G-Quadruplex-Catalyzed Aerobic Oxidation of Thiols to

Subscriber access provided by PACE UNIV PLEASANTVILLE

Article

Hemin/G-quadruplex-Catalyzed Aerobic Oxidation of Thiols to Disulfides: Application of the Process for the Development of Sensors, Aptasensors, and for Probing Acetylcholine Esterase Activity Eyal Golub, Ronit Freeman, and Itamar Willner Anal. Chem., Just Accepted Manuscript • Publication Date (Web): 20 Nov 2013 Downloaded from http://pubs.acs.org on December 2, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Hemin/G-quadruplex-Catalyzed Aerobic Oxidation of Thiols to Disulfides: Application of the Process for the Development of Sensors, Aptasensors, and for Probing Acetylcholine Esterase Activity Eyal Golub, Ronit Freeman and Itamar Willner* The Institute of Chemistry The Minerva Center for Complex Biohybrid Systems The Hebrew University of Jerusalem, Jerusalem 91904, Israel AUTHOR INFORMATION Corresponding Author * E-mail: [email protected] Tel: +972-2-6585272 Fax: +972-2-6527715

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

ABSTRACT

This study describes the novel hemin/G-quadruplex DNAzyme-catalyzed aerobic oxidation of thiols to disulfides and the resulting mechanism. The mechanism of the reaction involves the DNAzyme-catalyzed oxidation of thiols to disulfides, and the thiol-mediated autocatalytic generation of H2O2 from oxygen. The coupling of a concomitant H2O2-mediated hemin/G-quadruplex-catalyzed oxidation of Amplex Red to the fluorescent resorufin as a transduction module, provides a fluorescent signal for probing the catalyzed oxidation of the thiol to disulfides, and for probing sensing processes that yield the hemin/G-quadruplex as a functional label. Accordingly, a versatile sensing method for analyzing thiols (L-cysteine, glutathione) using the H2O2-mediated DNAzyme-catalyzed oxidation of Amplex Red to the resorufin was developed. Also, the L-cysteine and Amplex Red system was implemented as an auxiliary fluorescent transduction module for probing recognition events that form the catalytic hemin/G-quadruplex structures. This is exemplified with the development of thrombin aptasensor. The thrombin/thrombin binding aptamer recognition complex binds hemin, and the resulting catalytic complex activates the auxiliary transduction module involving the aerobic oxidation of L-cysteine and the concomitant formation of the fluorescent resorufin. Finally, the hemin/G-quadruplex DNAzyme/Amplex Red system was used to follow the activity of acetylcholine esterase, AChE, and to probe its inhibition. The AChE-catalyzed hydrolysis of acetylthiocholine to the thiol-functionalized thiocholine enabled the probing of the enzymatic activity of AChE through the hemin/G-quadruplex-catalyzed aerobic oxidation of thiocholine to the respective disulfide and the concomitant generation of the fluorescent resorufin product.

Keywords: Fluorescence; Thrombin; Acetylcholine; Inhibitor; L-cysteine; Hemin/G-quadruplex


2

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme1-3 finds growing interest as a catalyst for amplifying sensing events, for driving different biotransformations and as a label to follow DNA machines. The hemin/G-quadruplex DNAzyme complex was found to mimic different enzymatic activities of horseradish peoxidase, including the catalyzed oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), ABTS2-, by H2O2,1,2 the catalyzed generation of chemiluminescence in the presence of H2O2 and luminol,4,5 and the electrocatalyzed reduction of H2O2.6,7 Various G-rich sequences capable of forming Gquadruplex structure with parallel and anti-parallel topologies composed of either double- or triple-layer tetrads were reported8,9 and the complexation of the hemin cofactor to such structures to generate the horseradish peroxidase-mimicking catalysts were examined.10-12 The catalytic activity of the various hemin/G-quadruplexes differed, and it was found to be governed by the specific sequence, the resulting folding topology of the nucleic acids, and the affinity of the hemin cofactor to the resulting G-quadruplex. Also, the folding of G-rich aptamer sequences into G-quadruplexes upon the formation of the aptamer-substrate complexes enabled the incorporation of the hemin into the structures, resulting in catalytically-active DNAzymes that were used for the amplified detection of the aptamer-substrate complexes. Different optical assays based upon the conjugation of hemin/G-quadruplexes to semiconductor quantum dots were developed, resulting in the coupling of their unique biocatalytic and optical properties respectively. For example, the electron-transfer-mediated quenching of quantum dots by the hemin/G-quadruplex complex13 or the chemiluminescence resonance energy transfer (CRET) process generated by the hemin/G-quadruplex-catalyzed oxidation of luminol to the quantum dots, provided general mechanisms to develop different


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

sensing platforms.14-16 Additionally, different amplified sensing platforms have implemented the hemin/G-quadruplex as a catalytic label for the detection of DNA,17,18 for the analysis of aptamer-substrate recognition complexes,19-22 for the detection of metal ions,23,24 and for probing enzymatic reactions.25,26 The hemin/G-quadruplex was also applied as a catalyst for driving biocatalytic transformations.27 The DNAzyme was found to mimic the biocatalytic functions of NADH oxidase, where it catalyzes the oxidation of NADH to NAD+ under aerobic conditions, and the biocatalytic functions of NADH peroxidase, where the DNAzyme catalyzes under anaerobic conditions the oxidation of NADH to NAD+ by H2O2. The resulting catalytic systems were used as regeneration schemes for the NAD+ cofactor. In the present study, we describe a novel catalytic activity of the hemin/G-quadruplex as a DNAzyme for the aerobic oxidation of thiols to disulfides, in the absence of exogenously added H2O2. We demonstrate that the aerobic DNAzyme-catalyzed oxidation of the thiols to their respective disulfides leads to an autocatalytic cycle generating H2O2. The resulting H2O2 product is employed for two distinct H2O2–mediated biocatalytic pathways: (i) The continuous DNAzyme-catalyzed oxidation of the thiol to the disulfide, and (ii) The DNAzyme-catalyzed oxidation of Amplex Red to the fluorescent product, resorufin, acting as a reporter module. These set of reactions allowed us to develop general sensing platforms for analyzing thiols such as L-cysteine and glutathione, to follow aptamer-substrate complexes for the detection of thrombin, and to probe the activity of acetylcholinesterase and its inhibition.

