Fluorescent Farnesyl Diphosphate Analogue: A Probe To Validate

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Fluorescent Farnesyl Diphosphate Analogue - a Probe to Validate Trans-Prenyltransferase Inhibitors Kuo-Hsun Teng, Erh-Ting Hsu, Ying-Hsuan Chang, Sheng-Wei Lin, and Po-Huang Liang Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00486 • Publication Date (Web): 18 Jul 2016 Downloaded from http://pubs.acs.org on July 21, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fluorescent Farnesyl Diphosphate Analogue - a Probe to Validate Trans-Prenyltransferase Inhibitors Kuo-Hsun Teng,†‡ Erh-Ting Hsu,‡ Ying-Hsuan Chang,‡ Sheng-Wei Lin,†‡ and PoHuang Liang†‡* †

Institute of Biological Chemistry, Academia Sinica, Taipei 11529, Taiwan

‡

Institute of Biochemical Sciences, National Taiwan University, Taipei 10617, Taiwan

KEYWORDS prenyltransferase; fluorescent FPP analogue, zoledronate; stopped-flow; burst kinetics

ACS Paragon Plus Environment

1

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 32

ABSTRACT

Some trans-prenyltransferases, such as long-chain C40 octaprenyl diphosphate synthase (OPPS), short-chain C15 farnesyl diphosphate synthase (FPPS), and C20 geranylgeranyl diphosphate synthase (GGPPS), are important drug targets. These enzymes catalyze chain elongation of FPP or geranyl diphosphate (GPP) through condensation reactions with isopentenyl diphosphate (IPP), forming designate numbers of trans-double bonds in the final products. In order to facilitate drug discovery, we report here a sensitive and reliable fluorescence-based assay for monitoring their activities in real time. MANT-O-GPP, a fluorescent analogue of FPP, was used as an alternative substrate and converted by the wild-type OPPS and the engineered FPPS and GGPPS into sufficiently long products with enhanced fluorescence intensities. This fluorescence probe was used to reveal the inhibitory mechanism of zoledronate, a bisphosphonate drug that targets human FPPS and possibly GGPPS.


2

Page 3 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

A group of prenyltransferases catalyze consecutive condensation reactions of isopentenyl diphosphate (IPP) with an allylic substrate, dimethylallyl diphosphate (DMAPP), geranyl diphosphate (GPP), or farnesyl diphosphate (FPP) to produce linear polymers with designated chain lengths (1-3). These enzymes are classified as cis- or trans-type according to the stereochemistry of the double bonds formed from the IPP condensation reactions (4). Transprenyltransferases synthesize products, such as C15 FPP from GPP and IPP by farnesyl diphosphate synthase (FPPS), C20 geranylgeranyl diphosphate (GGPP) from FPP and one IPP by geranylgeranyl diphosphate synthase (GGPPS), and C40 octaprenyl diphosphate (OPP) from FPP and five IPP by octaprenyl diphosphate synthase (OPPS). OPP constitutes the side-chain of ubiquinone and inhibitors of bacterial OPPS could be developed as new antibiotics (5). Both FPP and GGPP are substrates for prenylation of the signaling proteins such as Ras, Rab, nuclear lamins, trimeric G-protein γ subunits, protein kinases, and small Ras-related GTP-binding proteins. Because hyperactive farnesylation or geranylgeranylation of these signaling proteins leads to diseases such as cancer, Paget’s disease, and osteoporosis in humans (6), a group of bisphosphonates, containing two carbon-linked phosphonates structurally mimicking pyrophosphate of the allylic substrate, were developed as drugs to treat these diseases. Zoledronate, a bisphosphonate with a small nitrogen-containing imidazole ring, is a drug (Zometa®/Reclast®) thought to target human FPPS (7), but was suspected to also inhibit human GGPPS (8). However, enzymatic assays showed that zoledronate did not inhibit human GGPPS (9) but surprisingly inhibited S. cerevisiae GGPPS (10) in vitro, despite their structural similarities [human GGPPS (PDB code 2FV1) (11) and S. cerevisiae GGPPS (PDB code 2DH4) (12) crystal structures have root mean square deviations (RMSD) of 1.2−2.6 Å for α-carbons].


3

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 32

Previously, we synthesized a FPP analogue, (2E,6E)-8-O-(N-Methyl-2-aminobenzoyl)3,7-dimethyl-2,6-octandien-1-diphosphate (MANT-O-GPP) (structure shown below), with the smallest fluorescent MANT group linked to C10 GPP via an ester bond (13), modified from another fluorescent probe (14).

O NH O

O O P P O O O 3NH4 O O

This fluorescent probe has been shown to serve as a satisfactory substrate for a cis-type undecaprenyl diphosphate synthase (UPPS) that catalyzes consecutive condensation reactions of FPP with eight IPP to form a C55 product (15). UPPS serves as an antibacterial drug target because its UPP product is the lipid carrier mediating biosynthesis of bacterial peptidoglycan. MANT displays an enhanced fluorescence at 420 nm when excited at 352 nm upon chain elongation and is therefore able to measure UPPS kinetics and inhibition (13). In this study, MANT-O-GPP was tested as a substrate on the long-chain E. coli OPPS and the mutant FPPS and GGPPS engineered to produce sufficiently long products. Using MANT-O-GPP, the kinetic constants of the wild-type OPPS and the mutant FPPS and GGPPS were measured and compared with those measured using the radioactive substrate to establish the fluorescent assay platform. Using this assay, the inhibitory mechanism of zoledronate on human GGPPS was solved. Our results as reported herein indicate that this fluorescent probe allowing the real-time monitoring of the prenyltransferase reactions is useful for their kinetics and inhibition studies.

