; Solas, D.; Sullivan, E. J.; Cronin, M. T.; Holmes, C. P.; Fodor, S. P. LightGenerated Oligonucleotide Arrays for Rapid DNA Sequence Analysis. Proc. Natl. Acad. Sci. 1994, 91 (11), 5022–5026. https://doi.org/10.1073/pnas.91.11.5022. (5) Matsuzaki, H.; Dong, S.; Loi, H.; Di, X.; Liu, G.; Hubbell, E.; Law, J.; Berntsen, T.; Chadha, M.; Hui, H.; Yang, G.; Kennedy, G.C.; Webster, T.A.; Cawley, S.; Walsh, P.S.; Jones, K.W.; Fodor, S.P.A.; Mei, R. Genotyping over 100,000 SNPs on a Pair of Oligonucleotide Arrays. Nat. Methods 2004, 1 (2), 109–111. https://doi.org/10.1038/nmeth718. (6) Gunderson, K. L.; Steemers, F. J.; Lee, G.; Mendoza, L. G.; Chee, M. S. A Genome-Wide Scalable SNP Genotyping Assay Using Microarray Technology. Nat. Genet. 2005, 37 (5), 549–554. https://doi.org/10.1038/ng1547. (7) Aravind Kumar, M.; Singh, V.; Naushad, S. M.; Shanker, U.; Lakshmi Narasu, M. Microarray-Based SNP Genotyping to Identify Genetic Risk Factors of Triple-Negative Breast Cancer (TNBC) in South Indian Population. Mol. Cell. Biochem. 2018, 442 (1–2), 1–10. https://doi.org/10.1007/s11010-017-3187-6. (8) Dagnall, C. L.; Morton, L. M.; Hicks, B. D.; Li, S.; Zhou, W.; Karlins, E.; Teshome, K.; Chowdhury, S.; Lashley, K. S.; Sampson, J. N.; Robinson, L. L.; Armstrong, G.T.; Bhatia, S.; Radloff, G.A.; Davies, S. M.; Tucker, M.A.; Yeager, M.; Chanock, S. J. Successful Use of Whole Genome Amplified DNA from Multiple Source Types for High-Density Illumina SNP Microarrays. BMC Genomics 2018, 19 (1). https://doi.org/10.1186/s12864-018-45726. (9) Manning, M.; Hudgins, L. Array-Based Technology and Recommendations for Utilization in Medical Genetics Practice for Detection of Chromosomal Abnormalities. Genet. Med. 2010, 12 (11), 742–745. https://doi.org/10.1097/GIM.0b013e3181f8baad. (10) Xue, H.; Huang, H.; Wang, Y.; An, G.; Zhang, M.; Xu, L.; Lin, Y. Molecular Cytogenetic Identification of Small Supernumerary Marker Chromosomes Using Chromosome Microarray Analysis. Mol. Cytogenet. 2019, 12 (1). https://doi.org/10.1186/s13039-0190425-5. (11) Collas, P. The Current State of Chromatin Immunoprecipitation. Mol. Biotechnol. 2010, 45 (1), 87–100. https://doi.org/10.1007/s12033-009-9239-8. (12) Hoshino, I.; Takahashi, M.; Akutsu, Y.; Murakami, K.; Matsumoto, Y.; Suito, H.; Sekino, N.; Komatsu, A.; Iida, K.; Suzuki, T.; Inoue, I.; Fumitaka, I.; Iwatate, Y.; Matsubara, H. Genome‑wide ChIP‑seq Data with a Transcriptome Analysis Reveals the Groups of Genes Regulated by Histone Demethylase LSD1 Inhibition in Esophageal Squamous Cell Carcinoma Cells. Oncol. Lett. 2019. https://doi.org/10.3892/ol.2019.10350.


