Fluorescence Detection of Telomerase Activity in Cancer Cells Based

Mar 15, 2010 - Caifeng Ding, Xiangling Li, Ying Ge, and Shusheng Zhang*. Key Laboratory of Eco-chemical Engineering, Ministry of Education, College of...
0 downloads 0 Views 1MB Size
Download PDF
Anal. Chem. 2010, 82, 2850–2855

Fluorescence Detection of Telomerase Activity in Cancer Cells Based on Isothermal Circular Strand-Displacement Polymerization Reaction Caifeng Ding, Xiangling Li, Ying Ge, and Shusheng Zhang* Key Laboratory of Eco-chemical Engineering, Ministry of Education, College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Qingdao 266042, China On the basis of the extension reaction of a telomerase substrate (TS) primer in the presence of the telomerase, the inherent signal-transduction mechanism of the hairpin fluorescence probe, and the strand-displacement property of polymerase, an amplified fluorescence detection of telomerase activity in the cancer cells was described in this manuscript. A hairpin fluorescence probe was used as not only the fluorescence signal carrier but also a template of the telomere elongation reaction. In the presence of the telomerase, the stems of the hairpin probes were opened and the telomerase activity could be determined with the fluorescence enhancement. The telomerase activity in the HeLa extracts equivalent to 40-1000 cells was detected by this method, with the multiple rounds of isothermal strand replication, which led to strand displacement, and constituted consecutive signal amplification for the novel detection paradigm that allowed measurment of telomerase activity in crude cell extracts equivalent to 4 cultured HeLa cells. Using magnetic beads as both the separation tool and the immobilization matrix of the aptamer of Ramos cells (CRL1596, B-cell, human Burkitt’s lymphoma), the detection of the amount of the Ramos cell with the low concentration of 100 cells mL-1 confirmed the reliability and practicality of the protocol, which reveal a good prospect of this platform for analysis. The accurate and sensitive recognition and detection of trace tumor biomarkers and cancer cells is the essential need for the understanding of the processes and mechanisms of the diseases and could be vital for disease diagnosis, prevention, and treatment. Telomeres are nucleic acids of constant repeat sequences that cap the ends of the chromosomes. During cell proliferation, telomeres are progressively shortening, and eventually a critically short telomere length is reached; the cell stops dividing and gets into senescence. However, in most malignant or cancer cells, the ribonucleoprotein telomerase, which will catalyze the addition of the telomeric repeats (TTAGGG)n onto the 3′-end of the human chromosomes by the use of reverse transcription and its intrinsic RNA as a template, is accumulated, and this results in the continuous elongation of the telomeres and the generation of * Corresponding author. Tel: +86-532-84022750. Fax: +86-532-84022750. E-mail: [email protected].

