Fully Automated DNA Reaction and Analysis in a Fluidic Capillary

Samples in the loop of an injection valve are amplified inside a rapid air ..... of anti-double-stranded DNA antibody in systemic lupus erythematosus ...
2 downloads 0 Views 263KB Size
Download PDF
Anal. Chem. 1997, 69, 848-855

Fully Automated DNA Reaction and Analysis in a Fluidic Capillary Instrument Harold Swerdlow,* Barbara J. Jones, and Carl T. Wittwer†

Department of Human Genetics, University of Utah, 308 Biopolymers Bldg. 570, Salt Lake City, Utah 84112

A simple, reliable, automated genetic analysis instrument has been designed and prototyped. The system uses novel fluidic technology, coupling thermal cycling, reaction purification, in-line loading, and capillary electrophoresis in a single instrument. Samples in the loop of an injection valve are amplified inside a rapid air thermal cycler. A liquid chromatographic separation eliminates contaminants and excess salt. The sample is loaded in an efficient, continuous, flow-through manner onto a polymer-filled separation capillary. Detection by laserinduced fluorescence produces signal-to-noise ratios of 1000:1 or greater. Refilling of the polymer-filled capillary is automatic; during the run, the system is reconditioned for injection of another sample. Since all components and connections are fluidic, automation is natural and simple. The instrument is reliable and fast, performing PCR reaction cycling, purification and analysis, all in 20 min. Reproducibility (CV) of retention times is 2% (n ) 129) and of peak areas 9% (n ) 34). Bubbles and particulates are eliminated by the chromatography column. Adaptation of the instrument prototype for separation of DNAsequencing reactions is described; cycle sequencing and electrophoresis of a single lane are complete in 90 min. Implications and challenges for development of fully automated fluidic instruments for genomic sequencing are discussed.

The polymerase chain reaction (PCR) has revolutionized molecular biology since its introduction by Mullis and Faloona.2 A specific DNA sequence is amplified by an enzymatic reaction using repetitive cycling between three temperatures. The product of the reaction is normally one or a few essentially homogeneous fragments of known size. The product DNA molecule(s) can be diagnostic for the presence of a specific bacterium or virus in a tissue or blood sample,3,4 can be used in many genetic tests, e.g., microsatellite genotyping,5 or can be used as a template for further analyses, notably DNA sequencing.6 Numerous instruments have been designed to automate the thermal cycling protocols.7,8 Conventional analysis of the PCR reaction products is performed by agarose gel electrophoresis.9 Electrophoresis is essential to distinguish true products from priming artifacts, primer-dimers, and unincorporated primers, although hybridization-based methods have also been employed to generate specificity in PCR analyses.10 Electrophoresis as currently practiced is a slow and tedious procedure, requiring manual pouring, loading, monitoring, and off-line detection. This process has been difficult to automate and has made PCR analysis a difficult task for the average clinical laboratory.11 To date, full automation of PCR reaction cycling and analysis has only been accomplished with nonelectrophoretic approaches.12-15 However, many PCR-based genetic tests require high-resolution electrophoretic separation.16,17

† Department of Pathology, 5C130 School of Medicine, University of Utah, Salt Lake City, UT 84112.

(1) Swerdlow, H.; Wittwer, C.; Gesteland, R. Automated high-speed DNA diagnostics in a capillary format. Sixth International Symposium on High Performance Capillary Electrophoresis, San Diego, CA, 1994. (2) Mullis, K. B.; Faloona, F. A. Methods Enzymol. 1987, 155, 335-350. (3) Butcher, A.; Spadoro, J. Clin. Immunol. Newsl. 1992, 12, 73-76. (4) Persing, D. H.; Telford, S. R., III; Rys, P. N.; Dodge, D. E.; White, T. J.; Malawista, S. E.; Spielman, A. Science 1990, 249, 1420-1423. (5) Fre´geau, C. J.; Fourney, R. M. BioTechniques 1993, 15, 100-119. (6) Innis, M. A.; Myambo, K. B.; Gelfand, D. H.; Brow, M. A. D. Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 9436-9440. (7) Haff, L.; Atwood, J. G.; DiCesare, J.; Katz, E.; Picozza, E.; Williams, J. F.; Woudenberg, T. BioTechniques 1991, 10, 102-112. (8) Wittwer, C. T.; Fillmore, G. C.; Hillyard, D. R. Nucleic Acids Res. 1989, 17, 4353-4357. (9) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 1989. (10) Livav, K. PCR Methods Appl. 1995, 4, 357-362. (11) Bockstahler, L. E. PCR Methods Appl. 1994, 3, 263-267. (12) Zhao, S.; Consoli, U.; Arceci, R.; Pfeifer, J.; Dalton, W. S.; Andreeff, M. BioTechniques 1996, 21, 726-731. (13) Findlay, J. B.; Atwood, S. M.; Bergmeyer, L.; Chemelli, J.; Christy, K.; Cummins, T.; Donish, W.; Ekeze, T.; Falvo, J.; Patterson, D.; et al. Clin. Chem. 1993, 39, 1927-1933. (14) Wittwer, C. T.; Hermann, M. G.; Moss, A. A.; Rasmussen, R. R. BioTechniques, in press. (15) Ririe, K. M.; Rasmussen, R. R.; Wittwer, C. T. Anal. Biochem., in press. (16) McCord, B. R.; Jung, J. M.; Holleran, E. A. J. Liq. Chromatogr. 1993, 16, 1963-1981. (17) Swerdlow, H.; Gesteland, R. Nucleic Acids Res. 1990, 18, 1415-1419.