MATERIALS AND METHODS


4

Page 5 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Materials. MANT-O-GPP was synthesized as previously described (13). FPP, IPP, and zoledronate were obtained from Sigma. Radiolabeled [14C]IPP (55 mCi/mmol) was purchased from Amersham Pharmacia Biotech. Potato acid phosphatase (2 units/mg) was obtained from Roche Molecular Biochemicals. The protein expression kit including the pET16b vector and competent BL21 (DE3) cells were obtained from Novagen. All commercial buffers and reagents were of the highest grade. Preparation of Recombinant E. coli OPPS, S. cerevisiae GGPPS, Human GGPPS, and Human FPPS. Protein expression and purification for E. coli OPPS (16), S. cerevisiae GGPPS (12), and human FPPS (17) were previously described. To prepare human GGPPS, a reported clone (11) was modified as follows. The gene encoding human GGPPS from a human cDNA was amplified using PCR with the forward primer 5’CATGCCATGGAGAAGACTCAAGAAACAGTCC-3’ and reverse primer 5’CGGGATCCTTAGTGGTGGTGGTGGTGGTGTTCATTTTCTTCTTTGAACATCT-3’ and cloned into pET16b vector, giving a C-terminal His-tag to the recombinant protein for Ni-NTA column purification. The correct plasmid confirmed from sequencing was subsequently transformed to BL21 cells for protein expression. The cells were grown at 37 °C to A600 = 0.6 and then induced with 1 mM IPTG at 16 °C. After a 16-hour induction, the cells were harvested by centrifugation at 7,000 x g for 15 mins. Cell pellets were suspended in 75-mL lysis buffer (25 mM Tris-HCl, pH 7.5, and 150 mM NaCl), subjected to French pressure cell press (AIMAMINCO Spectronic Instruments), and centrifuged at 17,000 x g for 30 mins to remove cell debris. The cell-free extract was loaded onto a Ni-NTA column equilibrated with the lysis buffer. The column was washed with 5 mM imidazole followed by 50 mM imidazole-containing lysis buffer. His-tagged human GGPPS was eluted with 300 mM imidazole and then dialyzed twice


5

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 32

against 3-L lysis buffer. These purified enzymes had purity higher than 90% according to SDSPAGE. Preparation of the Mutant Enzymes. Mutagenesis was carried out using the QuikChange site-directed mutagenesis kit (Agilent) and confirmed by DNA sequencing. The inactive mutant OPPS, in which the essential Asp residues (D84/D85/D88 and D211/D212/D215) in the two conserved Asp-rich motifs were replaced with Ala, was prepared using the mutagenic oligonucleotides: 5'-GACTCTGCTACACGCCGCCGTTGTGGCTGAATCAGATATGCG-3' and 5'-CGCATATCTGATTCAGCCACAACGGCGGCGTGTAGCAGAGTC-3' for D84A/D85A/D88A, as well as 5'CTTTCCAGTTGATCGCCGCTTTACTCGCTTACAATGCCGATGG-3' and 5'CCATCGGCATTGTAAGCGAGTAAAGCGGCGATCAACTGGAAAG-3' for D211A/D212A/D215A. The mutant S. cerevisiae GGPPS that can synthesize longer-chain products was prepared as reported previously (12) and the Y107A/F108A mutations were introduced using the mutagenic oligonucleotides: 5'CACCGCAAATTATATGGCGGCGAGAGCCATGCAACTTG-3' and 5'CAAGTTGCATGGCTCTCGCCGCCATATAATTTGCGGTG-3'. Similarly, the Y96A/F97A mutant human GGPPS was prepared using the mutagenic oligonucleotides: 5'CTGCCAATTACGTGGCGGCGCTTGGCTTG-3' and 5'CAAGCCAAGCGCCGCCACGTAATTGGCAG-3'. The protocol for protein expression and purification of the mutant enzymes was the same as for the wild-type enzymes. These purified mutant enzymes also had purity higher than 90% according to SDS-PAGE. Single-Turnover of MANT-O-GPP. To determine the products yielded from MANT-OGPP under single-turnover conditions, 15 µL of the enzyme (10 µM) pre-incubated with MANT-


6

Page 7 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

O-GPP (4 µM) was mixed with the same volume of [14C]IPP (50 µM) in the reaction buffer. The reaction buffer for the wild-type E. coli OPPS and mutant S. cerevisiae GGPPS was 100 mM Hepes-KOH (pH7.5), 50 mM KCl, 0.5 mM MgCl2, and 0.1% Triton X-100 as previously used (12, 16), while that for the mutant human GGPPS was 50 mM Tris, 2 mM MgCl2, 0.2% Tween 20, and 1 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) at pH 7.5 as previously used (11). Reactions were quenched by adding 67 µL of 0.6 N NaOH that can stop the reactions immediately, after specified time periods using the Quench-Flow instrument (Kintek, USA). The radio-labeled products were extracted with butanol (IPP was in aqueous phase), hydrolyzed using acidic phosphatase to remove the pyrophosphate, subjected to reverse-phase TLC analysis, and visualized under a phospho-imaging machine as previously described (16). The TLC plate with radiolabeled products was developed using acetone/water (19:1) and then exposed to a film. The products imaged by autoradiography were identified by their Rf values (12, 16). Radioactivity-Based Kinetic Analysis. To measure the kinetic constants by radioactive assays, 0.2 µM of the wild-type E. coli OPPS and the wild-type or mutant S. cerevisiae GGPPS and human GGPPS were respectively mixed with various concentrations of either FPP or MANT-O-GPP, and [14C]IPP as specified. For FPP or MANT-O-GPP Km measurements, 0.5 to 5 µM FPP or MANT-O-GPP was used with 50 µM [14C]IPP. For [14C]IPP Km and kcat determination, 3.5 µM FPP or MANT-O-GPP was utilized to saturate the enzyme and 2 to 50 µM [14C]IPP was added. 40-µL portions of the reaction mixtures were periodically withdrawn and mixed with 10 mM EDTA to chelate with Mg2+ and stop the enzyme reactions. The initial enzyme velocities at different substrate concentrations were determined within the first 10% of substrate depletion and calculated based on the radioactivities associated with the aqueous phase containing the unreacted [14C]IPP and the butanol phase used to extract the hydrophobic