24

Page 25 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(13) Duggan, D. J.; Bittner, M.; Chen, Y.; Meltzer, P.; Trent, J. M. Expression Profiling Using CDNA Microarrays. Nat. Genet. 1999, 21, 10–14. https://doi.org/10.1038/4434. (14) Su, A. I.; Cooke, M. P.; Ching, K. A.; Hakak, Y.; Walker, J. R.; Wiltshire, T.; Orth, A. P.; Vega, R. G.; Sapinoso, L. M.; Moqrich, A.; Patapoutian, A.; Hampton, G.M.; Schultz, P.G.; Hogenesch, J.B. Large-Scale Analysis of the Human and Mouse Transcriptomes. Proc. Natl. Acad. Sci. 2002, 99 (7), 4465–4470. https://doi.org/10.1073/pnas.012025199. (15) Vickovic, S.; Ståhl, P. L.; Salmén, F.; Giatrellis, S.; Westholm, J. O.; Mollbrink, A.; Navarro, J. F.; Custodio, J.; Bienko, M.; Sutton, L.-A.; Rosenquist, R.; Frisen, J.; Lundeberg, J. Massive and Parallel Expression Profiling Using Microarrayed Single-Cell Sequencing. Nat. Commun. 2016, 7, 13182. (16) Berg, K. C. G.; Sveen, A.; Høland, M.; Alagaratnam, S.; Berg, M.; Danielsen, S. A.; Nesbakken, A.; Søreide, K.; Lothe, R. A. Gene Expression Profiles of CMS2Epithelial/Canonical Colorectal Cancers Are Largely Driven by DNA Copy Number Gains. Oncogene 2019. https://doi.org/10.1038/s41388-019-0868-5. (17) Coleman, J. R. I.; Euesden, J.; Patel, H.; Folarin, A. A.; Newhouse, S.; Breen, G. Quality Control, Imputation and Analysis of Genome-Wide Genotyping Data from the Illumina HumanCoreExome Microarray. Brief. Funct. Genomics 2016, 15 (4), 298–304. https://doi.org/10.1093/bfgp/elv037. (18) Lo, S. G.; Wong, S. F.; Mak, J. W.; Choo, K. K.; Ng, K. P. Gene Expression Changes in Human Bronchial Epithelial Cells (BEAS-2B) and Human Pulmonary Alveolar Epithelial Cells (HPAEpiC) after Interaction with Cladosporium Sphaerospermum. Med. Mycol. 2019. https://doi.org/10.1093/mmy/myz061. (19) Shchepinov, M. S.; Case-Green, S. C.; Southern, E. M. Steric Factors Influencing Hybridisation of Nucleic Acids to Oligonucleotide Arrays. Nucleic Acids Res. 1997, 25 (6), 1155–1161. (20) Ravan, H.; Kashanian, S.; Sanadgol, N.; Badoei-Dalfard, A.; Karami, Z. Strategies for Optimizing DNA Hybridization on Surfaces. Anal. Biochem. 2014, 444, 41–46. https://doi.org/10.1016/j.ab.2013.09.032. (21) Webster, D. R.; Hekele, A. G.; Lauring, A. S.; Fischer, K. F.; Li, H.; Andino, R.; DeRisi, J. L. An Enhanced Single Base Extension Technique for the Analysis of Complex Viral Populations. PLoS ONE 2009, 4 (10), e7453. https://doi.org/10.1371/journal.pone.0007453. (22) Hughes, T. R.; Mao, M.; Jones, A. R.; Burchard, J.; Marton, M. J.; Shannon, K. W.; Lefkowitz, S. M.; Ziman, M.; Schelter, J. M.; Meyer, M. R.; Kobayashi, S.; Davis, C.; Dai, H.; He, Y. D.; Staphaniants, S. B.; Cavet, G.; Walker, W. L.; West, A.; Coffey, E.; Shoemaker, D. D., Stoughton, R.; Blanchard, A. P.; Friend, S. H.; Linsley, P. S. Expression Profiling Using Microarrays Fabricated by an Ink-Jet Oligonucleotide Synthesizer. Nat. Biotechnol. 2001, 19 (4), 342–347. https://doi.org/10.1038/86730. (23) McGall, G. H.; Barone, A. D.; Diggelmann, M.; Fodor, S. P. A.; Gentalen, E.; Ngo, N. The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 1997, 119 (22), 5081–5090. https://doi.org/10.1021/ja964427a. (24) LeProust, E. M.; Peck, B. J.; Spirin, K.; McCuen, H. B.; Moore, B.; Namsaraev, E.; Caruthers, M. H. Synthesis of High-Quality Libraries of Long (150mer) Oligonucleotides by a Novel Depurination Controlled Process. Nucleic Acids Res. 2010, 38 (8), 2522–2540. https://doi.org/10.1093/nar/gkq163.