2850

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

immortal cells.1-7 Having been observed in over 85% of all known human tumors, but repressed in most normal somatic issues, telomerase has been regarded as a biomarker for early stage cancer diagnosis as well as a therapeutic target.8-13 Thus, the need for a telomerase assay with greater sensitivity, selectivity, simplicity, cost effectiveness, and throughput in a wide range of applications has provided the driving force for continuous development of new strategies and technologies for analysis of telomerase activity. A variety of techniques have been developed to analyze telomerase activity.14-20 The initial assay of telomeric repeat amplification protocol (TRAP), with ultrahigh sensitivity, was established by Kim et al. Although quite powerful, TRAP requires the use of DNA polymerases and is, therefore, susceptible to PCRderived artifacts,10-12,21 especially when screening compounds for telomerase inhibition. Recently, alternative approaches have been (1) Morin, G. B. Cell 1989, 59, 521–529. (2) Cohen, S. B.; Graham, M. E.; Lovrecz, G. O.; Bache, N.; Robinson, P. J.; Reddel, R. R. Science 2007, 315, 1850–1853. (3) Stone, M. D.; Mihalusova, M.; O’Connor, C. M.; Prathapam, R.; Collins, K.; Zhuang, X. Nature 2007, 446, 458–461. (4) Harley, C. B.; Villeponteau, B. Curr. Opin. Genet. 1995, 5, 249–255. (5) Harley, C. B.; Futcher, A. B.; Greider, C. W. Nature 1990, 345, 458–460. (6) Hastie, N. D.; Dempster, M.; Dunlop, M. G.; Thompson, A. M.; Green, D. K.; Allshire, R. C. Nature 1990, 346, 866–867. (7) Niazov, T.; Pavlov, V.; Xiao, Y.; Gill, R.; Willner, I. Nano Lett. 2004, 4, 1683–1687. (8) Shay, J. W.; Bacchetti, S. Eur. J. Cancer 1997, 33, 787–791. (9) Hiyama, E.; Hiyama, K. Oncogene 2002, 21, 643–649. (10) Kim, N. W.; Piatyszek, M. A.; Prowse, K. R.; Harley, C. B.; West, M. D.; Ho, P. L. C.; Coviello, G. M.; Wright, W. E.; Weinrich, S. L.; Shay, J. W. Science 1994, 266, 2011–2015. (11) Savoysky, E.; Akamatsu, K.; Tsuchiya, M.; Yamazaki, T. Nucleic Acids Res. 1996, 24, 1175–1176. (12) Herbert, B. S.; Hochreiter, A. E.; Wright, W. E.; Shay, J. W. Nat Protoc. 2006, 1, 1583–1590. (13) Zheng, G. F.; Daniel, W. L.; Mirkin, C. A. J. Am. Chem. Soc. 2008, 130, 9644–9645. (14) Counter, C. M.; Avilion, A. A.; LeFeuvre, C. E.; Stewart, N. G.; Greider, C. W.; Harley, C. B.; Bacchetti, S. EMBO J. 1992, 11, 1921–1929. (15) Gelmini, S.; Caldini, A.; Becherini, L.; Capaccioli, S.; Pazzagli, M.; Orlando, C. Clin. Chem. 1998, 44, 2133–2138. (16) Hou, M.; Xu, D.; Bjo rkholm, M.; Gruber, A. Clin. Chem. 2001, 47, 519– 524. (17) Tatematsu, K.; Nakayama, J.; Danbara, M.; Shionoya, S.; Sato, H.; Omine, M.; Ishikawa, F. Oncogene 1996, 13, 2265–2274. (18) Nemos, C.; Remy-Martin, J. P.; Adami, P.; Arbez-Gindre, F.; Schaal, J. P.; Jouvenot, M.; Delage-Mourroux, R. Clin. Biochem. 2003, 36, 621–628. (19) Dalla Torre, C. A.; Maciel, R. M.; Pinheiro, N. A.; Andrade, J. A.; De Toledo, S. R.; Villa, L. L.; Cerutti, J. M. Braz. J. Med. Biol. Res. 2002, 35, 65–68. (20) Wen, J. M.; Sun, L. B.; Zhang, M.; Zheng, M. H. Mol. Pathol. 1998, 51, 110–112. 10.1021/ac902818w  2010 American Chemical Society Published on Web 03/15/2010