Experimental Section Materilas: Ultrapure water from NANOpure Diamond (Barnstead Int. Inc., Dubuque, IA) was used in all the experiments. Hemin was obtained from Frontier Scientific. Fresh stock solutions


4

Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of hemin were prepared prior to each experiment by dissolving an appropriate amount of hemin in DMSO, with a final concentration of 1 mM. Amplex UltraRed© was purchased from Invitrogen. All other chemicals were obtained from Sigma-Aldrich and were used as received without any further purification. The sequences of the oligonucleotides used in the present study were purchased from IDT: (3) 5' – TTTGGGTAGGGCGGGTTGGG – 3' (8) 5' – CACTGTGGTTGGTGTGGTTGG – 3'

Instruments: Optical absorption measurements UV-vis spectroscopy measurements were carried out using a Shimadzu UV-2401PC spectrophotometer. Fluorescence measurements Real-time fluorescence measurements were performed using a fluorescence spectrophotometer (Cary Eclipse, Varian Inc).

Oxidation of TNB to DTNB by the hemin/G-quadruplex All oligonucleotides were dissolved prior to the experiments in a phosphate buffer, 10 mM, pH = 7.4. TNB, (2), was prepared from DTNB, (1), according to a procedure described in the literature.28 A stock solution of TNB was prepared by dissolving TNB in a HEPES buffer, 10 mM, pH = 7.4. In a typical experiment the G-rich nucleic acid (3), 1 × 10-6 M, was incubated for a time-interval of 30 minutes at 250 C in a HEPES buffer solution, 5 mM, pH = 7.4 containing NaNO3, 200 mM, and KNO3, 20 mM, in the presence of hemin, 1 × 10-6 M. The incubation time-


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 30

interval was selected as the minimum time period required to stabilize the hemin/G-quadruplex. The reaction was initiated by adding TNB to the solution with a final concentration of 5 × 10-5 M.

Oxidation of L-cysteine, (4), to cystine, (5), by the hemin/G-quadruplex In a typical experiment (3), 1 × 10-6 M, was incubated for a time-interval of 30 minutes at 250 C in a HEPES buffer solution, 5 mM, pH = 7.4 containing NaNO3, 200 mM, and KNO3, 20 mM, in the presence of hemin, 1 × 10-6 M, and Amplex Red, (6), 1 × 10-4 M. The reaction was initiated by adding L-cysteine, to the solution with variable final concentrations. The detection limit was calculated using the 3σ method.

Detection of Thrombin In a typical experiment thrombin binding aptamer, TBA, (8), 1 × 10-6 M, was incubated in a HEPES buffer solution, 5 mM, pH = 7.4 containing NaNO3 200 mM and KNO3 20 mM, in the presence of hemin, 1 × 10-6 M, Amplex Red, 1 × 10-4 M, and variable concentrations of thrombin for a time-interval of 3 hours at 250 C. This time-interval is required to stabilize the thrombin/hemin/TBA. The reaction was initiated by adding L-cysteine to the solution with a final concentration of 50 µM. The detection limit was calculated using the 3σ method.

Probing the activity and inhibition of AChE In a typical experiment (3), 1 × 10-6 M, was incubated for 30 minutes at 250 C in a HEPES buffer solution, 5 mM, pH = 7.4 containing NaNO3, 200 mM, and KNO3, 20 mM, in the presence of hemin, 1 × 10-6 M, and Amplex Red, 1 × 10-4 M. The reaction was initiated by


6

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


adding AChE to the solution with variable concentrations and acetylthiocholine, (9), with a final concentration of 1 × 10-4 M. In the inhibition experiments the concentration of AChE remained constant, 5 × 10-8 M, and the inhibitor, (11), was added to the solution with variable final concentrations. The detection limit was calculated using the 3σ method.

Results and Discussions The Ellman's reaction Figure 1, is a versatile process generally used to quantify lowmolecular weight thiols or thiol groups associated with proteins. It involves the reaction of a thiol-functionalyzed component with the disulfide reagent 5,5'-dithiobis-(2-nitrobenzoic acid), DTNB, (1), to yield the exchange reaction and the release of the thiolated molecule 2-nitro-5thiobenzoic acid, TNB, (2), that exhibits a strong absorption band in the visible region with ε = 14150 M-1 at λmax= 412 nm.29,30 The spectral changes associated with this reaction provide a quantitative measure for the content of the thiol. We have implemented the spectral properties of DTNB, (1), and TNB, (2), to probe the hemin/G-quadruplex-catalyzed oxidation of the thiolated molecule TNB to the disulfide DTNB. Figure 2(A) depicts the time-dependent spectral changes upon interacting TNB, (2), with the hemin/G-quadruplex DNAzyme under aerobic conditions. The absorbance band of TNB at λ = 412 nm decreases while the absorbance band of DTNB at λ = 324 nm increases with a characteristic isosbestic point at λ = 358 nm, implying that the hemin/G-quadruplex catalyzes the oxidation of TNB to the disulfide, (1), under aerobic conditions. In order to explore the reaction and suggest a mechanistic route for the DNAzyme-catalyzed oxidation of the thiol to the disulfide, we performed several control experiments as shown in Figure 2(B). The timedependent absorbance changes at λ = 412 nm resulting from the hemin/G-quadruplex-catalyzed