7

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 32

products as previously described (12, 16). The plot of initial velocities vs. the substrate concentrations was fitted with the Michaelis-Menten equation (Eq. 1) as described (18) to give Km and kcat (Vmax/[E]) values. Vo = Vmax [S] / (Km + [S])

Eq. 1

In Eq. 1, Vo is the initial velocity, [E] is the enzyme concentration, [S] is the substrate concentration, Vmax is the maximum velocity, and Km is the Michaelis constant. Fluorescence-Based Kinetic Analysis. Fluorescence changes were monitored with time using a F-4500 fluorescence spectrophotometer (Hitachi) that applied an excitation wavelength of 352 nm (5 nm slit) and emission wavelength of 420 nm (10 nm slit) during the chain elongation of MANT-O-GPP. The assays were performed by mixing either 0.2 µM E. coli OPPS, the Y107A/F108A S. cerevisiae GGPPS, or the Y96A/F97A human GGPPS with various concentrations of MANT-O-GPP and cold IPP as specified. For MANT-O-GPP Km measurement, 0.5 to 5 µM MANT-O-GPP was used with 50 µM cold IPP. For IPP Km and kcat determination, 3.5 µM MANT-O-GPP was utilized to saturate the enzyme with cold IPP from 2 to 50 µM. A standard curve was generated to correlate the fluorescence changes upon incubating with 0.2 µM enzyme, 0.5, 1, 2, 3.5, or 5 µM MANT-O-GPP, and 50 µM cold IPP for 30 mins to reach completion. IPP consumption was measured from a radioactive assay using [14C]IPP as substrate at each concentration of MANT-O-GPP. The plot of initial velocities vs. concentrations of the substrate was fitted with Eq. 1. Radioactivity-Based IC50 Measurements. The IC50 values of zoledronate for 0.2 µM wildtype E. coli OPPS, S. cerevisiae GGPPS, and human GGPPS were respectively measured in separate reaction mixtures containing 5 µM FPP or MANT-O-GPP, 50 µM [14C]IPP, and


8

Page 9 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

different concentrations of zoledronate. The initial velocities were measured at zero and different concentrations of the inhibitor and IC50 values of the inhibitor were determined by fitting the plot of reaction rates versus the inhibitor concentrations using Eq. 2 (18). A(I) = A(0) x {1- [ I / (I + IC50)]}

Eq. 2

In this equation, A(I) is the enzyme activity with inhibitor concentration I, A(0) is the enzyme activity without the inhibitor, and I is the inhibitor concentration. Fluorescence-Based IC50 and Ki Measurements. The IC50 values of zoledronate for 0.2 µM E. coli OPPS, Y107A/F108A S. cerevisiae GGPPS, and Y96A/F97A human GGPPS were determined in separate reaction mixtures containing 5 µM MANT-O-GPP and 50 µM cold IPP in buffers containing various concentrations of zoledronate. The plot of initial velocities vs. concentrations of the inhibitor was fitted with Eq. 2 to yield the IC50 value. The Ki value of zoledronate against the Y107A/F108A S. cerevisiae GGPPS was measured using 0.2 µM enzyme, IPP (50 µM), zoledronate (0, 0.5, or 1 µM), and various concentrations of MANT-OGPP. The Lineweaver-Burk plot was fitted with the competitive inhibitory equation as described (18) to yield the Ki value. Stopped-Flow Experiments. The fluorescence of MANT-O-GPP above 420 nm with a cut-off filter was monitored using an excitation wavelength of 352 nm. To observe the inhibition of zoledronate on MANT-O-GPP chain elongation under the multiple-turnover conditions, the stopped-flow experiments were performed by mixing 1 µM S. cerevisiae or human GGPPS, 5 µM MANT-O-GPP, and different concentrations of zoledronate with an equal volume of 50 µM cold IPP in the reaction buffer. The stopped-flow traces for S. cerevisiae GGPPS reactions were


9

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 32

fitted with a single-exponential equation, while the data for human GGPPS were fitted with a single-exponential followed by a linear equation.

RESULTS MANT-O-GPP as an Alternative Substrate for the Wild-Type and Mutant TransPrenyltransferases. As shown in Fig. 1A, MANT-O-GPP was successfully elongated by E. coli OPPS to mainly incorporate 5 molecules of IPP in the single-turnover reaction with a time course similar to that of FPP (16), indicating that MANT-O-GPP could serve as a satisfactory substrate for this enzyme. Under steady-state conditions, the following values, MANT-O-GPP Km = 0.8±0.1 µM, [14C]IPP Km = 6.9±0.5 µM and kcat = (5.5±0.8) x 10-2 s-1, measured by radioactive assays (16), were similar to those measured using FPP (Table 1). These indicated that the MANT moiety did not interfere with the binding and catalysis. In contrast, MANT-O-GPP did not react with [14C]IPP by the wild-type S. cerevisiae GGPPS and human GGPPS as judged from the failure to form any radiolabeled product (not shown). However, it could be successfully elongated in the single-turnover reaction to incorporate mainly 4 IPP by the Y107A/F108A S. cerevisiae GGPPS and the Y96A/F97A human GGPPS (Fig. 1B). These mutant enzymes were expected to synthesize longer-chain products due to replacement of the large amino acids with the smaller Ala at the bottom to enlarge the active sites (12). These GGPPS mutants showed similar kinetic constants compared to the wild-type enzymes using MANT-O-GPP or FPP as a substrate (Table 1), indicating that the mutations did not alter the enzyme kinetics, but only yielded longer products.