developed to measure telomerase activity using optical,22,23 surface plasmon resonance,24 electrochemical,25 and quartz crystal microbalance26 biosensors. Willner and co-workers27-29 reported for the first time an electrochemical telomerase assay by the use of the catalytic DNAzyme, which consists of hemin and singlestranded guanine-rich nucleic acids and possesses peroxidaselike activities. Using electrochemical detection of telomeric repeats from PCR-amplified products based on guanine oxidation signal without any external labels, telomerase activity could be detected in cell extracts containing as low as 100 ng/µL protein.30 A nonPCR-based electrochemical assay that can detect telomerase activity through the electrochemical oxidation signals of guaninerich telomeric repeats added to the primers has also been reported. However, the paper does not contain qualified results because the differential pulse voltammetry (DPV) wave increased along with the telomerase concentrations originated from a narrow range of cell numbers (1000 HeLa cells to 3000 HeLa cells); when samples with more than 3000 HeLa cells were employed, no telomerase concentration dependence of the DPV signal could be observed.25 Mirkin’s group reported a new method for human telomerase assay by partly using the barcode assay.13 The use of polyvalent oligonucleotide AuNPs in their new assay provided a novel means of signal amplification, with the limit of detection comparable to the PCR-based TRAP method. However, most strategies described above are based on the detection of telomerase activity with the telomerase substrate (TS) primer immobilized on a transducer surface or other solid supports. Hairpin fluorescence probes (called molecular beacons in some references) are single-stranded oligonucleotide probes that contain a loop-and-stem structure with a fluorophore and a quencher linked to the two ends of the stem.31 In the presence of a nucleic acid with special sequence, which was complementary to the loop of the hairpin fluorescence probe, the hairpin structure undergoes conformational change that force the fluorophore and quencher moieties to separate, leading to the fluorescence signal being restored. Because of the inherent signal transduction mechanism, hairpin fluorescence probes provide superior properties over single-stranded linear DNA probes as probes for surface biosensors and the fluorescence signals can be detected in solution. Hairpin fluorescence probes possess many attractive properties, such as high sensitivity and selectivity, and target detection can (21) Niemeyer, C. M.; Adler, M.; Wacker, R. Trends Biotechnol. 2005, 23, 208– 216. (22) Schmidt, P. M.; Lehmann, C.; Matthes, E.; Bier, F. F. Biosens. Bioelectron. 2002, 17, 1081–1087. (23) Schmidt, P. M.; Matthes, E.; Scheller, F. W.; Bienert, M.; Lehmann, C.; Ehrlich, A.; Bier, F. F. Biol. Chem. 2002, 383, 1659–1666. (24) Maesawa, C.; Inaba, T.; Sato, H.; Lijima, S.; Ishida, K.; Terashima, M.; Sato, R.; Suzuki, M.; Yashima, A.; Ogasawara, S.; Oikawa, H.; Sato, N.; Saito, K.; Masuda, T. Nucleic Acids Res. 2003, 31, E4. (25) Shao, Z. Y.; Liu, Y. X.; Xiao, H.; Li, G. X. Electrochem. Commun. 2008, 10, 1502–1504. (26) Pavlov, V.; Willner, I.; Dishon, A.; Kotler, M. Biosens. Bioelectron. 2004, 20, 1011–1021. (27) Xiao, Y.; Pavlov, V.; Gill, R.; Bourenko, T.; Willner, I. ChemBioChem 2004, 5, 374–379. (28) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152–2156. (29) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 126, 7430–7431. (30) Eskiocak, U.; Ozkan-Ariksoysal, D.; Ozsoz, M.; Oktem, H. A. Anal. Chem. 2007, 79, 8807–8811. (31) Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303–308.

be performed in real-time, as the unbound probes do not need to be separated out from the bound probes. Recently, Wang’s group reported a method for amplified detection of DNA based on the inherent signal-transduction mechanism of the hairpin fluorescence probe and strand-displacement property of polymerase.32 Inspired by this simple and easy to use strategy, we designed a novel and PCR-free telomerase activity assay without the radioactive materials and highly purified telomerase samples. The hairpin fluorescence probe was used as a template of TS primer extension reaction and fluorescence signal carrier. Upon recognition and hybridization with the telomerase reaction product, the stems of the hairpin probes opened; the telomerase activity in the HeLa extracts equivalent to 40-1000 cells was detected with the fluorescence enhancement in this method. After the opened probes annealed with primer 2 and triggered the polymerization reaction, the high performance of this assay was related to the determination of telomerase activity from cell extracts equivalent down to 4 HeLa cells. Moreover, by the use of magnetic beads as both the separation tool and the immobilization matrix of the aptamer of Ramos cells, the amount of Ramos cells (CRL-1596, B-cell, human Burkitt’s lymphoma) was also detected by this design strategy with the low concentration of 100 cells mL-1 (Section 4 in the Supporting Information). The results show that the present fluorescence strategy holds great promise in the biochemical assay for the early diagnosis of cancers. EXPERIMENTAL SECTION Materials. 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonic acid (CHAPS), phenylmethylsulfonyl fluoride (PMSF), ethylene glycol-bis (β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), ethylene diamine tetraacetic acid (EDTA), diethyl pyrocarbonate (DEPC), and Tween 20 were purchased from Biodee Biothenology. RNase A was acquired from Sigma. 1-Ethyl-3-(3dimethylaminopropyl) carbodiimide (EDC) was purchased from Sigma-Aldrich. Carboxyl-modified magnetic beads (0.1-0.5 µm) were purchased from BaseLine ChromTech Research Centre, China. All other reagents were of analytical reagent grade. All the water used in the work was RNase-free. The hairpin fluorescence probes were synthesized by TaKaRa Bio Inc. (Dalian China). The oligonucleotides used in this work were synthesized by SBS Genetech Inc. Sequences of the oligos are listed in Table 1. The polymerase Klenow Fragment was purchased from TaKaRa Bio Inc. (Dalian China). HeLa and Ramos cells were obtained from Chinese Academy of Medical Sciences. Fluorescence Measurement. All fluorescence measurements were carried out at a F4500 fluorometer with excitation at 535 nm and emission at 576 nm for the hairpin fluorescence probes labeled by 5-carboxytetramethylrhodamine (TMR) as a fluorophore. When the samples were excited at 535 nm, the emission was scanned from 556 to 700 nm in steps of 1 nm; the scanning speed was 1200 nm/min. Cell Culture. HeLa and Ramos cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 IU mL-1 of penicillin-streptomycin. The cells were maintained at 37 °C in a humidified atmosphere (95% air and (32) Guo, Q. P.; Yang, X. H.; Wang, K. W.; Tan, W. H.; Li, W.; Tang, H. X.; Li, H. M. Nucleic Acids Res. 2009, 37, 3e20.