848 Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

S0003-2700(96)01104-3 CCC: $14.00

Genetic analysis by conventional methods is a time-consuming, manually intensive, costly procedure. Capillary electrophoresis (CE) has been touted as a high-speed, low-cost alternative to slabgel electrophoresis for genotyping, PCR analysis, restriction fragment digest analysis, mutation screening, and DNA sequencing. Irreproducibility and the lack of integrated, multiple-capillary instruments are the current reality. Available automation has been confined to loading and separation in single-capillary instruments. Total analysis time has not improved significantly due to slow sample preparation tasks. Furthermore, as a consequence of the large volumes required for reliable robotic sample loading, CE has not lowered the cost of genetic analyses. These problems have severely limited the acceptance of CE in the molecular biology laboratory. This paper describes a key step forward in correcting this situation, full automation of capillary genetic analysis using a fluidic sample preparation, processing and analysis strategy. We first described this methodology in February 1994 in an oral presentation.1

© 1997 American Chemical Society

To date, all de novo DNA-sequencing projects have been accomplished using electrophoresis. Currently, no other separation method is capable of single-nucleotide resolution for fragments hundreds of nucleotides in length and novel nonseparationbased methods have not come on-line yet. Full automation of DNA sequencing has yet to be accomplished. Such a device would be invaluable for the Human Genome Project18 and the clinical diagnostic market, e.g., to look at mutations in the inherited breast cancer susceptibility gene, BRCA1.19 Recently, most DNA-sequencing efforts have switched to a technique called cycle sequencing for generating the nested sets of specifically terminated DNA-sequencing products required for analysis.20,21 Cycle sequencing, like the related technique PCR, employs thermal cycling and uses an excess of oligonucleotide primers to provide an increase in signal with cycle number. The signal increase in cycle sequencing is linear with cycle number, whereas for PCR, it is exponential. Cycle sequencing facilitates routine sequencing of templates generated by PCR reactions and can be performed in the same instruments as standard PCR reactions. Thus, automation of sample processing for both PCR and DNA sequencing remains at the core of most serious large-scale genome efforts. Required instrumentation includes template preparation, reaction preparation, thermal cycling, reaction purification, sample loading, and electrophoresis subsystems. Numerous groups have automated the front-end tasks of template and reaction preparation and processing, mostly in 96well microtiter dishes.22-24 These robotic methods, though workable, suffer from reliability issues. Moving parts are always subject to wear and breakage. Pipet seals wear and lack of feedback information on fluid movement can cause unreliable behavior. Furthermore, simply copying manual laboratory procedures with robots may not be the most efficient path to automation of complicated molecular biology protocols. A new concept in automation is needed. Wittwer has described improved instrumentation for performing PCR reactions, an air thermal cycler employing 500 µm i.d., 1000 µm o.d., 10 µL glass capillaries.8 Air cycling provides a dramatic decrease in total cycling time over conventional aluminum block instruments that use polypropylene centrifuge tubes: 15-20 min compared with 1-4 h.25 This instrument also has utility for cycle sequencing.26 Although providing advantages in reaction time, reaction specificity, and simplification of cycling protocols, the capillaries are difficult to seal and open, inhibiting high-throughput or automated use of this technology. An effort (18) Watson, J. D. Science 1990, 248, 44-49. (19) Miki, Y.; Swensen, J.; Shattuck-Eidens, D.; Futreal, P. A.; Harshman, K.; Tavtigian, S.; Liu, Q.; Cochran, C.; Bennett, L. M.; Ding, W.; Bell, R.; Rosenthal, J.; Hussey, C.; Tran, T.; McClure, M.; Frye, C.; Hattier, T.; Phelps, R.; Haugen-Strano, A.; Katcher, H.; Yakumo, K.; Gholami, Z.; Shaffer, D.; Stone, S.; Bayer, S.; Wray, C.; Bogden, R.; Dayananth, P.; Ward, J.; Tonin, P.; Narod, S.; Bristow, P. K.; Norris, F. H.; Helvering, L.; Morrison, P.; Rosteck, P.; Lai, M.; Barrett, J. C.; Lewis, C.; Neuhausen, S.; Cannon-Albright, L.; Goldgar, D.; Wiseman, R.; Kamb, A.; Skolnick, M. Science 1994, 266, 66-71. (20) Murray, V. Nucleic Acids Res. 1989, 17, 8889. (21) Carothers, A. M.; Urlaub, G.; Mucha, J.; Grunberger, D.; Chasin, L. A. BioTechniques 1989, 7, 494-499. (22) Mardis, E. R.; Roe, B. A. BioTechniques 1989, 7, 840-850. (23) Wilson, R. K.; Yuen, A. S.; Clark, S. M.; Arakelian, P.; Hood, L. E. BioTechniques 1988, 6, 776-787. (24) DeAngelis, M. M.; Wang, D. G.; Hawkins, T. L. Nucleic Acids Res. 1995, 23, 4742-4743. (25) Wittwer, C. T.; Garling, D. J. BioTechniques 1991, 10, 76-83. (26) Swerdlow, H.; Dew-Jager, K. E.; Gesteland, R. BioTechniques 1993, 15, 512519.