10

Page 11 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fluorescence-Based Kinetic Measurements. When MANT-O-GPP was elongated by E. coli OPPS, Y107A/F108A S. cerevisiae GGPPS, and Y96A/F97A human GGPPS, the fluorescence intensities of the products at 420 nm were significantly higher than that of MANTO-GPP, as shown in Fig. 2A, 3A, and 4A, respectively. The inactive mutant OPPS, the wild-type yeast and human GGPPS failed to generate products, thus showing no fluorescence increase. Based on the fluorescence changes at different concentrations of MANT-O-GPP and IPP used (Fig. 2B and 2C respectively), the MANT-O-GPP Km and IPP Km of E. coli OPPS were measured to be 0.8±0.2 µM and 4.8±0.5 µM (Table 1) respectively, and a kcat of (6.2±0.9) x 10-2 s-1 was derived from the standard curve that correlated the fluorescence increases with IPP consumption (not shown). Similarly, the MANT-O-GPP Km and IPP Km of Y107A/F108A S. cerevisiae GGPPS were 1.8±0.4 µM and 19.2±4.5 µM (Table 1) respectively, based on the fluorescence changes at different concentrations of MANT-O-GPP and IPP (Fig. 3B and 3C). The kcat of (2.9±0.1) x 10-2 s-1 was derived from the standard curve (not shown). The MANT-OGPP Km and IPP Km of Y96A/F97A human GGPPS were 1.0±0.2 µM and 8.2±1.7 µM (Table 1) respectively, measured from the fluorescence changes at different concentrations of MANT-OGPP and IPP (Fig. 4B and 4C), and the kcat of (4.7±0.3) x 10-2 s-1 was derived from the standard curve (not shown). These kinetic constants were consistent with those measured by the radioactive assays using MANT-O-GPP and [14C]IPP (Table 1), confirming that the fluorescence changes could be utilized to monitor the reactions and measure the kinetics of these transprenyltransferases in real time, provided that they synthesized long-chain products. Moreover, the mutations for synthesizing long-chain products did not interfere with the kinetic constants of human and S. cerevisiae GGPPS.


11

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 32

Fluorescence-Based Inhibition Constant Measurements. The inhibition constants of zoledronate were measured based on the fluorescence changes during MANT-O-GPP chain elongation catalyzed by E. coli OPPS (Fig. 5A) and Y107A/F108A S. cerevisiae GGPPS (Figure 5B) at different concentrations of zoledronate. As shown in Table 2, the fluorescence assays gave an IC50 of 0.22±0.01 µM against E. coli OPPS and an IC50 of 0.71±0.03 µM against Y107A/F108A S. cerevisiae GGPPS. These were similar to those measured by the radioactive assays using FPP and wild-type OPPS and yeast GGPPS. The inhibition pattern of zoledronate against Y107A/F108A S. cerevisiae GGPPS (Fig. 5C) revealed that it was a competitive inhibitor with respect to the MANT-O-GPP substrate and the Ki was determined to be 0.67±0.08 µM. In contrast, zoledronate failed to inhibit the steady-state rates but was able to reduce the final product formation amplitudes of Y96A/F97A human GGPPS (Fig. 5D). This appeared to agree with the IC50 value > 100 µM (Table 2) from the radioactive assays using FPP and wildtype human GGPPS based on the initial velocities. As a positive control, Zol inhibited human FPPS with a potent IC50 value of 0.004 µM (Table 2). Different Inhibitory Modes of Zoledronate against Mutant S. cerevisiae and Human GGPPS. To rationalize the different inhibition patterns of zoledronate against S. cerevisiae and human GGPPS as shown in Fig. 5, we utilized stopped-flow fluorescence technology to monitor the fluorescence change of MANT-O-GPP in the absence or presence of different concentrations of zoledronate, while it was being elongated by the two mutant enzymes under the multipleturnover conditions. As shown in Fig. 6A, in the absence of zoledronate, the fluorescent trace of MANT-O-GPP elongated by the Y107A/F108A S. cerevisiae GGPPS showed a singleexponential phase with a rate constant of 1.8 x 10-2 s-1 in agreement with the steady-state kcat, indicating no product release limiting the steady-state rate. Moreover, zoledronate inhibited the


12

Page 13 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Y107A/F108A S. cerevisiae GGPPS activity in a dose-dependent manner (3.6 x 10-3 s-1 and 3.6 x 10-4 s-1 at 2 and 20 µM zoledronate, respectively) in the stopped-flow experiments (Fig. 6A), which was consistent with the inhibition pattern measured under the steady-state condition (Fig. 5B). However, as shown in Fig. 6B, MANT-O-GPP elongated by the Y96A/F97A human GGPPS showed a faster increasing phase initially (rate constant = 11.38 s-1) followed by a slower linear phase (steady-state phase), indicating product release as the rate-limiting step under the steady-state condition. In the presence of 20 or 50 µM zoledronate, the first phase disappeared, but the steady-state phase appeared almost unaffected, consistent with the inhibitory pattern that steady-state rates were not changed in the presence of different concentrations of zoledronate (Fig. 5D).