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

2851

Table 1. DNA Sequences and the Hairpin Fluorescence Probe DNA hairpin fluorescence probe 1 hairpin fluorescence probe 2 TS primer primer 2 chemically synthesized telomerase product aptamer S2 DNA a

sequences (5′ to 3′) TMRa-TCTTGGACACACTAACCCTAACCCTAACCCTAACTCTGCTCGACGGATTTGTGTCCAAGADABCYL TMR-TCTTGGACACACGCACCTCTACAGAACACCGTGTGTCCA AGA-DABCYL AATCCGTCGAGCAGAGTT TCTTGGAC AATCCGTCGAGCAGAGTTAGGGTTAGGGTTAGGGTTAG TACAGAACACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCT CCTCCCGGTG-NH2 CGGTGTTCTGTAGAGGTGCG

TMR in the hairpin fluorescence probes was the abbreviation of 5-carboxytetramethylrhodamine, which is a fluorophore.

Scheme 1. Principle of the Detection Telomerase Method without the Strand Displacement Amplification

5% CO2). The cancer cell densities were determined using a hemocytometer, and this was performed prior to any experiments. Telomerase Extract Preparation from HeLa Cells Grown in Culture. The telomerase was extracted by the CHAPS method.33 Cells were collected in the exponential phase of growth. Cells were counted, and an aliquot containing 1.0 × 106 cells was pelleted (3500 rpm in a 1.5 mL EP tube for 5 min) in culture medium. The pellet was washed twice with ice-cold PBS, and then, the pellet was resuspended in 200 µL of ice cold lysis buffer (0.5% CHAPS, 10 mM Tris-HC1, pH 7.5, 1 mM MgC12, 1 mM EGTA, 5 mM β-mercaptoethanol, 0.1 mM PMSF, 10% glycerol) by retropipeting at least three times and kept on ice for 30 min. The mixture was centrifuged at 16 000 rpm for 20 min at 4 °C, and the supernatant was collected carefully. The resulting extract was used immediately or was flash frozen in liquid nitrogen at -80 °C. Telomerase Activity Detection in HeLa cells. First, hairpin fluorescence probe 1 and TS primer were incubated in 200 µL of extension solution (50 mM Tris-HC1, pH 7.5, 1 mM MgC12, 1 mM EGTA, 50 mM KCl, 0.05% Tween 20) at 37 °C for 1 h. Then, telomerase extracts diluted in lysis buffer with the respective number of cells were added to the preceding reaction solution. The mixture was incubated at 30 °C for 1 h. Finally, a mixture of dNTPs was added, and the final concentration was 0.2 mM. The mixture was incubated at 30 °C for 1 h, and the fluorescence signal was detected. For control experiments, telomerase extracts were pretreated with RNase (37 °C for 15 min) or heat treated (90 °C for 3 min). After the telomerization reaction, primer 2 was added to the preceding reaction system; the reaction mixture was incubated at 37 °C for 1 h. Then 4 U polymerase Klenow Fragment and 100 µM dNTPs were added to the mixture; the reaction mixture was incubated at 37 °C for 2 h, and then the fluorescence intensities were recorded immediately. The total volume of the reaction mixture was 600 µL, and the final concentrations of hairpin fluorescence probe, TS primer, and primer 2 were 300 nM, 500 pM, and 300 nM, respectively. The detection conditions of the commercial telomerase activity was the same as described above. (33) Piatyszek, M. A.; Kim, N. W.; Weinrich, S. L.; Hiyama, K.; Hiyama, E.; Wright, W. E.; Shay, J. W. Methods Cell Sci. 1995, 17, 1–15.