to employ piezoelectric filling and automated processing of these capillary tubes has begun.27 Capillary electrophoresis using nonsieving buffers was developed in the early 1980s28,29 and was followed by the use of gelfilled capillaries for analysis of proteins30 and DNA-sequencing reaction products.17 More recently, non-cross-linked polymer-filled capillaries have been employed with great success for PCR and restriction fragment analysis31-33 and now offer equivalent resolution to cross-linked gels for DNA sequencing.34-38 This latter technology allows replacement of the separation matrix after each run. Replaceable gels promise ease of use, more runs per capillary, and a more direct path to automation. Previously, highly viscous matrixes have required specialized hardware for refilling, precluding their use in standard CE instruments, although recently, this barrier has come down.38 Current generation CE instruments automate electrophoresis and load samples, separation buffers, and wash solutions from autosampler vials or syringes. Besides the aforementioned problems with robotic systems, one potential drawback of these systems is the fact that capillary ends are repeatedly exposed to air. This may lead to instability of gel and polymer formulations and capillary coatings. Jorgenson has described a coupled system that allows continuous loading of eluted components from a first dimension liquid chromatography setup onto a second dimension capillary.39 Other automated loading schemes for CE have been described.40-43 Clearly, a system that allowed automated thermal cycling, purification, loading, and electrophoresis would be a major improvement for genetic analysis. Such a system is described here. Our fluidic strategy is based upon the idea that samples can be moved by pumping in small-bore tubes rather than pipetting them from place to place using robots. The technology is inherently simple, leads to more natural automation, and is fast and reliable. Furthermore, we believe that by achieving a better match between sample preparation and analysis, i.e., in miniaturizing and speeding up the fluidic front end, genetic analysis can be made more efficient. Fluidic technology has been used in the past to automate many distinct types of processes, e.g., DNA synthesis, protein sequencing, cell sorting, and blood gas analysis. The system described here is analogous to a flow injection analysis (FIA) instrument, with a thermal cycler as the stopped-flow (27) Meldrum, D. R. IEEE Eng. Med. Biol. 1995, (July/August), 443-448. (28) Jorgenson, J. W.; Lukacs, K. D. Anal. Chem. 1981, 53, 1298-1302. (29) Mikkers, F. E. P.; Everaerts, F. M.; Verheggen, T. P. E. M. J. Chromatogr. 1979, 169, 11-20. (30) Cohen, A. S.; Paulus, A.; Karger, B. L. Chromatographia 1987, 24, 15-24. (31) Heiger, D. N.; Cohen, A. S.; Karger, B. L. J. Chromatogr. 1990, 516, 3348. (32) Chang, H.-T.; Yeung, E. S. J. Chromatogr. B 1995, 669, 113-123. (33) Schwartz, H. E.; Ulfelder, K.; Sunzeri, F. J.; Busch, M. P.; Brownlee, R. G. J. Chromatogr. 1991, 559, 267-283. (34) Carrilho, E.; Ruiz-Martinez, M. C.; Berka, J.; Smirnov, I.; Goetzinger, W.; Miller, A. W.; Brady, D.; Karger, B. L. Anal. Chem. 1996, 68, 3305-3313. (35) Zhang, J. Z.; Fang, Y.; Hou, J. Y.; Ren, H. J.; Jiang, R.; Roos, P.; Dovichi, N. J. Anal. Chem. 1995, 67, 4589-4593. (36) Bashkin, J.; Marsh, M.; Barker, D.; Johnston, R. Appl. Theor. Electrophor. 1996, 6, 23-28. (37) Fung, E. N.; Yeung, E. S. Anal. Chem. 1995, 67, 1913-1919. (38) Menchen, S.; Johnson, B. F.; Madabhushi, R.; Winnik, M. Proc. SPIE 1996, 2680, 294-303. (39) Larmann, J. P., Jr.; Lemmo, A. V.; Moore, A. W., Jr.; Jorgenson, J. W. Electrophoresis 1993, 14, 439-447. (40) Deml, M.; Foret, F.; Bocek, P. J. Chromatogr. 1985, 320, 159-165. (41) Tsuda, T.; Mizuno, T.; Akiyama, J. Anal. Chem. 1987, 59, 799-800. (42) Andresen, B. D. U.S. Patent 4,708,782, 1987. (43) Zare, R. N.; Tsuda, T. U.S. Patent 5,141,621, 1992.

Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

849

Figure 1. System schematic. The thermal cycler, HPLC, valve 2, tee and capillary electrophoresis subsystems are depicted. In the legend associated with valve 2, “Heart cut” and “Run column” refer to the “Load” and “Inject” positions of this HPLC injection valve; the “Heart cut” notation conveys the idea of sampling the center portion of a peak. All digital control electronics and valve actuators are omitted for clarity. W ) waste vessel. See text for full description.

reaction chamber and a CE subsystem as the detector. The fluidic paradigm is well established in analytical chemistry, if not previously in genetic analysis. EXPERIMENTAL SECTION Instrument Overview. The basic schematic for our integrated instrument is shown in Figure 1. All the steps described below are automated. PCR using a fluorescent dye-labeled primer is performed in the injection loop of an HPLC valve. This loop is located inside an air thermal cycler. After cycling, the sample is desalted and purified by gel filtration chromatography and run through a tee, past the capillary. The waste chamber for HPLC doubles as the negative buffer chamber for electrophoresis. By application of an electric field while the primer and product transit the tee, these molecules are loaded continuously onto the polymerfilled electrophoresis capillary. Electrophoresis is monitored using an on-column laser-induced fluorescence detector. After the run, capillaries are reconditioned by application of pressure to the positive buffer chamber, which contains a supply of clean polymer matrix. Materials and Methods. PCR Reactions. PCR mixes (125 µL, two injections) are prepared using the protocol described for capillary air thermal cycling, with bovine serum albumin (BSA) added to avoid denaturation of the polymerase, while in contact with the large surface area of the tubing.8 A 12.5 µL sample of 20 pg/µL M13mp18 DNA template (a gift from Carl Fuller at USB/ Amersham, Cleveland, OH), 12.5 µL of each primer at 5 µM, 12.5 µL of a 2 mM mixture of all four deoxynucleotide triphosphates (ultrapure; Pharmacia, Piscataway, NJ), 12.5 µL of 10× reaction 850

Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

buffer (500 mM Tris-HCl, pH 8.3, 20 mM MgCl2, 2.5 mg/mL BSA, molecular biology grade; Boehringer Mannheim, Indianapolis, IN), 11.5 µL of Taq dilution buffer (10 mM Tris-HCl, pH 8.3, 2.5 mg/ mL BSA), and 1 µL of enzyme (AmpliTaq DNA polymerase, 5 units/µL; Perkin-Elmer, Norwalk, CT) are combined with 50 µL of H2O. One primer (21-mer) is a modified M13 universal primer, containing three extra nucleotides at the 5′ end, CGTTGTAAAACGACGGCCAGT, and labeled with the TAMRA dye44 according to Applied Biosystems’ protocol.45 The unlabeled primer (20-mer) has the sequence ATACGCAAACCGCCTCTCCC, producing a PCR product 303 base pairs in length. The temperature-cycling protocol on the air thermal cycler (Model 1605; Idaho Technology, Idaho Falls, ID) is set as follows: denaturation 0 s at 92 °C, annealing 0 s at 62 °C, elongation 0 s at 74 °C, 25 cycles, slope of 6, followed by a hold of 30 s at 74 °C to assure all the products had annealed to their double-stranded form. The complete cycling protocol takes ∼8 min to complete. PCR Separations. PCR reactions are injected by syringe into valve 1 (Figure 1), an HPLC injection valve, in the “Load” position (Model 9125; Rheodyne, Cotati, CA). The loop ports (1 and 4) of the valve are fitted with 0.022 in. i.d., 0.034 in. o.d. thin-wall Teflon tubing (STT-24; Small Parts, Miami Lakes, FL) using short lengths of Teflon (0.042 in. i.d., 0.066 in. o.d., no. 6417-41; Cole-Parmer, Niles, IL) and one-piece graphite finger-tight fittings (no. 32346; Alltech Associates, Deerfield, IL). The total length/volume of tubing used in the loop is 11 cm/27 µL; the effective length/ volume of tubing not blocked from thermal cycling by the fittings is 7 cm/17 µL. An injection volume of 60 µL of PCR reaction is used to ensure reproducible filling of the loop. The valve is rotated 30° to seal all ports and thermal cycling begins. Sealing the loop is essential to avoid bubbles and evaporation of the sample; in the standard Idaho Technology protocol, glass tubes are flame sealed before thermal cycling. After cycling, valve 1 is returned to the “Load” position and the pump (Model 110A; Beckman, Fullerton, CA) is started at 1.5 mL/min. A low-salt buffer (2 mM Tris-HCl, pH 8.0, 1 mM EDTA) is washed through the column (HEMA-BIO 100, 7.5 mm i.d. × 300 mm, 10 µm particle size; Tessek, Praha, Czech Republic), which is protected with a guard column (HEMA-SEC BIO 100, 4.6 mm i.d. × 10 mm, 10 µm; Alltech) and 2 µm frit (A115; Upchurch Scientific, Oak Harbor, WA). After 1 min, valve 1 is switched to “Inject” and the sample runs onto the column. Valve 2 (Model V451; Upchurch Scientific) is initially in the “Run column” position, sending the column effluent to waste. After 3 min of the chromatographic separation, valve 2 is switched to the “Heart cut” position (in chromatography, a heart cut refers to sampling the center portion of a peak). In the “Heart cut” position, the column eluate is passed through the tee (0.020 in. i.d, Model P727; Upchurch Scientific) and on to the negative buffer chamber. Simultaneously, the CE high-voltage power supply (Model CZE1000 PN30, operated in positive highvoltage mode; Spellman, Plainview, NY) is turned on for the remainder of the run. The primer and product DNA peaks coelute at 3.5 min in a peak ∼15 s (375 µL) full width at half-maximum (fwhm), the large unincorporated nucleotide peak elutes at 4.3 min, and the buffer salts elute at ∼10 min. At 4 min, valve 2 is switched again to the “Run column” position. After waiting 10 s for sample to migrate down the capillary, valve 3, a solenoid(44) Lee, L. G.; Connell, C. R.; Woo, S. L.; Cheng, R. D.; McArdle, B. F.; Fuller, C. W.; Halloran, N. D.; Wilson, R. K. Nucleic Acids Res. 1992, 20, 24712483. (45) Giusti, W. G.; Adriano, T. PCR Methods Appl. 1993, 2, 223-227.

actuated three-way valve (ETO-3-12; Clippard, Cincinnati, OH) is opened for 20 s, putting the TBE chase reservoir at 100 psi pressure. By adjusting the length of the tubing connecting the TBE chase reservoir to valve 2 (0.007 in. i.d., length ∼45 cm), the tee and connecting tubing are flushed with the 0.5× TBE running buffer (1× ) 89 mM Tris-borate, pH 7.0, 2 mM EDTA) at 2 mL/min. The high salt flush is essential for efficient electrophoresis; leaving the capillary end immersed in a low-salt buffer causes broad peaks and poor resolution. The HPLC pump remains on during the rest of the run to allow the column to be completely washed. Not shown in Figure 1 is an ultraviolet absorbance detector (Model 229 with a type 11, 254 nm optical unit; Isco, Lincoln, NE) attached to valve 2, port 4. This detector is useful for troubleshooting HPLC problems like leaky fittings and also allows periodic checking of heart cut times. However, HPLC problems are rare, and the heart cut times have been constant for many years of operating this instrument. The negative buffer chamber is fitted with a negative electrode and a constant-level device, to match the height of fluid in the positive buffer chamber. All tubing is 0.010 in. PEEK or Teflon except the tubing connecting the tee and the negative buffer chamber which has an inner diameter of 0.030 in. to reduce its electrical and hydrodynamic resistance. All tubing lengths should be kept as short as possible to reduce band-broadening. A fused-silica capillary (75 µm i.d., 375 µm o.d., 25 cm effective length, 75 cm total length; Polymicro Technology, Phoenix, AZ) is tightened into the tee using a peek sleeve (0.020 in. i.d., 1/16 in. o.d., no. F230; Upchurch Scientific) and a 375 µm o.d. capillary placed through the tee as a temporary guide. Thus, the separation capillary extends ∼125 µm into the fluid path from the wall of the tee. Capillaries are modified with the standard Hjerte´n coating to eliminate wall effects.46 Capillary electrophoresis, at 300 V/cm for 10 min, is performed with a very low viscosity matrix. The low-viscosity matrix we employ represents a compromise between reasonable PCR primer/product separation and easy replacement of the buffer at low pressure. The prototype system is compatible with any capillary or buffer of reasonable viscosity. Linear polyacrylamide (LPA) is made from a degassed solution of 10% monomer in 0.1× TBE by the addition of 1.6% N,N,N′,N′tetramethylethylenediamine and 1.6% ammonium persulfate (all electrophoresis purity; Bio-Rad, Hercules, CA). The LPA is dialyzed extensively against water to eliminate excess catalysis reagents and TBE, avoiding any prerunning of the capillary. The LPA is then diluted to 4% nominally in 0.5× TBE. The plexiglass positive buffer chamber, which is fitted with an electrode and a pressure supply line, is filled with this buffer; the fluid level is set by eye and remains constant for many runs. The buffer remains uncontaminated due to the large length of capillary after the detection window. Buffer is replaced at the beginning of each run by opening valve 4 for 3.5 min; this applies 100 psi to the chamber; the only outlet is through the capillary to the negative buffer chamber. During electrophoresis, the positive buffer chamber is vented to atmosphere by valve 4. Detection. Electrophoresis bands are visualized using a simple single-channel, on-column fluorescence detector, essentially as described.47 An inexpensive green (543 nm) helium-neon laser (750 µW; Melles-Griot, Carlsbad, CA) is focused onto the capillary (46) Hjerte´n, S. J. Chromatogr. 1985, 347, 191-198. (47) Swerdlow, H.; Zhang, J. Z.; Chen, D. Y.; Harke, H. R.; Grey, R.; Wu, S.; Dovichi, N. J.; Fuller, C. Anal. Chem. 1991, 63, 2835-2841.