DISCUSSION MANT-O-GPP has been demonstrated as a satisfactory substrate for E. coli UPPS in our previous study and the fluorescence increases at 420 nm during the chain elongation of MANTO-GPP allow us to measure UPPS kinetics and inhibition (13). As demonstrated here, MANT-OGPP is also useful to monitor the reactions catalyzed by the wild-type and mutant transprenyltransferases provided that they synthesize long-chain products. However, due to its more bulky size compared to FPP, the mutant Y107A/F108A yeast GGPPS incorporated less (mainly 4) IPP into the products when using MANT-O-GPP as compared to using FPP (mainly 7) (12). As limited by the size, it cannot be elongated by the wild-type human and yeast GGPPS. Nevertheless, MANT-O-GPP shows 2-fold lower Km values comparing to FPP for wild-type


13

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 32

OPPS and those mutant enzymes with enlarged active sites, probably through the extra binding of the MANT moiety with the enzymes, but IPP binding was weakened. It has been previously shown that zoledronate, a human FPPS inhibitor, can inhibit S. cerevisiae GGPPS (10), but not human GGPPS (9). By taking advantage of the detectable fluorescence signal of MANT-O-GPP using stopped-flow technology, we have demonstrated that zoledronate, while inhibiting the steady-state rates of S. cerevisiae GGPPS reactions, could not inhibit the steady-state rates of human GGPPS reactions. It could, however, inhibit the first turnover of burst kinetics under the multiple-turnover conditions. The kinetic mechanisms of the mutant S. cerevisiae and human GGPPS reactions are also different; the former’s ratedetermining step is the chemical reaction and shows a single exponential increase of fluorescence but the latter’s rate-limiting step is product release and thus reveals burst kinetics. Therefore, zoledronate may act as a product-like inhibitor in human GGPPS, so that the enzyme pre-occupied with zoledronate only displays the steady-state phase representing the product release step without the burst phase. On the other hand, zoledronate inhibits the S. cerevisiae GGPPS competitively in the active site. Our hypothesis derived from the kinetic studies can be supported by the crystal structures of human FPPS, human GGPPS and S. cerevisiae GGPPS. Zoledronate was shown bound at the active site of human FPPS (17) and S. cerevisiae GGPPS (10) through a cluster of Mg2+ ions that are coordinated to conserved aspartate residues. In contrast, GGPP product was found bound in the center of the helical bundle (product-inhibition site), which differs from the proposed FPPS chain elongation site (active site), to reveal product inhibition (11). The crystal structure of human GGPPS-zoledronate complex is not available yet. Based on the different inhibitory kinetics we observed for zoledronate on human GGPPS, this product-inhibition site might be


14

Page 15 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

responsible for the inhibition. However, it should be noted that the inhibition of zoledronate is weaker on human GGPPS, as the concentrations of zoledronate required to reduce the amplitudes of the reactions are higher in Fig. 5D than in Fig. 5B. Collectively, our fluorescent method without the need to use [14C]IPP provides an environmentally friendly assay method. Compared to the commercial EnzChek® Pyrophosphate Assay Kit (Invitrogen) available to detect the formed pyrophosphate that is then cleaved into monophosphate to form a chromophore to monitor prenyltransferase reactions (19), our method is less tedious and less expensive without need of using coupling reagents. Moreover, the EnzChek® kit detects phosphate, so it cannot distinguish between prenyltransferase and pyrophosphatase. MANT fluorophore is the smallest fluorophore, which not only has small perturbations on the natural substrate molecular framework but also possesses unique excited state intramolecular proton transfer (ESIPT) (20-22), resulting from the strong 6-member ring intramolecular hydrogen bond between N-H and C=O groups. The intrinsic proton transfer in the 1

ππ* state (23) is essentially barrierless in non-polar solvents and fluoresces strongly (24). In

summary, we provide here a convenient, sensitive and environmentally friendly real-time fluorescent platform, useful for studying kinetics and inhibition and even high throughput screening of inhibitors for prenyltransferases.


15

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 32

Table 1. Kinetic constants measured using the radioactive or fluorescent assays -1

Enzyme

Conditions

k

K (μM)a

(s )

m

cat

E. coli OPPS

S. cerevisiae GGPPS

Y107A/F108A S. cerevisiae GGPPS

human GGPPS

Y96A/F97A human GGPPS

a

FPP + [14C]IPP (radioactive)

(6.0±0.7) × 10

MANT-O-GPP + [14C]IPP (radioactive)

(5.5±0.8) × 10

MANT-O-GPP + cold IPP (fluorescent)

(6.2±0.9) × 10


(2.5±0.4) × 10

(2.9±0.1) × 10-2

(3.0±0.2) × 10


(4.7±0.3) × 10

6.9±0.5

0.8±0.2

4.8±0.5

3.2±0.3

0.8±0.2

2.6±0.5

3.3±0.5

1.0±0.3

12.1±1.3

1.8±0.4

19.2±4.5

2.8±0.4

1.4±0.2

3.3±0.7

4.5±0.7

1.6±0.3

6.5±0.5

1.0±0.2

8.2±1.7

-2



0.8±0.1

-2

(2.3±0.2) × 10

(3.5±0.2) × 10

4.0±0.3

-2



1.5±0.4 -2

(4.9±0.3) × 10

(4.7±0.3) × 10

m

-2



IPP K (μM)

