Genetic and Biochemical Evidence That Recombinant Enterococcus

Article pubs.acs.org/JAFC

Genetic and Biochemical Evidence That Recombinant Enterococcus spp. Strains Expressing Gelatinase (GelE) Produce Bovine MilkDerived Hydrolysates with High Angiotensin Converting EnzymeInhibitory Activity (ACE-IA) Loreto Gútiez,† Juan Borrero,† Juan J. Jiménez,† Beatriz Gómez-Sala,‡ Isidra Recio,§ Luis M. Cintas,† Carmen Herranz,† and Pablo E. Hernández*,† †

Departamento de Nutrición, Bromatologı ́a y Tecnologı ́a de los Alimentos, Facultad de Veterinaria, Universidad Complutense de Madrid (UCM), 28040 Madrid, Spain ‡ INNAVES S.A., 36475 Porriño, Pontevedra, Spain § Instituto de Investigación en Ciencias de la Alimentación, CIAL (CSIC-UAM), C/. Nicolás Cabrera 8, 28049 Madrid, Spain ABSTRACT: In this work, genes encoding gelatinase (gelE) and serine proteinase (sprE), two extracellular proteases produced by Enterococcus faecalis DBH18, were cloned in the protein expression vector pMG36c, containing the constitutive P32 promoter, generating the recombinant plasmids pCG, pCSP, and pCGSP encoding gelE, sprE, and gelE−sprE, respectively. Transformation of noncaseinolytic E. faecalis P36, E. faecalis JH2-2, E. faecium AR24, and E. hirae AR14 strains with these plasmids permitted detection of caseinolytic activity only in the strains transformed with pCG or pCGSP. Complementation of a deletion (knockout) mutant of E. faecalis V583 for production of gelatinase (GelE) with pCG unequivocally supported that gelE is responsible for the caseinolytic activity of the transformed strain grown in bovine skim milk (BSM). RP-HPLC-MS/MS analysis of hydrolysates of transformed Enterococcus spp. strains grown in BSM permitted the identification of 38 major peptide fragments including peptides with previously reported angiotensin converting enzyme-inhibitory activity (ACE-IA), antihypertensive activity, and antioxidant activity. KEYWORDS: lactic acid bacteria (LAB), Enterococcus faecalis, gelatinase (GelE), serine protease (SprE), ACE-inhibitory peptides, antihypertensive peptides

■

infections.11 Previous studies have shown that Enterococus faecalis strains from food origin produce food-derived hydrolysates with ACE-IA12−14 and that most, but not all, E. faecalis strains from food, environmental, and clinical origin produce milk-derived hydrolysates with high ACE-IA.15 Accordingly, it would be convenient to identify those E. faecalis metabolic activities releasing milk-derived ACE-IP. The zinc metalloprotease gelatinase (GelE) and the serine protease (SprE) are two secreted proteases produced by E. faecalis16,17 that contribute to biofilm formation, stress response inside the host, host immune system evasion, and virulence.18,19 On the other hand, the fsr (E. faecalis regulator) is a twocomponent quorum sensing-dependent regulatory system whose operon encodes the fsrABCD genes. The last gene encodes an autoinducing cyclic peptide, a gelatinase biosynthesis activating pheromone (GBAP) that is processed and exported out of the cells by the FsrB protein. Accumulation of GBAP outside the cells is sensed by the FsrC histidine kinase, leading to the activation of the response regulator FsrA. Activated FsrA induces expression of the fsrBCD genes. These fsr genes are involved in an autoregulatory circuit that results in a boost of GBAP signaling

INTRODUCTION Many dietary proteins contain encrypted within their primary structure bioactive peptides with beneficial effects against cardiovascular diseases, inflammation, and cancer.1,2 From the bioactive peptides, those with angiotensin converting enzymeinhibitory activity (ACE-IA) and blood pressure-lowering effects have been extensively studied, due to the high prevalence of hypertension in the Western population.3 Furthermore, peptides with ACE-IA known as ACE-inhibitory peptides (ACE-IP) are of interest due to their potential use in the treatment of elevated blood pressure and associated cardiovascular events.4 Milk proteins are the main source of bioactive peptides, although other animal and plant proteins may also contain these peptides.5−7 The release of ACE-IP from food proteins may be achieved by digestive enzymes, by hydrolysis with specific proteolytic enzymes, or by fermentation and ripening during food processing. Fermentation conditions and the proteolytic activity of specific lactic acid bacteria (LAB) seem to modulate the production of ACE-IP during their growth in milk.8,9 The enterococci are LAB that play a beneficial role in the development of the sensory characteristics of fermented foods being employed as starters in the food industry and as probiotics for humans and animals.10 However, they are also gastrointestinal tract colonizers with lifestyles ranging from intestinal symbionts to multidrug-resistant pathogens responsible for nosocomial and, to a lesser extent, community-acquired © 2014 American Chemical Society