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 30

oxidation of TNB, (2), to DTNB, (1) is depicted in curve (a). The time-dependent formation of (1) in the absence of the G-quadruplex, (3), but in the presence of hemin only, curve (b), or in the presence of the buffer only, curve (c), are significantly lower than the rate of formation of (1) shown in curve (a), implying that the hemin/G-quadruplex, indeed, catalyzes the oxidation of the thiol to the disulfide, (1). It should be noted that H2O2 was not added exogenously to the systems. Nonetheless, as we will describe later, that the hemin/G-quadruplex-catalyzed oxidation of (2) to (1) involves the intermediary formation of H2O2 through the reduction of O2. To confirm that H2O2 participated in the aerobic oxidation of (2), we added catalase into the reaction mixture (catalase decomposes H2O2). The time-dependent absorbance changes of TNB, (2), in the presence of catalase, 10 U, the hemin/G-quadruplex and under aerobic conditions are shown in curve (d). Clearly, the oxidation of TNB by the hemin/G-quadruplex to (1) is blocked, implying that H2O2 is, indeed, the active oxidant agent in the oxidation of the thiol TNB to the disulfide DTNB, although H2O2 was not added to the system. These results suggest that an effective mechanism for the formation of H2O2 in the system exists. Further control experiments confirmed the participation of O2 in the process and allowed to quantitatively characterize the formation of H2O2 in the system: (i) The hemin/G-quadruplex-catalyzed oxidation of (2) to (1) was examined under inert atmosphere of nitrogen, Figure 2(B), curve (e). The oxidation of (2) to (1) was fully blocked, indicating that O2 is a key component in the oxidation process. (ii) The hemin/G-quadruplex-catalyzed oxidation of (2) to (1) was examined under inert atmosphere of nitrogen upon addition of different concentrations of H2O2, Figure S-1. As the concentration of H2O2 increases, the oxidation of (2) to (1) is enhanced, confirming that H2O2 is, indeed, an important agent in the oxidation process. By using the rate of formation of (1) in the presence of variable, exogenously added, H2O2 concentrations, we estimated the concentration of H2O2


8

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


generated in the system shown in Figure 2(B), curve (a), to be ca. 13.5 µM. Based on previous studies exploring the peroxidase-stimulated oxidation of thiols31 and the properties of thiol radicals,32 one may formulate the mechanism for the hemin/G-quadruplex-catalyzed oxidation as outlined in Figure 3. In the primary step of the process the inefficient non-catalyzed oxidation of the thiol to the disulfide proceeds while generating either trace amounts of hydrogen peroxide, eq. 2, or of water, eq. 3. The generated H2O2 initiates the hemin/G-quadruplex-catalyzed .

oxidation of the thiols and the resulting formation of the thiol radicals (RS ) in two subsequent steps, Figure 3. The resulting thiol radicals are, however, extremely important intermediates that autocatalyze the formation of H2O2 via the set of reactions outlined in eq. 4 to eq. 8. The autonomous regeneration of H2O2 provides a feedback cycle for the continuous generation of H2O2 and for the catalyzed formation of the disulfide. That is, the non-catalyzed formation process, eq. 2, leads to the formation of trace amounts of H2O2, thus activating the DNAzymecatalyzed formation of the thiol radicals that ultimately initiate an amplification cycle that leads to the continuous formation of H2O2 and to the disulfide product. Realizing that the aerobic interaction of thiols with the hemin/G-quadruplex DNAzyme leads to the non-linear formation of H2O2, one may branch the generated product of H2O2 towards either the hemin/G-quadruplex-catalyzed oxidation of thiol to disulfides, or to a second route of hemin/G-quadruplex-catalyzed oxidation of a reporter substrate, a route acting as a reporter module. That is, the reporter system provides the readout signal for the oxidation and consequently for the presence of thiols in the system. Thiols are a verstile class of compounds playing important roles in many biological processes.33 Biomolecules that contain a thiol functional group such as cysteine, homocyseine, glutathione and H2S are essential for the proper function of cellular processes. The intracellular levels of these biomolecules correlate with


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 30

various clinical syndromes and diseases.34-38 In the present study we developed a sensor for Lcysteine as depicted in Figure 4(A). L-cysteine plays a central role in controlling the folding and tertiary structure of proteins.39 L-cysteine has been also identified as an endogenous excitotoxin that damages the central nervous system,40,41 and elevated amounts of L-cysteine were found to be associated with various neurodegenerative diseases such as Parkinson’s disease or Alzheimer’s and Hallervorden-Spatz diseases.42,43 Also, accumulation of the oxidized cysteine, cystine, in the urine, may cause cystinuria.44 Thus, the development of sensors for cysteine has a clinical as well as a medical importance. Indeed, various optical45,46 and electrochemical47,48 sensors for L-cysteine have been developed recently. In the present system we employed the hemin/G-quadruplex to catalyze the oxidation of L-cysteine to cystine. This is explained in Figure 4(A) with the development of a sensing platform for L-cysteine, (4). Under aerobic conditions and in the presence of the hemin/G-quadruplex, the catalyzed oxidation of L-cysteine, (4), to cystine, (5), proceeds with the concomitant generation of H2O2. In the presence of added Amplex Red the H2O2-mediated DNAzyme-catalyzed oxidation of Amplex Red, (6), to the fluorescent product resorufin, (7), acts as the reporter module.49 As the concentration of the thiol increases, the concentration of the generated H2O2 is enhanced respectively, resulting in the enhanced formation of the fluorescent product, resorufin, (7). Thus, the reporter system provides a fluorescent readout signal that is related to the concentration of the thiol. Figure 4(B) shows the time-dependent fluorescence changes of the reporter in the presence of L-cysteine, 1 × 10-4 M, hemin/G-quadruplex and the appropriate control experiments. Evidently, the fluorescence is generated only in the presence of the thiol, DNAzyme, oxygen and the reporter system. Figure 4(C) depicts the time-dependent fluorescence changes upon analyzing different concentrations of L-cysteine, (4). As the concentration of L-cysteine increases the fluorescence signals are