-2

-2

-2

-2

-2

Km of FPP or MANT-O-GPP


16

Page 17 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 2. IC50 of zoledronate measured using the radioactive or fluorescent assays Inhibitor

OH HO P O N

Enzyme

E. coli OPPS

HO

P O OH

IC50 (μM)


0.22±0.01

14

FPP + [ C]IPP (radioactive)

OH

N

Condition

0.29±0.06

14

human FPPS

GPP + [ C]IPP (radioactive)

0.004±0.0002

Y107A/F108A S. cerevisiae GGPPS


0.71±0.03

S. cerevisiae GGPPS


human GGPPS


Zoledronate

14

0.66±0.06

14


>100

17

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 32

FIGURES CAPTION Figure 1. Single-turnover chain elongation of MANT-O-GPP. (A) MANT-O-GPP reacted with 5 molecules of IPP by E. coli OPPS to form the major product within 5 sec, similar to that using FPP. (B) MANT-O-GPP could be elongated with mainly 4 molecules of IPP by the Y107A/F108A S. cerevisiae GGPPS (left) and the Y96A/F97A human GGPPS (right). In these single-turnover reactions, 10 µM each enzyme, 4 µM MANT-O-GPP, and 50 µM [14C]IPP were used.

Figure 2. Real-time monitoring of E. coli OPPS reaction using MANT-O-GPP. (A) Fluorescence at 420 nm during chain elongation of MANT-O-GPP was increased by E. coli OPPS (●), but not by the inactive mutant OPPS (○) in the solution containing 0.2 µM enzyme, 5 µM MANT-O-GPP, and 50 µM cold IPP. (B) Measurements of the fluorescence changes using 0.2 µM E. coli OPPS and 50 µM cold IPP at different concentrations of MANT-O-GPP [0.5 µM (●), 1 µM (○), 2 µM (▼), 3.5 µM (△), and 5 µM (■)]. (C) Measurements of the fluorescence changes using 0.2 µM E. coli OPPS and 3.5 µM MANT-O-GPP at different concentrations of cold IPP [2 µM (●), 5 µM (○), 10 µM (▼), 20 µM (△), and 50 µM (■)]. Typical fluorescence traces obtained directly from the fluorimeter are shown here.

Figure 3. Real-time monitoring of MANT-O-GPP chain elongation by the Y107A/F108A S. cerevisiae GGPPS. (A) Fluorescence at 420 nm during chain elongation of MANT-O-GPP was increased by the Y107A/F108A S. cerevisiae GGPPS (●), but not by the wild-type S. cerevisiae GGPPS (○) in the solution containing 0.2 µM enzyme, 5 µM MANT-O-GPP, and 50 µM cold


18

Page 19 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

IPP. (B) Measurements of the fluorescence changes using 0.2 µM Y107A/F108A S. cerevisiae GGPPS and 50 µM cold IPP at different concentrations of MANT-O-GPP [0.5 µM (●), 1 µM (○), 2 µM (▼), 3.5 µM (△), and 5 µM (■)]. (C) Measurements of the fluorescence changes using 0.2 µM Y107A/F108A S. cerevisiae GGPPS and 3.5 µM MANT-O-GPP at different concentrations of cold IPP [2 µM (●), 5 µM (○), 10 µM (▼), 20 µM (△), and 50 µM (■)]. Typical fluorescence traces obtained directly from the fluorimeter are shown here.

Figure 4. Real time monitoring of MANT-O-GPP chain elongation by the Y96A/F97A human GGPPS. (A) Fluorescence at 420 nm during chain elongation of MANT-O-GPP was increased by the Y96A/F97A human GGPPS (●), but not by the wild-type human GGPPS (○) in the solution containing 0.2 µM enzyme, 5 µM MANT-O-GPP, and 50 µM cold IPP. (B) Measurements of the fluorescence changes using 0.2 µM Y96A/F97A human GGPPS and 50 µM cold IPP at different concentrations of MANT-O-GPP [0.5 µM (●), 1 µM (○), 2 µM (▼), 3.5 µM (△), and 5 µM (■)]. (C) Measurements of the fluorescence changes using 0.2 µM Y96A/F97A human GGPPS and 3.5 µM MANT-O-GPP at different concentrations of cold IPP [2 µM (●), 5 µM (○), 10 µM (▼), 20 µM (△), and 50 µM (■)]. Typical fluorescence traces obtained directly from the fluorimeter are shown here.

Figure 5. Measuring enzyme inhibition by zolendorate using MANT-O-GPP. (A) Fluorescence changes during MANT-O-GPP chain elongation by E. coli OPPS were measured at different concentrations of zoledronate [0 µM (●), 0.25 µM (○), 0.35 µM (▼), 0.5 µM (△), and 0.6 µM (■)]. (B) Fluorescence changes during MANT-O-GPP chain elongation by the Y107A/F108A S. cerevisiae GGPPS were measured at different concentrations of zoledronate [0 µM (●), 1 µM


19

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 32

(○), 2 µM (▼), 3 µM (△), and 5 µM (■)]. (C) Ki measured based on the fluorescence changes during MANT-O-GPP chain elongation by the Y107A/F108A S. cerevisiae GGPPS under different concentrations of zoledronate (Zol). The reaction mixture contained the Y107A/F108A S. cerevisiae GGPPS (0.2 µM), cold IPP (50 µM), zoledronate [0 µM (●), 0.5 µM (■), or 1 µM ( ▲)],

and various concentrations of MANT-O-GPP. Error bars represent the standard deviation

(±SD) calculated based on at least three independent experiments. (D) The fluorescence changes during MANT-O-GPP chain elongation by the Y96A/F97A human GGPPS were measured at different concentrations of zoledronate [0 µM (●), 10 µM (○), 50 µM (▼), and 100 µM (△)]. Except (C), typical fluorescence traces directly obtained from the fluorimeter are shown here.