Received: Revised: Accepted: Published: 5555

February 7, 2014 May 30, 2014 May 30, 2014 May 30, 2014 dx.doi.org/10.1021/jf5006269 | J. Agric. Food Chem. 2014, 62, 5555−5564

Journal of Agricultural and Food Chemistry

Article

and the induction of the Fsr regulon, among which the gelE−sprE operon is the most induced.19,20 In the gelE−sprE operon, the gene encoding GelE is located immediately adjacent to the 3′ end of fsrC and is cotranscribed with sprE. However, despite their significance for E. faecalis virulence, both the fsr and the gelE− sprE loci are present in enterococcal isolates from different ecological environments, suggesting that both the Fsr system and the GelE and SprE proteins may play an additional role in the biology of E. faecalis,18 not exclusively associated with virulence. E. faecalis DBH1821 is a bacteriocinogenic strain producer of bovine skim milk (BSM)-derived hydrolysates with high ACEIA.15 This strain may synthesize the GelE encoded by its gelE− sprE operon (GenBank no. JQ815406) as a 509 amino acid preproenzyme with a predicted N-terminal signal peptide of 29 amino acids, a prosequence of 480 amino acids, and the mature GelE of 318 amino acids, which is further subjected to C-terminal processing for full activation of protease activity, resulting in a molecular mass of 33 kDa.22,23 Similarly, SprE may be synthesized as a 284 amino acid preproenzyme with a predicted N-terminal signal peptide of 32 amino acids, a prosequence of 252 amino acids, and the mature serine-type glutamyl endopeptidase (SprE) of 237 amino acids and a molecular mass of 25 kDa.24 We describe in this work the cloning of the extracellular proteases GelE and SprE, produced by E. faecalis DBH18, in the protein expression vector pMG36c and the genetic and biochemical evidence that recombinant Enterococcus spp. strains expressing GelE produce BSM-derived hydrolysates with ACE-IA due to the production of ACE-IP.

■

Table 1. Bacterial Strains and Plasmids Used in This Study descriptiona

strain or plasmid strains Enterococcus faecalis DBH18 Enterococcus faecalis QA53 Enterococcus faecalis JH2-2 Enterococcus faecalis V583 Enterococcus faecalis P4 Enterococcus faecalis P36 Enterococcus faecalis H10 Enterococcus faecalis 3Er1 Enterococcus faecium AR24 Enterococcus hirae AR14 plasmids pMG36c pCG pCGSP pCSP

MATERIALS AND METHODS

pAS222 pAS222-KO-GelE

Bacterial Strains, Culture Conditions, Basic Genetic Techniques, and Enzymes. The bacterial strains and plasmids used in this study are listed in Table 1. E. faecalis DBH1821 was used as the source of gelE and sprE. The nucleotide sequence of gelE from E. faecalis DBH18 (GenBank no. JQ815406) showed 99 and 98% homology with those of E. faecalis OG1RF (GenBank no. CP002621) and E. faecalis V583 (GenBank no. AE016830), respectively, whereas the nucleotide sequence of sprE showed a 98% homology with those of E. faecalis OG1RF and E. faecalis V583. The enterococcal strains were propagated at 37 °C in MRS broth (Oxoid Ltd., Basingstoke, UK). When needed, chloramphenicol (Cm) (Sigma Chemical Co., St. Louis, MO, USA) was added to the recombinant cultures at 10 μg/mL. Reconstituted 10% (w/ v) bovine skim milk powder (BSM) (Oxoid), heated at 121 °C for 5 min, was seeded with a loop of frozen stocks of recombinant cultures and grown at 37 °C for 24 h. Three percent (v/v) grown cultures were added to freshly made reconstituted 10% (w/v) BSM, and the cultures were further grown at 37 °C for 24, 48, and 96 h. The fermentation process was discontinued by heating of the BSM-derived cultures at 75 °C for 1 min,12 and the cultures were vigorously stirred and centrifuged at 8000g for 10 min. The resulting supernatants were filtered through 0.20 μm pore size filters (Whatman International Ltd., Maidstone, UK) and stored at −20 °C before use. Total genomic DNA from E. faecalis DBH18 was isolated using the Wizard DNA Purification Kit (Promega, Madison, WI, USA). Plasmid DNA isolation was carried out using the High Pure Plasmid Isolation Kit (Roche Diagnostics, East Sussex, UK), as suggested by the manufacturer, but with the cells suspended with lysozyme (40 mg/mL) and mutanolysin (500 U/mL) and incubated at 37 °C for 10 min before the kit instructions were followed. All DNA restriction enzymes were supplied by New England BioLabs (Beverly, MA, USA). Ligations were performed with the T4 DNA ligase (Roche Molecular Biochemicals, Mannheim, Germany). Electrocompetent Enterococcus spp. cells were obtained as previously described25 and transformed with a Gene Pulser and Pulse Controller apparatus (BioRad Laboratories, Hercules, CA, USA). Determination of Gelatin and Bovine Skin Milk Hydrolysis by Different E. faecalis Strains. Well-characterized E. faecalis strains from food, environmental, and clinical origin including E. faecalis