to excite the TAMRA dye (excitation maximum 559 nm, emission maximum 575 nm, data not shown). Light collected by a 20×, 0.4 NA microscope objective (Newport, Irvine, CA) is filtered both spatially using a 1.6 mm diameter pinhole and spectrally using a band-pass filter (580DF10 580 nm center wavelength, 10 nm bandwidth; Omega Optical, Brattleboro, VT) and a long-pass filter (OG 570; Omega Optical) to eliminate scattered laser light. Detection is achieved with a photomultiplier tube (R1477 operated at -900 V; Hamamatsu, Bridgewater, NJ); the current signal is converted to a voltage, analog filtered at 5.5 Hz, then digitized at 10 Hz, and collected by a personal computer. DNA Sequencing Reactions. Cycle-sequencing reactions (60 µL) using dideoxy-ATP and TAMRA dye-labeled universal primer (Perkin-Elmer, Applied Biosystems Division, Foster City, CA) are prepared as described previously.26 Injections are done exactly as described above for PCR reactions. Samples are thermal cycled using conditions identical to those described previously,26 except that, after cycling, reactions are held in the loop at 90 °C for 1 min to denature the fragments, followed by 5 s at 70 °C. Probably due to the rapid dilution of single-stranded DNA onto the chromatography column, no further denaturation is required to achieve excellent resolution. The complete cycling protocol takes ∼25 min. DNA Sequencing Separations. The instrument used to purify and analyze DNA cycle sequencing reactions is identical to that described above for PCR reactions. A few minor changes are made to the previous protocols for this series of experiments. The capillary employed is coated by the method of Hjerte´n46 and filled with 5% LPA, 7 M urea in 1× TBE polymerized in situ according to a published method.35 The capillary is run with 1× TBE in the positive buffer chamber and the TBE chase reservoir (Figure 1). No replacement of the polymer in the capillary is attempted; capillaries are reused four times and then discarded. Electrophoresis is at 250 V/cm for 1 h; the HPLC pump is shut off after 12.5 min. The photomultiplier tube voltage is increased to -1100 V, and the data collection rate is 2 Hz. Automation and Timing. Automation of the system is achieved on an IBM PC clone operating under MS-DOS. A digital I/O board (CYDIO24H) connected to a relay mounting rack (CYSSR24) fitted with standard solid-state relays (CYOAC5 and CYODC5) is used to control all the hardware (Cyber Research, Branford, CT). The sequencing of all events and collection of data is handled by Labtech Notebook version 6.1.2 (Labtech, Wilmington, MA) using an open-loop control sequence. Valves 1 and 2 are turned by an electronic valve actuator (Model V1000; Thar Designs, Pittsburgh, PA) controlled using TTL logic. Valves 3 and 4 are controlled using a 12 V supply and solid-state relays. The Idaho Technology air thermal cycler was modified by the company to allow the instrument to be turned on and off with an external TTL signal. The HPLC pump, laser, capillary, and PMT power supplies are all controlled by 110 V solid-state relays from the digital I/O board. At present, the only manual operations are filling the reaction loop from a syringe and washing the loop after a run. All other events are handled by the computer after a single keystroke. Data Analysis. The data collected by Labtech Notebook are stored in ASCII format and imported into the Quattro Pro 2.0 spreadsheet program (Borland International, Scotts Valley, CA). A macro written for Quattro Pro determined the primer and product peak locations and extracted the data in a region around the product peak for integration. Integration was performed using Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

851

a Gaussian regression algorithm to determine peak height, peak area, and theoretical plates. The product peak data consistently fit a Gaussian profile. Safety Considerations. High voltage applied to any part of a connected fluid system poses a serious risk of shock and damage to equipment. For safety purposes, the positive buffer chamber, connected to the high-voltage side of the CE power supply, is encased in an interlocked plastic box. The CE power supply can only be turned on by the computer and only when the box is closed and its power switch is on. The negative buffer chamber and return of the CE power supply are grounded to the optical table. The optical table is connected directly and securely to a dedicated ground in the main electrical supply box. All tubing is made of plastic as are the column, the tee, the Upchurch valve, and the wetted components of the Rheodyne valve. All fluid components, to the extent possible, are further electrically isolated from ground and the grounded optical table using plexiglass brackets. The noncapillary fluid path is fixed at a low voltage by using a wide-bore tubing connection between the tee and the negative buffer chamber (see above). Care must be taken to avoid bubbles in this tubing section as these will encourage the high voltage to arc to alternative places in the fluid path. RESULTS AND DISCUSSION Design Considerations. The Idaho Technology air thermal cycler is employed because of its excellent speed and ease of adaptability to fluidics; we mounted an HPLC injection valve (valve 1) so its loop projects into the thermal cycler. The thermal kinetics of this reaction loop need to be matched to the instrument. We placed a microthermocouple probe (010-J-I600-H-GND-6"IMTRAN-24"LW-MP; Idaho Labs, Idaho Falls, ID) attached to a homemade high-speed digital sampling thermometer (100 ms response time) in the liquid inside various tubing to accomplish this. A match was found with 0.022 in. i.d, 0.034 in. o.d. Teflon tubing. To turn the injection valve, we use a Thar Designs actuator, which is uniquely capable of 30° rotations, allowing all ports on the valve to be sealed. Together these components allow a sample to be automatically loaded, sealed, thermally cycled, and injected onto a column without fluid loss due to evaporation or bubble formation. Standard DNA reactions, both PCR and DNA-sequencing samples, have been shown to benefit from purification before electrophoresis on capillaries and slab gels.16,31,33,48-50 For example, stability of capillary gels is adversely affected by the presence of template DNA remaining in the reaction.48 Signal strength for capillary electrophoresis is diminished by the presence of ionic species in the sample matrix.33 For these reasons, purifying PCR or DNA-sequencing reactions before electrophoresis in a fluidic instrument is advantageous. For PCR reactions under our conditions,25 reconstruction experiments have shown that the offending substances, as far as signal strength is concerned, are buffer salt and deoxynucleotide triphosphates (dNTPs). Elimination of these ingredients increases sample loading efficiency. While buffer components and salt are easy to separate from DNA, dNTPs offer far more of a challenge. Nucleotide triphosphates possess a charge of ∼-4 above neutral (48) Swerdlow, H.; Dew-Jager, K. E.; Brady, K.; Grey, R.; Dovichi, N. J.; Gesteland, R. Electrophoresis 1992, 13, 475-483. (49) Swerdlow, H.; Dew-Jager, K.; Gesteland, R. F. BioTechniques 1994, 16, 684693. (50) Tong, X.; Smith, L. M. Anal. Chem. 1992, 64, 2672-2677.