2852

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

(See Section 3 in the Supporting Information). RESULTS AND DISCUSSION Principle of the Assay for the Detection of Telomerase. The principle of the detection telomerase activity without the multiple circle strand displacement amplification was schematically shown in Scheme 1. The telomerase detection system consisted of a hairpin fluorescence probe and a TS primer (primer 1). In the presence of the telomerase, the telomerization reaction was allowed to proceed in the presence of the nucleotide mixture dNTPs. TTAGGG repeat units were continuously added to the 3′-end of the primer 1 by telomerase to form a longer single strand DNA (S1). At the same time, the hairpin fluorescence probe recognized and hybridized with S1 and underwent a conformational change, leading to stem separation and fluorescence signal restoring. The principle of the isothermal amplified detection telomerase was schematically shown in Scheme 2 including two steps. The telomerase detection system consisted of a hairpin fluorescence probe, a TS primer (primer 1), and another short primer (primer 2). Following step 1 described in last paragraph, primer 2 annealed with the open stem and triggered a polymerization reaction in the presence of dNTPs/polymerase. With the process of primer 2 extension, S1 was displaced by the polymerase with strand-displacement activity, after which a cDNA (cDNA) was synthesized, forming a probe-cDNA complex. Finally, to renew the cycle, the displaced S1 hybridized with another hairpin fluorescence probe, which triggered another polymerization reaction (Step 2). According to ref 25, the stem of the probe was 11mer sequences long, and the primer 2 was 8-mer sequences long, which was complementary to the stem region of the hairpin probe at the 3′-end. Thus, the stem-loop conformational probe was unable to anneal with the primer 2 to induce a polymerization reaction. Throughout these two steps, the telomerase played a key role as initiator of the telomerization reaction to perform S1, which was complementary to the loop of the probe, to act as a trigger of the recovery of the fluorescence signal in step 1 and the polymerization reaction in step 2. Since S1 could be displaced and trigger the polymerization reaction circularly, obvious fluorescence enhancement could be observed even in the presence of a trace

Scheme 2. Fluorescence Amplification Assay of Telomerase Activitya

a Schematic illustration the TS primer elongation process with the hairpin probe as the template (Step 1) and the multiple cycles of the isothermal strand-displacement polymerization reaction (Step 2).

Figure 1. (A) Fluorescence enhancement of the TS primer product in the presence of 0.25 pg mL-1 and 25 ag mL-1 commercial telomerase before (curves b and c, the green one and the purple one) and after (curves d and e, the blue one and the red one) the multiple strand displacement amplification. (B) Fluorescence intensities corresponding to the analysis of telomerase activity originating from 1000 HeLa cells before (curve d, the blue one) and after (curve e, the red one) the multiple strand displacement amplification, lysis buffer control (curve a, the black one), heat-inactivated control for 1000 HeLa cells (curve b, the green one), and RNase-inactivated control for 1000 HeLa cells (curve c, the purple one). The concentrations of hairpin fluorescence probe, primer 1, and primer 2 were 300 nM, 500 pM, and 300 nM, respectively.

amount of the telomerase. Therefore, by monitoring the increase of fluorescence intensities, the telomerase activity could be detected with high sensitivity. Detection Capability of the Strategy. The determination of the telomerase in the present method was based on the conformational change of the hairpin fluorescence probe upon hybridization with S1 elongated from the TS primer in the presence of telomerase. To prove the capability of the design, the enhancement of fluorescence intensities in the presence of the commercial telomerase and the telomerase extracted from 1000 HeLa cells were shown in Figure 1. After the period of step 1, an obvious enhancement of the fluorescence intensity in the presence of 0.25 pg mL-1 telomerase could be observed (curve c) though the fluorescence intensity induced by 25 ag mL-1 telomerase (curve b) was a little higher than the background level (curve a). The fluorescence intensities of curves d and e were significantly increased compared to curves b and c at the same concentrations of telomerase after the period of step 2. For practicable measuring of telomerase activity in telomerase extracts from telomerase-positive HeLa cells, the crude telomerase