10

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


intensified. By monitoring of fluorescence generated after a fixed time-interval of 40 minutes, the respective calibration curve, Figure 4(C), inset, was derived. The system enabled the analysis of L-cysteine with a detection limit that corresponded to 9 ×10-7 M. Thus, this sensing platform is generic and could be implemented to analyze any thiol substrate (for the implementation of the sensing platform to sense glutathione and the appropriate control experiments, see supporting information, Figures S-2 and Figure S-3). The hemin/G-quadruplex sensing platform was also implemented to analyze cysteine in a serum sample. L-cysteine could be analyzed with a detection limit corresponding to 115 μM. Thus, the sensing platform allows the analysis of Lcysteine within the physiologically-relevant concentration range (see details and experimental results, Figure S-4 and Figure S-5, supporting information). As the hemin/G-quadruplex acts as a catalyst for both the aerobic oxidation of the thiol to the disulfide and for the H2O2-mediated catalyzed-oxidation of Amplex Red to resorufin, the content of the DNAzyme controls both the kinetics of the oxidation of the thiol as well as the intensity of the readout fluorescent signal. Thus, a system consisting of L-cysteine and Amplex Red may act as an auxiliary transduction scheme for any sensing platform that leads to the formation of the hemin/G-quadruplex DNAzyme. This has been exemplified by developing a thrombin aptasensor system using the hemin/G-quadruplex/Amplex Red system as an auxiliary assembly for the transduction of the sensing events. The thrombin-binding aptamer, TBA, (8), is known to fold into a G-quadruplex structure upon formation of the aptamer-substrate complex, in the presence of added K+ ions.50,51 The complexation of hemin with the resulting thrombin/Gquadruplex structure yields an active horseradish peroxidase-mimicking DNAzyme. Indeed, this features were used to develop different amplified thrombin detection assays.52-54 Figure 5(A) exemplifies the scheme for sensing thrombin using the DNAzyme-catalyzed oxidation of L-


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

cysteine in the presence of Amplex Red as an auxiliary fluorescence transduction module. In the presence of thrombin, TBA and K+ ions the TBA/thrombin complex is formed. The association of hemin to the G-quadruplex structure yields the DNAzyme, and this catalyzes the oxidation of L-cysteine to cystine with the concomitant generation of H2O2 and the resulting H2O2-mediated oxidation of Amplex Red to the fluorescent product, resorufin. As the concentration of the DNAzyme is controlled by the concentration of thrombin, the resulting fluorescence intensity relate to the concentration of thrombin. Figure 5(B) shows the time-dependent fluorescence changes upon analyzing different concentrations of thrombin by the auxiliary L-cysteine/Amplex Red readout system. It can be seen that as the concentration of thrombin increases, the fluorescence changes in the system are intensified. By monitoring the fluorescence intensities of resorufin generated by the systems after a fixed time-interval, corresponding to 60 minutes, the appropriate calibration curve, Figure 5(B), inset, was derived. This system enabled the analysis of thrombin with a detection limit corresponding to 1.7 × 10-9 M. The dynamic range of the present thrombin sensing system is quite narrow (1 × 10-9 M – 1 × 10-8 M). Nonetheless, this dynamic range could be expanded by lowering the K+-ion concentration, yet this would perturb the sensitivity of the system. Besides the significance of the system as a thrombin-sensingplatform it demonstrates that hemin complexes with different G-quadruplexes yield catalysts for the aerobic oxidation of thiols. Since many aptamer complexes yield G-quadruplex/substrate complexes (e.g. VEGF or ATP), many other amplified aptasensors may be envisaged. Furthermore, since many different G-quadruplex structures are known (parallel, anti-parallel, self-assembled and G-quadruplex of variable number of layers), different catalytic activities of the resulting hemin/G-quadruplex can be expected. Such studies could expand the present report.