852

Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

pH. Most commercial resins have a negative charge on the surface of their beads. For example, polyacrylamide-based matrixes for gel filtration suffer from hydrolysis of amide side groups to carboxylic acids, with subsequent deprotonation to form negatively charged side groups. In gel filtration, this excludes the dNTPs from the pores of the beads, causing aberrant mobility; the dNTPs elute as if they were higher molecular weight DNA. This phenomenon can be corrected by a high-salt elution buffer, but for our purpose this only exacerbates the problem. By trial and error, we discovered a hydroxyethyl methacrylate-based resin, HEMA-BIO 100, that could separate dNTPs from PCR primers and products. The column is compatible with a very low-salt buffer (2 mM Tris-HCl, pH 8.0, 1 mM EDTA). The concentration of buffer is critical; lower salt ruins the chromatographic separation between dNTPs and the primer/product DNA and higher salt reduces signal. The elution is isocratic and thus highly reliable. The cleanup is rapid; primer and product coelute in 3.5 min at 1.5 mL/min. Back pressure is 500 psi. A slower flow rate does not improve the system and increases total analysis time; a faster flow rate taxes some of the fittings. The primer/product peak elutes in a 15 s wide peak (fwhm). This peak width corresponds to a 375 µL volume or a dilution factor on the column of 14:1. Even considering this dilution, the signal-to-noise ratio is excellent (see below); efficient loading is a consequence of the low total ionic strength of the eluted fractions. At the proper time in the chromatography run (between 3 and 4 min), valve 2 directs the primer/product peak through the tee; before and after this heart cut, the column output is directed to waste. The design of the tee junction is novel in its simplicity, although similar designs have been proposed.39,40,43 The capillary is positioned in the flow path of the tee, providing a fluidic and electrical connection within the larger bore. The tee outlet is connected to the CE negative buffer chamber. The only current path for anions is through the tee and up through the capillary. This forces anions to be loaded onto the capillary electrokinetically as they pass the tee junction. No significant hydrodynamic loading (splitting) occurs; material is loaded onto the electrophoresis capillary only if a voltage is present while the components pass through the tee. For an efficient electrokinetic loading, a saltfree sample matrix is required as described above, but additionally, to maintain resolution, the injection time must be short. Stacking of the DNA at the injection end of the capillary assists in this regard. Stacking can be attributed to two phenomena. First, the sample matrix has a lower conductivity than the polymercontaining buffer. This conductivity disparity produces a higher electric field across the sample, and molecules move faster through the sample matrix than through the separation matrix. Second, the polymer impedes the migration of DNA molecules, again causing them to stack at the injection end.51 Experience tells us that a 10-30 s injection time at the electrophoresis running voltage is both adequate for signal strength and sufficiently short to avoid band-broadening. Under our HPLC running conditions, the chromatographic peak has a 15 s fwhm. The spatial extent of the loaded sample arising from this peak will be equivalent to a standard 15 s CE loading. The integral of this chromatographic peak gives the amount of an equivalent standard CE loading with the same product of concentration and time (and the same total ionic strength of the sample). After sample loading, valve 2 allows (51) Cohen, A. S.; Najarian, D. R.; Paulus, A.; Guttman.A; Smith, J. A.; Karger, B. L. Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 9660-9663.

a high-salt buffer to be chased through the tee and connecting tubing. Without this chase, the injection end of the capillary stays immersed in the low-salt buffer, resulting in poor resolution. This tee injection scheme allows efficient sample loading with no moving parts and without disturbing the column or capillary. More important, it provides a simple interface for attachment of upstream fluidic components, like PCR and DNA-sequencing reaction modules. The electrophoresis capillary (75 µm i.d., 375 µm o.d., 25 cm effective length, 75 cm total length) is coated to eliminate wall effects with LPA and a bifunctional silane reagent according to the method of Hjerte´n46 and filled with 4% LPA buffer. The PCR analyses described here require only the ability to distinguish the presence or absence of a product fragment of the correct size. For this reason, we use a large excess of catalyst and initiator (16 times conventional concentrations) in our LPA polymerizations to reduce viscosity, simplifying the pressure manifolds and increasing separation speed at the expense of resolution. The capillary length is made much greater than the effective length; this would only be a problem if the CE power supply voltage were limiting. Thus, analytes never reach the positive buffer chamber, which contains a supply of clean polymer buffer. Refilling of the capillary is accomplished by application of relatively low pressure (100 psi) to the chamber via a solenoid valve. After this step, the capillary is ready for analysis of a new sample. Although originally tested by manually controlling all the pumps, valves, etc. the system was designed for ease of automation. Timing sequences for all the components are controlled through a digital interface board by a personal computer. Valves are turned by digitally controlled actuators. The electrophoresis and photomultiplier tube power supplies and the pump and cycler are also controlled by the computer. The pressure lines to the TBE chase and positive buffer chamber are switched by computercontrolled solenoid valves. Automation of the instrument provides precise timing of all aspects of the cycling, purification, and separation, leading to reproducibility of the analyses. Performance. Automated PCR reaction and analysis are performed on the prototype system and shown in Figure 2A. This run was complete in ∼20 min, including thermal cycling (8 min), purification (4 min), and electrophoresis (8 min). Baseline noise is very low for the entire run. Spikes (narrow noise peaks) due to particulates are eliminated by the HPLC column, and spikes due to bubbles are eliminated by both the column and the closed nature of the tee loading strategy. These problems are frequently seen in conventional capillary electrophoresis runs, though rarely discussed in print. Since the predominant sources of noise are removed, the signal-to-noise ratio (peak height divided by the standard deviation of the baseline) is very high, e.g., 1600:1 for the 303 base-pair product peak in Figure 2A. This is more than adequate for most applications of this technology. Any automated PCR system must perform postreaction sterilization. Sterilization in this context means elimination or inactivation of template DNA and all products of the previous reaction. In diagnostics, this step is required to avoid false positives, i.e., in the absence of added template.52,53 We treat the reaction passages with either HCl or NaOH at 94 °C for 3 min, followed by an extensive H2O rinse. This wash protocol either (52) Cimino, G. D.; Metchette, K. C.; Tessman, J. W.; Hearst, J. E.; Isaacs, S. T. Nucleic Acids Res. 1991, 19, 99-107. (53) Longo, M. C.; Berninger, M. S.; Hartley, J. L. Gene 1990, 93, 125-128.