source and/or refb

gelE+, sprE+, GelE+, used as the source of gelE and sprE GelE+

DNBTA, 21

gelE+, sprE+, fsrABC−, GelE−

HRC, 50

gelE+, sprE+, fsrABCD+, GelE+

LMG, 51

gelE+, sprE+, GelE+

IFR, 27

gelE+, sprE+, GelE−

IFR, 27

GelE+

HRC

GelE+

HRC

GelE−

DAAUR

GelE−

DAAUR

Cmr, pMG36e derivative Cmr, pMG36c derivative carrying the PCR product GELc Cmr, pMG36c derivative carrying the PCR product GEL/SPRc Cmr, pMG36c derivative carrying the PCR product SPRc integrative vector, Ampr Ampr, pAS222 derivative

RUG-MG, 36 this work

DNBTA, 26

this work this work LMG,30 this work

a Cmr, choramphenicol resistant; Ampr, ampicillin resistant. bDAAUR, Departamento de Agricultura y Alimentación, Universidad de la Rioja (Logroño, Spain); DNBTA, Departamento de Nutrición, Bromatologıá y Tecnologıá de los Alimentos, Facultad de Veterinaria, Universidad Complutense de Madrid (Madrid, Spain); HRC, Departamento de Microbiologı ́a, Hospital Universitario Ramón y Cajal (Madrid, Spain); IFR, Institute of Food Research (Norwich, UK); LMG, Laboratory of Microbial Gene Technology, Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences (Ås, Norway); RUG-MG, Departament of Molecular Genetics, University of Groningen (Haren, The Netherlands). cSee Table 2.

DBH1821 and E. faecalis QA5326 isolated from Mallard ducks (Anas platyrhynchos) and aged buffalo cheese, respectively, as well as E. faecalis P4 and E. faecalis P36, two medical isolates of clinical origin,27 and E. faecalis H10 and E. faecalis 3Er1, two more human clinical isolates of the multilocus sequence typing (MLST)-derived clonal complex 2 (CC2) and CC9, respectively,28 obtained from the Servicio de Microbiologı ́a, Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Hospital Universitario Ramón y Cajal, Madrid, (Spain), were evaluated for their ability to hydrolyze gelatin and bovine milk caseins. For detection of gelatinase activity, 5 μL of overnight cultures of E. faecalis strains, grown in MRS broth at 37 °C, were placed into Todd−Hewitt agar (Oxoid) containing 30 g of gelatin (Oxoid) per liter (TH-GEL), grown overnight at 37 °C, and placed at 4 °C for 5 h before examination of zones of turbidity around the cultures. The caseinolytic activity of E. faecalis strains was also evaluated by placing 5 μL of these cultures into Todd− Hewitt plates containing 1.5% (w/v) of BSM (TH-BSM) and grown overnight at 37 °C. A clear zone of hydrolysis within 24 h of growth was considered positive for caseinolytic activity. PCR Amplification and Nucleotide Sequencing. Oligonucleotide primers were obtained from Sigma-Genosys Ltd. (Cambridge, UK). PCR amplifications were performed in 50 μL reaction mixtures containing 1 μL of purified DNA, 70 pmol of each primer, and 1 U of 5556

dx.doi.org/10.1021/jf5006269 | J. Agric. Food Chem. 2014, 62, 5555−5564


Article

Table 2. Primers and PCR Products Used in This Study primer or PCR product primers GERL-F GERL-R SPL-F SPL-R Pr1 Pr2 Pr3 Pr4 Pr5 Pr6 PCR product GEL SPR GEL/SPR a