Figure 6. Stopped-flow fluorescence traces during MANT-O-GPP chain elongation by the Y107A/F108A S. cerevisiae GGPPS and the Y96A/F97A human GGPPS in the absence and presence of zoledronate. (A) Fluorescence traces of mixing 1 µM Y107A/F108A S. cerevisiae GGPPS, 5 µM MANT-O-GPP and 50 µM cold IPP in the absence and the presence of 2 µM and 20 µM zoldronate (Zol). (B) The fluorescence traces of mixing 1 µM Y96A/F97A human GGPPS, 5 µM MANT-O-GPP and 50 µM cold IPP in the absence and the presence of 20 µM and 50 µM zoledronate.


20

Page 21 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1

(A)

(B) + 1 IPP + 2 IPP

+ 1 IPP + 2 IPP + 3 IPP

+ 3 IPP + 4 IPP

+ 4 IPP + 5 IPP + 6 IPP

+ 5 IPP

+ 7 IPP

0.4

0.6

1

1.5

2

3

5

Time (sec)


21

Biochemistry

Figure 2

(A)

(B)

800

800

600

600

RFI (a.u.)

1000

RFI (a.u.)

1000

400

200

400

200

0 0

0

20

40

60

80

100

0

20

Time (sec)

(C)

40

60

80

100

Time (sec)

800

600

RFI (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 32

400

200

0 0

20

40

60

80

100

Time (sec)


22

Page 23 of 32

Figure 3

(A)

(B) 1400

1400

1200

1200

1000 RFI (a.u.)

RFI (a.u.)

1000 800 600

800 600

400

400

200

200

0

0

0

20

40

60

80

100

0

20

40

60

80

100

Time (sec)

Tim e (sec)

(C) 1400 1200 1000 RFI (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

800 600 400 200 0 0

20

40

60

80

100

Time (sec)


23

Biochemistry

Figure 4

(B)

1000

1000

800

800

600

600

RFI (a.u.)

RFI (a.u.)

(A)

400

200

400

200

0 0 0

20

40

60

80

100

0

Time (sec)

20

40

60

80

100

Time (sec)

(C) 800

600 RFI (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 32

400

200

0 0

20

40

60

80

100

Time (sec)


24

Page 25 of 32

Figure 5

(A)

(B)

1600

2500 1400

2000

1200

RFI (a.u.)

1000 800

1500

1000

600 400

500 200

0

0 0

50

100

150

0

200

50

(C)

100

150

200

600

800

Time (sec)

Tim e (sec)

(D) 3000 2500 2000 RFI (a.u.)

RFI (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

1500 1000 500 0 0

200

400 Tim e (sec)


25

Biochemistry

Figure 6

(A) 3

2.8

0 µM Zol

Signal

2.6

2 µM Zol 2.4

2.2

20 µM Zol 2 0

20

40

60

80

100

Time (sec)

(B) 3.2

0 µM Zol

3.1 3

20 µM Zol Signal

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 32

2.9

50 µM Zol 2.8 2.7 2.6 2.5 0

20

40

60

80

100

Time (sec)


26

Page 27 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

AUTHOR INFORMATION Corresponding Author *Email: [email protected] Tel: +886-2-3366-4069, Fax: +886-2-2363-5038 Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding This work was supported by the Ministry of Science and Technology of Taiwan (102-2113-M001-005-MY3). Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT We thank the funding provided by the Ministry of Science and Technology of Taiwan (1022113-M-001-005-MY3). We also thank Ms. Alice Yeh for proofreading.

ABBREVIATIONS IPP, isopentenyl diphosphate; DMAPP, dimethylallyl diphosphate; GPP, geranyl diphosphate; FPP, farnesyl diphosphate; FPPS, farnesyl diphosphate synthase; GGPP, geranylgeranyl diphosphate; GGPPS, geranylgeranyl diphosphate synthase; OPP, octaprenyl diphosphate; OPPS, octaprenyl diphosphate synthase; MANT-O-GPP, (2E,6E)-8-O-(N-Methyl-2aminobenzoyl)-3,7-dimethyl-2,6-octandien-1-diphosphate; RMSD, root mean square deviations


27

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 32

REFERENCES (1)

Poulter, C. D., and Rilling, H. C. In Biosynthesis of Isoprenoid Compounds; Porter, J.

W., Spurgeon, S. L., Eds.; Wiley: New York, 1981; Vol 1, pp 161−224. (2)

Ogura, K., Koyama, T., and Sagami, H. (1997) Polyprenyl diphosphate synthases.

Subcell. Biochem. 28, 57–87. (3)

Liang, P. H., Ko, T. P., and Wang, A. H. (2002) Structure, mechanism and function of

prenyltransferases. Eur. J.Biochem. 269, 3339–3354. (4)

Ogura, K., and Koyama, T. (1998) Enzymatic Aspects of Isoprenoid Chain Elongation.

Chem. Rev. 98, 1263–1276. (5)

Asai, K., Fujisaki, S., Nishimura, Y., Nishino, T., Okada, K., Nakagawa, T., Kawamukai,

M., and Matsuda, H. (1994) The identification of Escherichia coli ispB (cel) gene encoding the octaprenyl diphosphate synthase. Biochem. Biophys. Res. Commun. 202, 340–345. (6)

Green, J. R. (2003) Antitumor effects of bisphosphonates. Cancer 97, 840–847.