A

B

Figure 2. Electropherograms of PCR runs on the prototype system. (A) A single run is depicted. x axis: CE retention time in seconds. Time is measured from the injection onto the chromatographic column; however, time zero is taken to be the expected time of loading of the primer/product peak onto the capillary. Data have been offset by 0.2 unit in the y dimension to make the baseline easily visible; note the complete absence of spikes in the data. The 21-nucleotide primer is off-scale in a very narrow peak at 417 s. The early broad shoulder is an unexplained artifact of the fluidic loading; one possible explanation is minor species in the primer, but another is chromatographic heading. A primer-dimer peak runs just slower than the primer at 421 s. The 303 base-pair PCR product peak runs at 459 s. (B) Product peaks from four runs performed on the system during the reproducibility experiment described in the text; runs 12 (Figure 2A), 18, 24, and 30 of 34 total runs are depicted. The four runs are offset by 1 unit (V) from the previous run in the y dimension for clarity; run 12 is at the bottom, run 30 at the top. The retention times of the four product peaks are 459, 450, 449, and 443, respectively, bottom to top. Theoretical plates (millions) for the four product peaks are 1.98, 1.41, 1.24, and 1.13, respectively. The peak areas (millivolt seconds) are 600, 664, 656, and 634, respectively.

removes all contaminating DNA or renders it unfit for amplification (data not shown). A second issue is the reproducibility of the instrument signal for repetitive injections over time. We expect the peak area to be constant when PCR samples made identically are injected; however, this is not always the case. By injection of externally cycled samples, we have shown that most of the irreproducibility can be traced to reusing the reaction loop. Interestingly, this progressive decrease in product peak area with injection can also be corrected by washing the loop with 1 N NaOH at 94 °C for 3 min. We presume that NaOH acts to hydrolyze adsorbed proteins, which either inhibit or bind the polymerase, but it may also affect the surface of the Teflon tubing Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

853

itself. Having addressed these two concerns with a single procedure, the same reaction loop can be used repeatedly for PCR amplifications. Consecutive injections (129) were done to assess the reproducibility of our prototype instrument. The experiment was run on 16 days over a 45-day period. Identically made samples were injected repeatedly, using two different loop wash protocols, i.e., washing the loop after every run (34 injections) or after every fifth run (95 injections) with 1 N NaOH at 94 °C for 3 min. Figure 2B depicts four runs from this experiment, runs 12, 18, 24, and 30, during which time (3 days) the loop was washed after every run. The retention times of the product peaks were quite reproducible for the runs shown; the coefficient of variation (CV ) 100 times the standard deviation divided by the mean) was 1.2%. For the entire experiment, the CV for the product peaks was 2.0% (n ) 129). The variation in retention times includes a contribution from both the chromatography (arrival time of the primer/product peak at the tee) and the CE (arrival time of the product peak at the detector), because time is measured from injection onto the column. This variation is small, considering that reactions were run over many weeks on the same capillary (coatings degrade) and that neither column nor capillary temperature was controlled in these experiments (it is widely accepted that viscosity and electrophoretic mobility vary 2%/°C54). Product peaks were sharp, averaging 1.0 s fwhm and 1.1 million theoretical plates for the entire experiment, although these numbers were not very reproducible; the CV was 23% for the data in Figure 2B and 31% for the entire experiment. Peak area reproducibility can be tightly controlled only by washing the reaction tubing every run; the CV for the four runs depicted in Figure 2B was 3.9%, and for all 34 injections was 9.0%. Washing every fifth run gives no better than a 24% CV for peak areas (n ) 95). The variation in peak areas includes a major contribution from the PCR reaction itself and some instrumental error, e.g., sample loading efficiency, detector drift, etc. With proper washing, therefore, the same reaction loop can be used for hundreds of runs. The washing step is not automated at present, and further attempts to improve the peak area precision have been unsuccessful. Like the reaction loop, the capillary column is reusable when the polymer buffer is replaced at the beginning of each run. Typically we can run hundreds of reactions on each capillary. Our prototype PCR analysis instrument was modified to perform cycle-sequencing reactions, fragment purification, sample loading, electrophoresis, and detection. The capillary was coated with LPA using the same method as for PCR separations, but was filled with a 5% LPA, 7 M urea, 1× TBE buffer, polymerized in situ.35 The positive buffer chamber and TBE chase reservoir contained 1× TBE. M13mp18 single-stranded DNA was used as the template in a cycle-sequencing reaction along with TAMRA dye-labeled universal primer and dideoxy-ATP.26 The instrument was run fully automated after injection of the cycle-sequencing reaction mix into the machine. Electrophoretic run time was increased to 1 h at an electric field of 250 V/cm. The entire process requires only 90 min for completion. A representative run is shown in Figure 3. Comparison between the trace pattern and the known sequence shows the data to be interpretable beyond 600 nucleotides. A signal-to-noise ratio of 90 was achieved for peaks near 100 nucleotides in length. This signal-to-noise ratio compares favorably with the value implied (54) Knox, J. H. Chromatographia 1988, 26, 329-337.