12

Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The hemin/G-quadruplex-catalyzed oxidation of thiols to disulfides under aerobic conditions, with the concomitant H2O2-mediated DNAzyme-catalyzed oxidation of (6) to (7), was further implemented to probe the activity of acetylcholine esterase, AChE, and to follow its inhibition. Acetylcholinesterase, AChE, plays a major role in the neuronal transduction process.55 The neurotransmitter acetylcholine activates the neural response system, and its rapid hydrolytic depletion by AChE is essential to switch off the neurotransmitter-triggered neurons. Upon the inhibition of AChE, e.g. by chemical warfare agents,56,57 the accumulation of acetylcholine leads to an uncontrolled response of the neuronal system. In the past decade different sensing platforms to detect acetylcholinesterase activity and its inhibition by nerve gas analogues were reported. Some of these employed the coupling of the choline oxidase enzyme to AChE that in the presence of acetylcholine led to the generation of H2O2. The monitoring of either the bleaching of the luminescence of the CdSe/ZnS quantum dots,58,59 or measuring the electrochemical currents resulting from the electrocatalytic reduction of the generated H2O2,60 allowed the detection of the inhibitors. Additionally, AChE inhibitors were detected by monitoring the changes in the surface plasmon resonance signal resulting from the binding of inhibitors to AChE enzymes that were immobilized on a gold surface.61 It was found that acetylthiocholine can substitute acetylcholine as substrate of AChE,62 and indeed, the AChE catalyzes the hydrolysis of the acetylthiocholine, (9), into the thiolated product of thiocholine, (10), and acetate. The AChE-catalyzed hydrolysis of (9) into (10) was previously implemented to develop a photoelectrochemical sensor to probe the activity of AChE using semiconductor CdS nanoparticles as photocatalysts.63 Additionally, the thiolated product, (10), was used to turn-on the fluorescence of a fluorogenic probe in a screening assay for AChE inhibitors.64 In the present study the AChE-biocatalyzed hydrolysis of (9) to thiocholine, (10), was used to probe the


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 30

activity of AChE using the auxiliary hemin/G-quadruplex-catalyzed oxidation of the generated thiol and the concomitant generation of the resorufin fluorescence as a readout signal for the AChE activity, Figure 6(A). In the presence of the co-added hemin/G-quadruplex as a DNAzyme and Amplex Red as a fluorogenic label, the secondary hemin/G-quadruplex-catalyzed oxidation of thiocholine to the disulfide proceeds, with the concomitant generation of H2O2. The resulting H2O2-mediated DNAzyme-catalyzed oxidation of (6) to the fluorescent product, (7) functions as a readout module. As the secondary readout module is controlled by the concentration of formed thiol, the resulting fluorescence provides a transduction signal reflecting the enzymatic activity of AChE (either the content of the enzyme or its inhibition). Figure 6(B) depicts the timedependent fluorescence changes generated by the system in the presence of AChE, 5 × 10-7 M (10 U), and the respective control experiments. Evidently, the fluorescence is generated only in the presence of AChE and acetylthiocholine, (9) and requires the presence of the hemin/Gquadruplex for the generation of fluorescence. Figure 6(C) shows the time-dependent fluorescence changes generated by the system in the presence of different concentrations of AChE. It should be noted that in these experiments the concentration acetylthiocholine, the hemin/G-quadruplex, and of Amplex Red were retained constant throughout the experiment. As the concentration of AChE increases the time-dependent fluorescence changes are intensified, consistent with the higher content of the catalyst that lead to elevated amounts of thiocholine, and this is reflected by the higher fluorescence of resorufin. Figure 6(C), inset, depicts the resulting calibration curve corresponding to the fluorescence intensities of resorufin generated by the system in the presence of different concentrations of the enzyme, at a fixed time-interval of 60 minutes.


14

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We, then, implemented the hemin/G-quadruplex-catalyzed oxidation of the AChEgenerated thiocholine, in the presence of Amplex Red, to probe the inhibition of AChE by the inhibitor 1,5-bis(4-allyldimethylammoniumphenyl)pentane-3-one dibromide, (11),56 Figure 6(D). In this system, the inhibitor (11) is expected to inhibit the AChE-catalyzed hydrolysis of (9) to thiocholine, resulting in lower quantities of thiocholine, (9), and thus lower fluorescence intensities generated by the reporter module are expected upon increasing the concentration of the inhibitor (11). Figure 6(D) shows the time-dependent fluorescence changes upon addition of different concentrations of the inhibitor (11) to the system consisting of the AChE-catalyzed hydrolysis of acetylthiocholine, in the presence of the hemin/G-quadruplex/Amplex Red transduction module. In this experiment, the concentrations of acetylthiocholine, AChE, hemin/G-quadruplex and of Amplex Red remained constant throughout the experiment, and only the concentration of the inhibitor is varied. As the concentration of the inhibitor increases, the time-dependent fluorescence intensities of resorufin decrease, consistent with the lower content of the thiol-containing product generated by AChE. Figure 6(D), inset, depicts the resulting calibration curve corresponding to the fluorescence intensities of resorufin generated by the system in the presence of different concentrations of the inhibitor, at a fixed time-interval of 160 minutes.

Conclusions The present study has demonstrated the novel catalytic activity of the hemin/G-quadruplex as a DNAzyme for the aerobic oxidation of thiols to disulfides in the absence of added H2O2. The hemin/G-quadruplex-catalyzed transformation of the thiol to the disulfide involves an interesting autocatalytic mechanism. The active oxidation agent in the process was found to be H2O2. Trace