25


Page 26 of 28

(25) Hölz, K.; Hoi, J. K.; Schaudy, E.; Somoza, V.; Lietard, J.; Somoza, M. M. High-Efficiency Reverse (5′→3′) Synthesis of Complex DNA Microarrays. Sci. Rep. 2018, 8 (1). https://doi.org/10.1038/s41598-018-33311-3. (26) Pastinen, T.; Kurg, A.; Metspalu, A.; Peltonen, L.; Syvänen, A. C. Minisequencing: A Specific Tool for DNA Analysis and Diagnostics on Oligonucleotide Arrays. Genome Res. 1997, 7 (6), 606–614. (27) Pastinen, T.; Raitio, M.; Lindroos, K.; Tainola, P.; Peltonen, L.; Syvänen, A. C. A System for Specific, High-Throughput Genotyping by Allele-Specific Primer Extension on Microarrays. Genome Res. 2000, 10 (7), 1031–1042. (28) Tonisson, N.; Zernant, J.; Kurg, A.; Pavel, H.; Slavin, G.; Roomere, H.; Meiel, A.; Hainaut, P.; Metspalu, A. Evaluating the Arrayed Primer Extension Resequencing Assay of TP53 Tumor Suppressor Gene. Proc. Natl. Acad. Sci. 2002, 99 (8), 5503–5508. https://doi.org/10.1073/pnas.082100599. (29) Steemers, F. J.; Chang, W.; Lee, G.; Barker, D. L.; Shen, R.; Gunderson, K. L. WholeGenome Genotyping with the Single-Base Extension Assay. Nat. Methods 2006, 3 (1), 31– 33. https://doi.org/10.1038/nmeth842. (30) Fan, J.; Gunderson, K. L.; Bibikova, M.; Yeakley, J. M.; Chen, J.; Wickham Garcia, E.; Lebruska, L. L.; Laurent, M.; Shen, R.; Barker, D. [3] Illumina Universal Bead Arrays. In Methods in Enzymology; Elsevier, 2006; Vol. 410, pp 57–73. https://doi.org/10.1016/S0076-6879(06)10003-8. (31) Aksyonov, S. A.; Bittner, M.; Bloom, L. B.; Reha-Krantz, L. J.; Gould, I. R.; Hayes, M. A.; Kiernan, U. A.; Niederkofler, E. E.; Pizziconi, V.; Rivera, R. S.; Williams, D .J. B.; Williams, P. Multiplexed DNA Sequencing-by-Synthesis. Anal. Biochem. 2006, 348 (1), 127–138. https://doi.org/10.1016/j.ab.2005.10.001. (32) Albert, T. J.; Norton, J.; Ott, M.; Richmond, T.; Nuwaysir, K.; Nuwaysir, E. F.; Stengele, K.-P.; Green, R. D. Light-Directed 5’-->3’ Synthesis of Complex Oligonucleotide Microarrays. Nucleic Acids Res. 2003, 31 (7), e35. (33) Pirrung, M. C.; Bradley, J.-C. Comparison of Methods for Photochemical PhosphoramiditeBased DNA Synthesis. J. Org. Chem. 1995, 60 (20), 6270–6276. https://doi.org/10.1021/jo00125a010. (34) Kwiatkowski, M. Inversion of in Situ Synthesized Oligonucleotides: Improved Reagents for Hybridization and Primer Extension in DNA Microarrays. Nucleic Acids Res. 1999, 27 (24), 4710–4714. https://doi.org/10.1093/nar/27.24.4710. (35) McGall, G. H.; Christians, F. C. High-Density GeneChip Oligonucleotide Probe Arrays. Series Eds.; Springer Berlin Heidelberg: Berlin, Heidelberg, 2002; Vol. 77, pp 21–42. https://doi.org/10.1007/3-540-45713-5_2. (36) Beaucage, S. L.; Caruthers, M. H. Deoxynucleoside Phosphoramidites—A New Class of Key Intermediates for Deoxypolynucleotide Synthesis. Tetrahedron Lett. 1981, 22 (20), 1859–1862. https://doi.org/10.1016/S0040-4039(01)90461-7. (37) Sauer, B. Functional Expression of the Cre-Lox Site-Specific Recombination System in the Yeast Saccharomyces Cerevisiae. Mol. Cell. Biol. 1987, 7 (6), 2087–2096. https://doi.org/10.1128/MCB.7.6.2087. (38) Sauer, B.; Henderson, N. Site-Specific DNA Recombination in Mammalian Cells by the Cre Recombinase of Bacteriophage P1. Proc. Natl. Acad. Sci. 1988, 85 (14), 5166–5170. https://doi.org/10.1073/pnas.85.14.5166.