extracts were prepared and used in a telomeric elongation process on TS primer to obtain S1. S1 in the samples was then hybridized with the loop of hairpin fluorescence probe 1. Subsequently, the solution containing primer 2 was added to the above mixture to anneal with the opened stem and trigger a polymerization reaction circularly in the presence of dNTPs/polymerase. Curves d and e in Figure 1B were the fluorescence intensities emitted upon analyzing the telomerase activity originated from 1000 HeLa cells before and after the step 2 (multiple circles strand-displacement process). The result showed that the fluorescence intensity after the strand displacement amplification process was significantly higher than the fluorescence signal before the process, and the latter was higher than the fluorescence signal obtained from lysis buffer control (curve a, 0 cells). To confirm the fluorescence signals observed in the above experiments were dependent on telomerase activity, control experiments were done by pretreating the HeLa cells extract with RNase or being heat-treated. It is well-known that RNase and heat will destroy the essential RNA template and reverse transcriptase protein of telomerase, and telomerase activity is sensitive to them. Curves b Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

2853

Figure 2. Effect of concentrations of primer 1 (A) and the polymerization reaction time (B) on the fluorescence intensities.

and c in Figure 1B showed that in both cases the fluorescence signals decreased to background level. It was clearly confirming the fluorescence signals were dependent on telomerase activity. To further prove the detection capability of the strategy, a chemical synthesized DNA strand containing the same sequence with the TS primer elongated product was used for the control experiment. Through recognition and hybridization with the chemical synthesis DNA sequence, the conformational of the hairpin fluorescence probes changed and the obvious fluorescence intensity, compared to the control buffer, was observed as shown in Figure S1 in the Supporting Information. In addition, with the proceeding of the multiple circles strand-displacement process, the fluorescence signal enhanced dramatically. According to the results, when the chemical synthetic DNA was used, fluorescence signal values were obtained higher than one obtained with real extract samples, which was accordance with the literature.34,35 This may be attributed to the enzyme activity, and purity could not reach the theoretical efficiency though the concentration of the primer 1 was the same as the concentration of the chemical synthetic DNA. All the results described above implied that the hairpin fluorescence probe underwent a conformational change upon hybridization with both the DNA resulting from the telomeric elongation process and the chemical synthesis DNA, restoring the fluorescence signals. Moreover, the polymerization reaction circularly could amplify the signal dramatically, so the present design has the capability to detect the telomerase activity in cancer cells with high sensitivity. Optimization of the Detection Conditions. To improve the sensitivity of fluorescence quantification of telomerase, the concentration of primer 1 was optimized. As shown in Figure 2A, the fluorescence intensities increased rapidly with the increase of the primer 1 concentration at first and reached an equilibration step at the concentration of 500 pM. Thus, this concentration was selected for the subsequent assays. In order to keep the circular strand-displacement polymerization reaction act smoothly, 300 nM of primer 2, which was the same as the concentration of hairpin fluorescence probe 1 was used in the experiment. This concentration of primer 2 was chosen to ensure that the circular strand-displacement polymerization reaction could be proceeding in the largest extent if all (34) Ozkan-Ariksoysal, D.; Tezcanli, B.; Kosova, B.; Ozsoz, M. Anal. Chem. 2008, 80, 588–596. (35) Tang, Z. W.; Wang, K. M.; Tan, W. H.; Ma, C. B.; Li, J.; Liu, L. F.; Guo, Q. P.; Meng, X. X. Nucleic Acids Res. 2005, 33, e97.