nucleotide sequence (5′−3′) or descriptiona

PCR product amplified

CATAGAGCTCTGTAAGGAGGATTTTAGAAATGAAGGGAAATAAAATTTTATACAT ATAAGTTAAGCTTGTATCATTCATTGACCAGAACAGATTCACTTG CATAGAGCTCTGTAAGGAGGATTTTAGAAATGAAAAAGTTCTCCATACGAAAAAT ATAAGTTAAGCTTGTATTACGCTGCTGGCACAGCGGATAAAC TACTCGAGATTTCCCGTGATTCT CTCTGCTGGAATCGGAGCT AGCTCCGATTCCAGCAGAGGGTCACCAGTTGGCGAAGAAGT GGAAGGAGTTAATTGTTTCTAGAAGGGAAATAAAATTTTATAC GTATAAAATTTTATTTCCCTTCTAGAAACAATTAACTCCTTCC GCTATGGTATTGAGTTATGAGGGGC

GEL, GEL/SPR GEL SPR GEL/SPR, SPR R1 R1 R2a R2a R2b R2b

1530 bp SacI/HindIII fragment containing the P32 ribosome binding site and complete gelE 903 bp SacI/HindIII fragment containing the P32 ribosome binding site and complete sprE 2400 bp SacI/HindIII fragment containing the P32 ribosome binding site and complete gelE−sprE

Cleavage site for restriction enzymes is underlined; P32 ribosome binding site is shown in bold.

Platinum Pfx DNA Polymerase (Invitrogen S.A., Barcelona, Spain). Samples were subjected to an initial cycle of denaturation (97 °C for 2 min), followed by 35 cycles of denaturation (94 °C for 45 s), annealing (55−58 °C for 30 s), and elongation (68 °C for 40 s), ending with a final extension step at 68 °C for 7 min in a DNA thermal cycler Techgene (Techne, Cambridge, UK). The PCR-generated fragments were purified by a NucleoSpin Extract II Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) before cloning into the expression vector and for nucleotide sequencing. Nucleotide sequencing of purified PCR products was done using the ABI PRISM BigDye Terminator cycle sequence reaction kit and the automatic DNA sequencer ABI PRISM model 377 (Applied Biosystems, Foster City, CA, USA) at the DNA Sequencing Service (Sistemas Genómicos, Valencia, Spain). Recombinant Plasmids Derived from pMG36c. The primers and inserts used for construction of the recombinant plasmids are listed in Table 2. Restriction mapping analysis of the gelE−sprE operon of E. faecalis DBH18 indicated the absence of restriction sites for restriction enzymes SacI and HindIII. Total genomic DNA of E. faecalis DBH18 was used as template for amplification with the GERL-F/GERL-R, SPLF/SPL-R, and GERL-F/SPL-R primer pairs of a 1530 bp SacI/HindIII fragment (GEL) containing gelE, a 903 bp SacI/HindIII fragment (SPR) containing sprE, and a 2400 bp SacI/HindIII fragment (GEL/SPR) containing gelE and sprE, respectively. Fragments GEL, SPR, and GEL/ SPR were digested with the indicated restriction enzymes and inserted into plasmid pMG36c digested with the same enzymes. The ligation mixtures were used to transform E. faecalis P36 and the recombinant derivatives checked by their gelatinase and caseinolytic activities. The recombinant plasmids pCG, pCSP, and pCGSP were purified from E. faecalis P36 and analyzed by PCR and sequencing of the inserts. Subsequently, these recombinant plasmids were used to transform E. faecalis DBH18, E. faecalis JH2-2, E. faecium AR24, and E. hirae AR14. The caseinolytic activity of the recombinant enterococcal strains was determined by a stab-on-agar test (SOAT) during growth of the selected colonies in TH-BSM plates at 37 °C for 24 h and visualization of clear zones of hydrolysis. Construction and Characterization of a Gelatinase (GelE) Deletion (Knockout) Mutant of E. faecalis V583. The deletion of gelE in E. faecalis V583 was achieved by double-crossover homologous recombination using pAS222 as the cloning vector.29,30 The gene sprE located downstream of gelE and the initial sequence of gelE were the homologous sequences used in homologous recombination to remove gelE. The insert to be cloned into pAS222 was constructed by a threestep PCR. First, the entire sprE was amplified with primers Pr1 and Pr2 to obtain fragment R1. The fragment R2, with the initial sequence of gelE, was subjected to a two-step PCR to remove an internal Met codon that could cause residual expression of a truncated gene and further amplified using primer pairs Pr3−Pr4 and Pr5−Pr6 (Table 2). Fragments R1 and R2 were then fused using the primer pairs Pr1 and