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 30

amounts of H2O2 generated by the direct oxidation of the thiol by oxygen activates the hemin/Gquadruplex-catalyzed oxidation of the thiol to the disulfide and the initiation of an autocatalytic cycle for the generation of H2O2 under aerobic conditions. The discovery that the hemin/G-quadruplex catalyses the oxidation of thiols to disulfides and the assembly of a thiol/hemin/G-quadruplex/Amplex Red fluorescent transduction module have several important consequences: (i) the aerobic DNAzyme-catalyzed oxidation of the thiols to disulfides might be a general route to ligate thiol-functionalized nucleic acids. (ii) The detection of different naturally occurring thiols (e.g. glutathione) has important clinical diagnostic implications. (iii) Many aptamers generate G-quadruplexes upon the formation of the aptamersubstrate complexes. By conjugation of hemin to these G-quadruplexes and coupling of the thiol/Amplex Red fluorescence transduction module to these systems, different aptasensors may be envisaged (e.g. the detection of ATP or VEGF). (iv) Different DNA sensing assays have implemented functional hairpin structures that cage the G-quadruplex sequence in their stem regions were developed. The opening of the hairpins by the appropriate analyte provided, then, the catalytic amplified chemiluminescent/colorimetric transduction of the sensing events. The coupling of the hemin/G-quadruplex unit, generated upon opening of the functional hairpin structures, to the thiol/Amplex Red fluorescent transduction module may provide an alternative path to readout these sensing events. Previous studies have implemented horseradish peroxidase and Amplex Red for sensing glutathione by the similar concept.65 The use of horseradish peroxidase/Amplex Red and the hemin/G-quadruplex/Amplex Red for sensing glutathione (e.g., Figures S-2 and S-3, supporting information) revealed a ca. 100-fold enhanced sensitivity. The advantages of the hemin/G-quadruplex system rest, however, on the fact that many aptamers yield G-quadruplex/substrate complexes, and thus different aptameric G-quadruplex sequences


16

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


can be integrated and caged in hairpin nucleic acid structures. This enables to implement the hemin/G-quadruplex DNAzyme as catalytic transducer in substantially more sensing platforms, as compared to horseradish peroxidase.

FIGURES

Figure 1. The exchange reaction between the Ellmans reagent, DTNB, (1) and a thiolated component, RSH.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

Figure 2. (A) Time-dependent spectral changes corresponding to the hemin/G-quadruplexcatalyzed oxidation of TNB to DTNB. The spectra were recorded at time-intervals of 2 minutes. (B) Time-dependent absorption changes at λ = 412 nm corresponding to the oxidation of TNB, (2), 5 × 10-5 M, to DTNB, (1), in the presence of: (a) the hemin/G-quadruplex, 1 × 10-6 M (b) hemin only, 1 × 10-6 M, (c) In the presence of HEPES buffer only, (d) the hemin/G-quadruplex ,1 × 10-6 M and catalase, 10 U, (e) same as (a) but under inert atmosphere of nitrogen.


18

Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Suggested mechanism for the aerobic hemin/G-quadruplex-catalyzed oxidation of thiols to disulfides with the concomitant generation of H2O2.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

Figure 4. (A) Schematic hemin/G-quadruplex-catalyzed oxidation of L-cysteine, (4), to cystine, (5), under aerobic conditions with the concomitant generation of H2O2 and the resulting catalyzed-oxidation of Amplex Red, (6), to resorufin, (7), as a reporter module for the presence of L-cysteine. (B) Time-dependent fluorescence changes of the generated resorufin in the presence of: (a) hemin/G-quadruplex, 1 × 10-6 M, and L-cysteine, 1 × 10-4 M, (b) the hemin/G-


20

Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


quadruplex, 1 × 10-6 M, L-cysteine, 1 × 10-4 M and catalase, 10 U, (c) hemin/G-quadruplex, 1 × 10-6 M, in the absence of L-cysteine, (d) same as (a) but in the absence of oxygen, (e) hemin only, 1 × 10-6 M, and L-cysteine, 1 × 10-4 M, (f) G-quadruplex only, 1 × 10-6 M, L-cysteine, 1 × 10-4 M. (C) Time-dependent fluorescence changes due to the hemin/G-quadruplex-catalyzed oxidation of Amplex Red to resorufin in the presence of hemin/G-quadruplex ,1 × 10-6 M, and variable concentrations of L-cysteine: (a) 0 M, (b) 5 × 10-7 M, (c) 1 × 10-6 M, (d) 3 × 10-6 M, (e) 5 × 10-6 M, (f) 7 × 10-6 M, (g) 1 × 10-5 M, (h) 1 × 10-4 M. Inset: Derived calibration curve corresponding to the fluorescence changes of the system in the presence of different concentrations of L-cysteine after a fixed time interval of 40 minutes. SD corresponds to N = 3 measurements.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 30

Figure 5. (A) Schematic catalyzed oxidation of L-cysteine, (4), to cystine, (5), by the thrombin/hemin/TBA under aerobic conditions with the concomitant generation of H2O2 and the resulting catalyzed-oxidation of Amplex Red, (6), to resorufin, (7), as a reporter module for the presence of thrombin. (B) Time-dependent fluorescence changes corresponding to the catalyzedoxidation of Amplex Red to resorufin in the presence of hemin/TBA and variable concentrations of thrombin: (a) 0 M, (b) 1 × 10-9 M, (c) 3 × 10-9 M, (d) 5 × 10-9 M, (e) 8 × 10-9 M, (f) 1 × 10-8 M, (g) 5 × 10-8 M. Inset: Derived calibration curve corresponding to the fluorescence changes of the system in the presence of different concentrations of thrombin after a fixed time interval of 60 minutes. SD corresponds to N = 3 measurements.