26

Page 27 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(39) Reznikoff, W. S. Tn5 as a Model for Understanding DNA Transposition. Mol. Microbiol. 2003, 47 (5), 1199–1206. (40) Caulfield, M. J.; Qiao, G. G.; Solomon, D. H. Some Aspects of the Properties and Degradation of Polyacrylamides. Chem. Rev. 2002, 102 (9), 3067–3084. https://doi.org/10.1021/cr010439p. (41) Stahl, P. L.; Salmen, F.; Vickovic, S.; Lundmark, A.; Navarro, J. F.; Magnusson, J.; Giacomello, S.; Asp, M.; Westholm, J. O.; Huss, M.; Mollbrink, A.; Linnarsson, S.; Codeluppi, S.; Borg, A.; Ponten, F.; Costea, P. I.; Sahlen, P.; Mulder, J.; Bergmann, O.; Lundeberg, J.; Frisen, J. Visualization and Analysis of Gene Expression in Tissue Sections by Spatial Transcriptomics. Science 2016, 353 (6294), 78–82. https://doi.org/10.1126/science.aaf2403. (42) Eng, C.-H. L.; Lawson, M.; Zhu, Q.; Dries, R.; Koulena, N.; Takei, Y.; Yun, J.; Cronin, C.; Karp, C.; Yuan, G.-C.; Cai, L. Transcriptome-Scale Super-Resolved Imaging in Tissues by RNA SeqFISH+. Nature 2019, 568 (7751), 235–239. https://doi.org/10.1038/s41586-0191049-y. (43) McGall, G.; Labadie, J.; Brock, P.; Wallraff, G.; Nguyen, T.; Hinsberg, W. Light-Directed Synthesis of High-Density Oligonucleotide Arrays Using Semiconductor Photoresists. Proc. Natl. Acad. Sci. 1996, 93 (24), 13555–13560. https://doi.org/10.1073/pnas.93.24.13555. (44) Fick, A. Ueber Diffusion. Ann. Phys. Chem. 1855, 170 (1), 59–86. https://doi.org/10.1002/andp.18551700105. (45) Baselga, J.; Hernandez-Fuentes, I.; Pierola, I. F.; Llorente, M. A. Elastic Properties of Highly Crosslinked Polyacrylamide Gels. Macromolecules 1987, 20 (12), 3060–3065. https://doi.org/10.1021/ma00178a020. (46) Lin, H.-R. Solution Polymerization of Acrylamide Using Potassium Persulfate as an Initiator: Kinetic Studies, Temperature and PH Dependence. Eur. Polym. J. 2001, 37 (7), 1507–1510. https://doi.org/10.1016/S0014-3057(00)00261-5. (47) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. The Effect of Surface Probe Density on DNA Hybridization. Nucleic Acids Res. 2001, 29 (24), 5163–5168. (48) Nishigaki, K.; Kaneko, Y.; Wakuda, H.; Husimi, Y.; Tanaka, T. Type II Restriction Endonucleases Cleave Single-Stranded DNAs in General. Nucleic Acids Res. 1985, 13 (16), 5747–5760. (49) Feng, K.; Costa, J.; Edwards, J. S. Next-Generation Sequencing Library Construction on a Surface. BMC Genomics 2018, 19 (1). https://doi.org/10.1186/s12864-018-4797-4. (50) Bumgarner, R. Overview of DNA Microarrays: Types, Applications, and Their Future. In Current Protocols in Molecular Biology; Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., Eds.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2013. https://doi.org/10.1002/0471142727.mb2201s101. (51) Gunderson, K. L. Decoding Randomly Ordered DNA Arrays. Genome Res. 2004, 14 (5), 870–877. https://doi.org/10.1101/gr.2255804.


27


TOC


Page 28 of 28

Fabrication of Inverted High-Density DNA Microarrays in a

Recommend Documents