(7)

Dunford, J. E., Kwaasi, A. A., Rogers, M. J., Barnett, B. L., Ebetino, F. H., Russell, R.

G., Oppermann, U., and Kavanagh, K. L. (2008) Structure-activity relationships among the nitrogen containing bisphosphonates in clinical use and other analogues: time-dependent inhibition of human farnesyl pyrophosphate synthase. J. Med. Chem. 51, 2187–2195. (8)

Goffinet, M., Thoulouzan, M., Pradines, A., Lajoie-Mazenc, I., Weinbaum, C., Faye, J.

C., and Seronie-Vivien, S. (2006) Zoledronic acid treatment impairs protein geranyl-geranylation for biological effects in prostatic cells. BMC Cancer 6, 60.


28

Page 29 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(9)

Szabo, C. M., Matsumura, Y., Fukura, S., Martin, M. B., Sanders, J. M., Sengupta, S.,

Cieslak, J. A., Loftus, T. C., Lea, C. R., Lee, H. J., Koohang, A., Coates, R. M., Sagami, H., and Oldfield, E.(2002) Inhibition of geranylgeranyl diphosphate synthase by bisphosphonates and diphosphates: a potential route to new bone antiresorption and antiparasitic agents. J. Med. Chem. 45, 2185–2196 (10) Guo, R. T., Cao, R., Liang, P. H., Ko, T. P., Chang, T. H., Hudock, M. P., Jeng, W. Y., Chen, C. K., Zhang, Y., Song, Y., Kuo, C. J., Yin, F., Oldfield, E., and Wang, A. H. (2007) Bisphosphonates target multiple sites in both cis- and trans-prenyltransferases. Proc. Natl. Acad. Sci. U. S. A. 104, 10022–10027. (11) Kavanagh, K. L., Dunford, J. E., Bunkoczi, G., Russell, R. G., and Oppermann, U. (2006) The crystal structure of human geranylgeranyl pyrophosphate synthase reveals a novel hexameric arrangement and inhibitory product binding. J. Biol. Chem. 281, 22004–22012. (12) Chang, T. H., Guo, R. T., Ko, T. P., Wang, A. H., and Liang, P. H. (2006) Crystal structure of type-III geranylgeranyl pyrophosphate synthase from Saccharomyces cerevisiae and the mechanism of product chain length determination. J. Biol. Chem. 281, 14991–15000. (13) Teng, K. H., Chen, A. P., Kuo, C. J., Li, Y. C., Liu, H. G., Chen, C. T., and Liang, P. H. (2011) Fluorescent substrate analog for monitoring chain elongation by undecaprenyl pyrophosphate synthase in real time. Anal. Biochem. 417, 136–141. (14) Chen, A. P.-C., Chen, Y. H., Liu, H. P., Li, Y. C., Chen, C. T., and Liang, P. H. (2002) Synthesis and application of a fluorescent substrate analogue to study ligand interactions for undecaprenyl pyrophosphate synthase. J. Am. Chem. Soc. 124, 15217–15224.


29

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 32

(15) Guo, R. T., Ko, T. P., Chen, A. P., Kuo, C. J., Wang, A. H., and Liang, P. H. (2005) Crystal structures of undecaprenyl pyrophosphate synthase in complex with magnesium, isopentenyl pyrophosphate, and farnesyl thiopyrophosphate: roles of the metal ion and conserved residues in catalysis. J. Biol. Chem. 280, 20762–20774. (16) Pan, J. J., Kuo, T. H., Chen, Y. K., Yang, L. W., and Liang, P. H. (2002) Insight into the activation mechanism of Escherichia coli octaprenyl pyrophosphate synthase derived from presteady-state kinetic analysis. Biochim. Biophys. Acta 1594, 64–73. (17) Kavanagh, K. L., Guo, K., Dunford, J. E., Wu, X., Knapp, S., Ebetino, F. H., Rogers, M. J., Russell, R. G., and Oppermann, U. (2006) The molecular mechanism of nitrogen-containing bisphosphonates as antiosteoporosis drugs. Proc. Natl. Acad. Sci. U. S. A. 103, 7829–7834. (18) Segel, I. H. In Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems; Classics Library, ed.; John Wiley and Sons: New York, 1993; pp 100−118. (19) Upson, R. H., Haugland, R. P., Malekzadeh, M. N., and Haugland, R. P. (1996) A spectrophotometric method to measure enzymatic activity in reactions that generate inorganic pyrophosphate. Anal.Biochem. 243, 41–45. (20) Scheiner, S. J. (2000) Theoretical studies of excited state proton transfer in small model systems. Phys. Chem. A, 104, 5898–5909. (21) Dale, R. E., Eisinger, J., and Blumberg, W. E. (1979) The orientational freedom of molecular probes. The orientation factor in intramolecular energy transfer. Biophys. J., 26, 161– 193.


30

Page 31 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(22) Dale, R. E., and Eisinger, J. In Biochemical fluorescence: concepts, Marcel Dekker; New York, 1975. (23) Waluk, J. In Conformational aspects of intra- and intermolecular excited state proton transfer; conformational analysis of molecules in excited states" J.Waluk, Ed.; WileyVCH, 2002. (24) Lukeman, M., and Wan, P. (2002) A new type of excited-state intramolecular proton transfer: proton transfer from phenol OH to a carbon atom of an aromatic ring observed for 2phenylphenol. J. Am. Chem. Soc. 2002, 124, 9458–9464.


31

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 32

Table of Contents Graphic and Synopsis


32

Fluorescent Farnesyl Diphosphate Analogue: A Probe To Validate

Recommend Documents