22

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. (A) Probing the activity of AChE in the presence of hemin/G-quadruplex, acetylthiocholine, (9), and Amplex Red under aerobic conditions. (B) Time dependent fluorescence changes due to the hemin/G-quadruplex-catalyzed oxidation of Amplex Red to resorufin in the presence of: (a) AChE, 5 × 10-7 M, hemin/G-quadruplex, 1 × 10-6 M, and (9) ,1 × 10-4, (b) hemin/G-quadruplex, 1 × 10-6 M, and (9), 1 × 10-4 M (c) AChE, 5 × 10-7 M, hemin/Gquadruplex, 1 × 10-6 M. (C) Time-dependent fluorescence changes due to the hemin/Gquadruplex-catalyzed oxidation of Amplex Red to resorufin in the presence of hemin/Gquadruplex, 1 × 10-6 M, acetylthiocholine, 1 × 10-4 M, and variable concentrations of AChE: (a) 0 M, (b) 1 × 10-9 M, (c) 5 × 10-9 M, (d) 1 × 10-8 M, (e) 5 × 10-8 M, (f) 3 × 10-7 M, (g) 5 × 10-7 M. Inset: Derived calibration curve corresponding to the fluorescence changes of the system at different concentrations of AChE after a fixed time interval of 60 minutes. (D) Time-dependent fluorescence changes due to the hemin/G-quadruplex-catalyzed oxidation of Amplex Red to resorufin in the presence of hemin/G-quadruplex, 1 × 10-6 M, AChE, 1 × 10-9 M, acetylthiocholine, 1 × 10-4 M, and variable concentrations of the inhibitor, (11) : (a) 0 M, (b) 1 × 10-8 M, (c) 8 × 10-8 M, (d) 1 × 10-7 M, (e) 5 × 10-7 M, (f) 1 × 10-6 M, (g) 1 × 10-5 M. Inset: Derived calibration curve corresponding to the fluorescence changes of the system in the presence of different concentrations of the inhibitor, (11), after a fixed time interval of 160 minutes. ASSOCIATED CONTENT The anaerobic H2O2-mediated hemin/G-quadruplex-catalyzed oxidation of TNB, (1), to DTNB, (2), control experiments for the sensing of glutathione and the sensing of variable concentrations of glutathione, and the sensing of glutathione in human plasma. This material is available free of charge via the Internet at http://pubs.acs.org.


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 30

Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

Funding Sources Israel Science Foundation. Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This research is supported, in part, by the Microreagent EU FET project and by the Israel Science Foundation.


24

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Travascio, P.; Li, Y. F.; Sen, D. Chem. Biol. 1998, 5, 505 – 517. (2) Witting, P. K.; Travascio, P.; Sen, D.; Mauk, A. G. Inorg. Chem. 2001, 40, 5017 – 5023. (3) Sen, D.; Poon, L. C. H. Crit. Rev. Biochem. Mol. Biol. 2011, 46, 478 – 492. (4) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152 – 2156. (5) Niazov, T.; Pavlov, V.; Xiao, Y.; Gill, R.; Willner, I. Nano Lett. 2004, 4, 1683 – 1687. (6) Pelossof, G.; Tel-Vered, R.; Elbaz, J.; Willner, I. Anal. Chem. 2010, 82, 4396 – 4402. (7) Zhang, M.; Xu, S.; Minteer, S. D.; Baum, D. A. J. Am. Chem. Soc. 2011, 133, 15890 – 15893. (8) Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Nucleic Acids Res. 2006, 34, 5402 − 5415. (9) Bugaut, A.; Balasubramanian, S. Biochemistry 2008, 47, 689−697. (10) Zhu, L.; Li, C.; Zhu, Z.; Liu, D.; Zou, Y.; Wang, C.; Fu, H.; Yang, C. Anal. Chem. 2012, 84, 8383 − 8390. (11) Nakayama, S.; Wang, J. X.; Sintim, H. O. Chem. Eur. J. 2011, 17, 5691 – 5698. (12) Cheng, X.; Liu, X.; Bing, T.; Cao, Z.; Shangguan, D. Biochemistry 2009, 48, 7817 – 7823. (13) Sharon, E.; Freeman, R.; Willner, I. Anal. Chem. 2010, 82, 7073 – 7077. (14) Freeman, R.; Liu, X.; Willner, I. J. Am. Chem. Soc. 2011, 133, 11597−11604.


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 30

(15) Liu, X.; Freeman, R.; Golub, E.; Willner, I. ACS Nano 2011, 5, 7648−7655. (16) Golub, E.; Niazov, A.; Freeman, R.; Zatsepin, M.; Willner, I. J. Phys. Chem. C 2012, 116, 13827−13834. (17) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J.Am. Chem. Soc. 2004, 126, 7430 – 7431. (18) Shimron, S.; Wang, F.; Orbach, R.; Willner, I. Anal. Chem. 2012, 84, 1042−1048. (19) Teller, C.; Shimron, S.; Willner, I. Anal. Chem. 2009, 81, 9114 –9119. (20) Elbaz, J.; Moshe, M.; Shlyahovsky, B.; Willner, I. Chem. Eur. J. 2009, 15, 3411 – 3418. (21) Kong, D. M.; Xu, J.; Shen, H. X. Anal. Chem. 2010, 82, 6148 – 6153. (22) Bi, S.; Li, L.; Zhang, S. S. Anal. Chem. 2010, 82, 9447−9454 (23) Li, T.; Shi, L. L.; Wang, E. K.; Dong, S. J. Chem. Eur. J. 2009, 15, 3347-3350. (24) Li, T.; Wang, E.; Dong, S. Anal. Chem. 2010, 82, 1515−1520. (25) Shlyahovsky, B.; Li, D.; Katz, E.; Willner, I. Biosens. Bioelectron. 2007, 22, 2570 – 2570. (26) Stefan,L.; Denat, F.; Monchaud, D. J. Am. Chem. Soc. 2011, 133, 20405-20415. (27) Golub, E.; Freeman, R.; Willner, I. Angew. Chem., Int. Ed. 2011, 50, 11710-11714. (28) Miron, T.; Rabinkov, A.; Mirelman, d.; Weiner, L.; Wilchek M., Anal. Biochem. 1998, 265, 317–325. (29) Ellman, G.L. Arch. Biochem. Biophys. 1959, 82, 70-77.