854 Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

A

B

Figure 3. Fully automated capillary cycle sequencing of M13mp18 DNA. x axis: CE retention time in minutes; time is measured from the injection onto the chromatographic column, however, time zero is taken to be the expected time of loading of the DNA fragments onto the capillary. y axis: signal in arbitrary fluorescent units. A dideoxy-ATP-terminated ladder was generated using a TAMRAlabeled M13 universal primer. Samples were cycled, purified, loaded, and run automatically on a polymer-filled capillary in the fluidic prototype instrument. The 75 µm i.d., 25 cm. effective length capillary was filled with 5%T, 0%C linear polyacrylamide and electrophoresed at 250 V/cm. The peaks correspond to “A”s in the known sequence; numbering on the charts refers to total nucleotide length for “A” peaks near the ends of the graphs, however, 18 is the length of the primer and 626 is the approximate length at which the baseline is lost. (A) Entire electropherogram. (B) Detail of (A). The data of (A) are shown expanded from 19 to 23 min, including “A” peaks 117-166 nucleotides in length. The average signal-to-noise ratio is 90 in this region. Near-baseline resolution between consecutive “A” residues can be seen, e.g., in the two triplets (AAA) at the far right.

in one of our previous reports, the data having been obtained on a nonfluidic capillary gel system with a similar detector (we reported that a 100-mer peak had 130 000 molecules and the limit of detection was 6000 molecules with a signal-to-noise ratio of 3;

thus, the signal-to-noise ratio is 65 at 100 nucleotides17). This data quality is adequate for correct base-calling, but should be improved upon for accurate long four-color reads. Resolution is excellent for this noncross-linked polymer-filled capillary; a closeup of the electropherogram between 117 and 166 nucleotides is shown in Figure 3B. Adequate resolution for base-calling can be seen for adjacent “A”s in this region and beyond, although running the capillary at room temperature undoubtedly contributes to compression. These sequencing results are preliminary because we have not done four-color runs.47 We can perform four consecutive runs on these capillaries with no loss of resolution. With some optimization and an improved sample cleanup protocol, we might be able to increase the number of serial runs per capillary. The polymer formulation we used for these runs is too viscous to be replaced with the 100 psi pump we currently have installed. Recently, lower viscosity formulations of capillary DNA sequencing buffers have been reported.34,36,38 These buffers are also capable of longer reads without increasing analysis times. Using one of these new buffers, we will replace the polymer solution after each sequencing run, likely generating many runs per capillary with increased reproducibility. CONCLUSIONS Capillary electrophoresis has made significant progress toward becoming an indispensable technology in the analytical chemistry laboratory. However, in order for CE to be accepted by molecular biologists, some major changes are required. Burning of capillary windows, coating to eliminate wall effects, trimming of capillary ends, and preparation of stable buffers will all need to be done commercially and at a reasonable price. Clogging and degeneration of capillaries will not be tolerated by end-users, especially when expensive arrays become the norm. Separation buffer replacement and sample loading will need to be automated in a foolproof fashion. A better match between sample preparation volume and the amount used for an analysis is also required to lower costs. While traditional DNA-sequencing reactions are performed in 5-10 µL and PCR reactions in 25-100 µL volumes, CE requires nanoliter loadings to avoid overloading and bandbroadening. Similarly, short PCR separations (10 min) are of limited utility when current generation PCR machines typically require 1-2 h for thermal cycling. Furthermore, the purification of CE samples after PCR or DNA-sequencing reactions has been tedious and difficult to automate.31,48 The desire to prepare and analyze small-volume reactions automatically led us to ask if a capillary could be used as a reaction vessel as well as the separation channel. Such an instrument has been constructed using a coupled fluidic approach. The diagnostic version of this instrument can perform PCR reactions in smallbore tubes, purify the product fragments, and load them directly onto a separation capillary. The system is extremely fast, requiring only 20 min for PCR reaction and analysis. The automated fluidics avoid manual manipulations, sample loading is performed in-line, and the closed system design is easily amenable to postreaction sterilization. The system is fully regenerated during each cycle; it is ready for a new sample when (55) Harrison, D. J.; Fluri, K.; Seiler, K.; Fan, Z.; Effenhauser, C. S.; Manz, A. Science 1993, 261, 895-897. (56) Jacobson, S. C.; Hergenro¨der, R.; Koutny, L. B.; Ramsey, J. M. Anal. Chem. 1994, 66, 1114-1118.

the previous one is finished. Sensible automation will increase the reliability and reproducibility of DNA analysis and make it available to the clinical laboratory. The system promises lower cost when reaction volume is reduced below the current level. We expect this volume reduction to be feasible since microbore or capillary LC will reduce the dilution of the sample on the column. Signal-to-noise ratios are excellent, and bubble and particulate spikes are eliminated by the system design. Thermal cycling and separation of single-lane cycle-sequencing reactions have also been accomplished in this prototype in 90 min. Micromachining has attracted much attention recently as an alternative for integrated genetic and chemical analysis systems.55,56 A common theme in these reports is that smaller devices will lead to faster, cheaper, more efficient systems. This is true as long as miniaturization is done sensibly and that individual system components are compatible and matched in terms of both volume and time requirements. The prototype fluidic analysis instrument described here provides a large-scale model for integrating microfabricated components into working systems. A new methodology has been created, employing fluidic sample preparation, processing, and analysis for certain routine molecular biology tasks. With this novel fluidic paradigm comes a challenge to invent new automatable protocols rather than using robots to automate existing ones. Centrifugation, phenol extraction, and ethanol precipitation, for example, can be eliminated by clever modification of existing techniques. The benefits can be enormous, allowing the creation of simple, reliable, inexpensive, easily automated dedicated instruments. We are currently working on improving this prototype, especially the peak area reproducibility. In the future, we will modify this system for bacterial, viral, and genetic disease diagnosis, possibly directly from whole blood; a portable pointof-care instrument for clinical use is envisioned. Another priority is reducing the reaction loop and column diameters to achieve lower cost. Eventually, we hope to miniaturize to the level of total analysis systems on micromachined silicon wafers. To meet the high-throughput needs of the Human Genome Project, we are constructing a multiple-capillary, four-color DNA sequencer, using this unique technology. For dye-primer sequencing, this will entail running four separate reactions and combining them fluidically before the separation column. An alternative approach using dye-terminator chemistry requires only a single reaction chamber and column for each sequencing template. ACKNOWLEDGMENT The authors thank Raymond Gesteland for advice and support. This work was supported in part by a grant from the National Institutes of Health, 5P30 HG00199. This work was also supported in part by an appointment to the Human Genome Distinguished Postdoctoral Fellowship program sponsored by the U.S. Department of Energy, Office of Health and Environmental Research and administered by the Oak Ridge Institute for Science and Education (H.S.). Received for review December 10, 1996.X

October

29,

1996.

Accepted

AC961104O X

Abstract published in Advance ACS Absracts, February 1, 1997.

Analytical Chemistry, Vol. 69, No. 5, March 1, 1997

855