2854

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

the hairpin fluorescence probes 1 could be opened by the elongated products of primer 1 according to the ref 31. The polymerization reaction time, which determined the circle times, was another influence condition for the fluorescence assay. The influence of the polymerization reaction time was investigated, as shown in Figure 2B. The fluorescence intensities increased almost linearly with the increase of polymerization reaction time to 2 h, and a plateau effect was reached after this time. Therefor, the polymerization reaction time was controlled at 2 h all through the experiment. Detection of Telomerase Activity in HeLa Cells. As the telomerization was controlled by the content of telomerase in the cell lysate samples, the amount of opened hairpin fluorescence probes, and the intensity of fluorescence signal, all were related to the number of cancer cells. To validate the sensitivity of the newly developed telomerase assay, cell extracts extracted from 1.0 × 106 HeLa cells were serially diluted with lysis buffer and used as a source for telomerase. Under the optimization conditions, the fluorescence intensity emitted from the system analyzing variable numbers of HeLa cell was shown in Figure 3. The results showed that the fluorescence intensities increased with an increase in the number of the cells. The telomerase activity in the HeLa extracts equivalent to 40-1000 cells could be detected in the method without the strand displacement amplification. To further investigate the signal amplification ability of the multiple circles strand-displacement process in real samples, we compared the detection sensitivity of the method containing both steps to the method with step 1 only. Figure 4 showed the fluorescence intensities emitted from the system analyzing a variable number of HeLa cells with the multiple circles stranddisplacement process. The results showed that the fluorescence intensity increased with an increase in the number of the cells used for the cell extracts. The telomerase activity in the HeLa extracts equivalent to 4-1000 cells could be detected in the present method. A series of eleven repetitive measurements of 20 target cells were used for estimating the precision, and the relative standard deviation was 4.3%. It showed that the amplification fluorescence detection had good reproducibility. This method and some other techniques for telomerase assays were summarized in Table S1 in the Supporting Information. The sensitivity of this present work was found to be increased about 1-4 orders of magnitude than that of some methods and was comparable to that of Sato’s work using bioluminescence detection. Because the procedure of cell culture and telomerase

Figure 3. Detection of different telomerase activity equivalent to the amounts HeLa cell without the strand displacement amplification. (A) The fluorescence intensities induced by different concentrations of telomerase equivalent to different amounts of cells, the curves from a to j contain the telomerase activity equivalent to the amounts HeLa cell of 0, 40, 60, 80, 100, 200, 400, 600, 800, and 1000 cells. (B) The relationship between the fluorescence intensities and different concentrations of telomerase equivalent to different amounts of cells. The conditions are the same as in Figure 1.

Figure 4. Detection of different telomerase activity equivalent to the amounts of HeLa cell with the strand displacement amplification. (A) The fluorescence intensities induced by different concentration of telomerase equivalent to different amounts of cells, the curves from a to o contain the telomerase activity equivalent to the amounts HeLa cell of 0, 4, 6, 8, 10, 20, 40, 60, 80, 100, 200, 400, 600, 800, 1000 cells. (B) The relationship between the fluorescence intensities and different concentration of telomerase equivalent to different amounts of cells. The conditions are the same as in Figure 1.

preparation could be done before the detection experiment and the telomerase extracted from Hela cells can be stored at -20 °C for about 2 weeks with stability for further experiment, the total detection time of the two methods is about 3 and 6 h, respectively, which was competitive compared to the methods with a similar detection limit. Only need a fluorescence probe and some dNTPs, the direct detection of telomerase could be accomplished with step 1, so the low cost was another merit compared to other methods. The cost of the strategy with the multiple circles of the strand displacement amplification process was also tolerated due to its high sensitivity. The main disadvantages of the current method rely on two aspects. Though the sensitivity of the novel approach is comparable to the TRAP assay, but contrary to TRAP assay, which provides reproducible detection of telomerase in cell extract equivalents from several cells up to tens of thousands cells, the current method could test extract equivalents corresponding to 40-1000 cells; the narrow range of cell numbers optimal for the assay seems to be a great disadvantage. Also, the nonlinear response of the reaction may constitute a practical problem. CONCLUSION In summary, a PCR-free strategy to convert the telomerase activity into fluorescence signals employing a hairpin fluorescence probe and two primers based on TS primer elongation and polymerase-induced isothermal strand-displacement polymerization reaction was proposed

in this study. Due to the inherent superior properties of the hairpin fluorescence probe and the amplification of the multiple circles of the strand displacement, the assay could be easily used to detect telomerase activity and the amount of the cancer cells in solution with a high sensitivity. Telomerase activity in crude cell extracts equivalent to as few as 4 cultured HeLa cells and 100 cells mL-1 Ramos cell could be detected using this novel detection paradigm. In conclusion, with its simplicity, selectivity, and sensitivity, this strategy as a molecular tool holds great promise in the biochemical assay not only for the telomerase activity and the amount of the cancer cells but also for other biomarkers in early diagnosis for cancers. ACKNOWLEDGMENT This work was supported by the National Nature Science Foundation of China (No. 20975059), the National Nature Science Foundation of Shandong Province (No. ZR2009BZ005), and the National Basic Research Program of China (No. 2010CB732404). SUPPORTING INFORMATION AVAILABLE Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org. Received for review December 11, 2009. Accepted March 4, 2010. AC902818W Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

2855