26

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30) Riddles, P. W.; Blakeley, R. L.; Zerner, B. Methods Enzymol. 1983, 91, 49−60. (31) Burner, U.; Obinger, C. FEBS Lett. 1997, 411, 269-274. (32) Harman, L. S.; Carver, D. K.; Schreiber, J.; Mason, R. P. J. Biol. Chem. 1987, 261, 1642– 1648. (33) Meister, A.; Anderson, M. E. Ann. Rev. Biochem. 1983, 52, 711–760. (34) Calonge, M. T.; Gasparini, P.; Chillaron, J.; Chillon, M.; Gallucci, M.; Rousaud, F.; Zelante, L.; Testar, X.; Dallapiccola, B.; Disilverio, F.; Di Silverio F.; Barceló P.; Estivill X.; Zorzano A.; Nunes V.; PalacıYn M. Nat. Genet. 1994, 6, 420–425. (35) Wu, G. Y.; Fang, Y. Z.; Yang, S.; Lupton, J. R.; Turner, N. D. J. Nutr. 2004, 134, 489– 492. (36) Chadefaux, B.; Ceballos, I.; Hamet, M.; Coude, M.; Poissonnier, M.; Kamoun, P.; Allard, D. Lancet 1988, 2, 741. (37) Medina, M. A.; Amores-Sanchez, M. I. Eur. J. Clin. Invest. 2000, 30, 754–762. (38) Rahman, I.; Biswas, S. K. Mol. Aspects Med. 2009, 30, 60–76. (39) Petsko, G. A.; Ringe, D. Protein Structure and Function: From Sequence to Consequence; New Science Press Ltd.: London, UK, 2004. (40) Olney, J. W.; Zorumski, C.; Price, M. T.; Labruyere, J. Science 1990, 248, 596–599. (41) Janaky, R.; Varga, V.; Hermann, A.; Saransaari, P.; Oja, S. S. Neurochem. Res. 2000, 25, 1397−1405.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 30

(42) Heafield, M. T.; Fearn, S.; Steventon, G. B.; Waring, R. H.; Williams, A. C.; Sturman, S. G. Neurosci. Lett. 1990, 110, 216–220. (43) Perry, T. L.; Norman, M. G.; Young, V. W.; Whiting, S.; Crichton, J. U.; Hansen, S.; Kish, S. J. Ann. Neurol. 1985, 18, 482–489. (44) Crawhall, J. C.; Watts, R. W. E. Am. J. Med. 1968, 45, 736-755. (45) Chen, X.; Zhou,Y.; Peng, X.; Yoon, J. Chem. Soc. Rev. 2010, 39, 2120−2135. (46) Peng, H.; Chen, W.; Cheng, Y.; Wang, B. Sensors 2012, 12, 15907-15946. (47) Inoue, T.; Kirchhoff, J. R. Anal. Chem. 2000, 72, 5755–5760. (48) Shahrokhian S. Anal. Chem. 2001, 73, 5972–5978. (49) Nakayama, S.; Sintim H. O. Mol. BioSyst. 2010, 6, 89-94. (50) Bock, L. C.; Griffin, L. C.; Latham, J. A.; Vermaas, E. H.; Toole, J. J. Nature 1992, 355564. (51) Macaya, R. F.; Waldron, J. A.; Beutel, B. A.; Gao, H. T.; Joesten, M. E.; Yang, M. H.; Patel, R.; Bertelsen, A. H.; Cook, A. F. Biochemistry 1995, 34, 4478. (52) Li, T.; Wang, E.; Dong, S. Chem. Commun. 2008, 31, 3654– 3656. (53) Jiang B.Y.; Wang M.; Li C.; Xie J. Q. Biosens. Bioelectron. 2013, 43, 289-292. (54) Golub, E.; Freeman, R. Niazov, A.; Willner, I. Analyst 2011, 136, 4397–4401. (55) Perry, E.; Walker, M.; Grace, J.; Perry, R. Trends Neurosci. 1999, 22, 273–280.


28

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(56) Miao, Y.; He, N.; Zhu, J.J. Chem. Rev. 2010, 110, 5216–5234. (57) Dupree, J. L.; Bigbee, J. W. J. Neurosci. Res. 1994, 39, 567–575. (58) Gill, R.; Bahshi, L.; Freeman, R.; Willner, I. Angew. Chem., Int. Ed. 2008, 47, 1676–1679. (59) Meng, X.; Wei, J.; Ren, X.; Ren, J.; Tang, F. Biosens. Bioelectron. 2013, 47, 402–407. (60) Upadhyay, S.; Rao, G. R.; Sharma, M. K.; Bhattacharya, B. K.; Rao, V. K.; Vijayaraghavan, R. Biosens. Bioelectron. 2009, 25, 832−838 (61) Milkani, E.; Lambert, C.R.; McGimpsey, W.G. Anal. Biochem. 2011, 408, 212–219. (62) Froede, H. C.; Wilson, I. B. J. Biol. Chem. 1984, 259, 1010-1013. (63) Pardo-Yissar, V.; Katz, E.; Wasserman, I.; Willner, I. J. Am. Chem. Soc. 2003, 125, 622−623. (64) Maeda, H.; Matsuno, H.; Ushida, M.; Katayama, K.; Saeki, K;. Itoh, N. Angew. Chem., Int. Ed. 2005, 44, 2922−2925. (65) Votyakova, T. V.; Reynolds, I. J. Arch. Biochem. Biophys. 2004, 431, 138–144.


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 30

For TOC only


30

G-Quadruplex-Catalyzed Aerobic Oxidation of Thiols to

Recommend Documents