Pr6, and the construct was cloned into pAS222 resulting in plasmid pAS222-KO-GelE. To replace the genes on the chromosome with those in the construct, the latter plasmid was transformed into electrocompetent E. faecalis V583 cells,25 and the selection for doublecrossover events was performed as described by Biswas et al.31 The replacement of gelE and the integrity of the flanking genes in E. faecalis V583 ΔgelE was confirmed by DNA sequencing. Determination of the ACE-Inhibitory Activity. The ACE-IA of the supernatants of the recombinant Enterococcus spp. strains, grown in BSM, was determined by a fluorometric assay with modifications, as previously described.15 The angiotensin converting enzyme (ACE, peptidyl-dipeptidase A, EC 3.4.15.1) was obtained from Sigma Chemical Co., and the ACE working solution was added to blank (B), control (C), or samples (S). The reaction was started by adding the fluorogenic substrate o-aminobenzoylglycyl-p-nitro-L-phenylalanyl-L-proline (AbzGly-p-Phe(NO2)-Pro-OH) (0.45 mM, Bachem Feinchemikalien, Bubendorf, Switzerland), and the reaction mixture was incubated at 37 °C. The fluorescence of the samples was measured in a Multiscan Microplate Fluorimeter (FLUOstar optima, BMG Labtech, Offenburg, Germany) with the FLUOstar (version 1.32 R2, BMG Labtech) control system for processing of the data. The ACE-IA was expressed as the protein concentration required to inhibit 50% of the ACE activity (IC50). The percentage of ACE-inhibitory activity was calculated as 100 × (C − S)/(C − B). The protein concentration of the water-soluble extracts was determined by using the BCA protein assay (Pierce, Thermo Fisher Scientific Inc., Rockford, IL, USA). Analysis of the Bovine Skim Milk-Derived Hydrolysates by Reversed-Phase High-Performance Liquid Chromatography− Tandem Mass Spectrometry (RP-HPLC-MS/MS). The RP-HPLCMS/MS analysis of the supernatants obtained after growth of the recombinant Enterococcus spp. strains in BSM was performed on an Agilent 1100 HPLC System (Agilent Technologies, Waldbron, Germany) with column HiPore (RP318 C18 column 250 × 4.6 mm, 5 μm particle size; Bio-Rad, Richmond, CA, USA). The HPLC system was connected online to an Esquire 3000 quadrupole ion trap (Bruker Daltonik GmbH, Bremen, Germany) equipped with an electrospray ionization source, as previously described.15 Solvent A was a mixture of water/trifluoroacetic acid (1000:0.37, v/v), and solvent B contained acetonitrile/trifluoroacetic acid (1000:0.27, v/v). Peptides were eluted with a linear gradient of solvent B in A from 0 to 45% in 60 min at a flow rate of 0.8 mL/min. Different spectra were recorded over the mass/ charge (m/z) range of 100−1500. About five spectra were averaged in the MS and in the MS(n) analyses. The signal threshold to perform auto MS(n) analyses was 10000 (i.e., 5% of the total signal), and the precursor ions were isolated within a range of 4.0 m/z and fragmented with a voltage ramp from 0.35 to 1.4 V. The m/z spectral data were transformed to mass values by using the Data Analysis (version 3.0; Bruker Daltonik) control program. BioTools (version 2.1; Bruker 5557



Article

Daltonik) was used to process the MS(n) spectra for peptide identification and sequencing. Statistical Analysis. A nonlinear adjustment of the data obtained was performed to calculate the IC50 values with the program PRISM version 4.02 for Windows (GraphPad Software, Inc., San Diego, CA, USA), as previously described.32 The program gives the estimated value of the IC50 together with the standard error.

■

RESULTS Hydrolysis of Gelatin and Bovine Milk Proteins by E. faecalis Strains from Different Origins. E. faecalis strains from food, environmental, and clinical origins were evaluated for production of gelatinase and their caseinolytic activity. With the exception of E. faecalis P36, previously recorded as gelE+ and sprE+ but GelE−,27 all strains produced a clear zone of turbidity or hydrolysis after growth on TH-GEL and TH-BSM plates (Figure 1). These results suggest that production of GelE and SprE and/

Figure 1. Gelatin (a) and bovine casein hydrolysis (b) by E. faecalis strains of food, environmental, and clinical origin grown in Todd Hewitt-gelatin (TH-GEL) and Todd Hewitt-bovine skim milk (THBSM) plates, respectively: (1) E. faecalis DBH18; (2) E. faecalis QA53; (3) E. faecalis P4; (4) E. faecalis P36; (5) E. faecalis 3Er1; (6) E. faecalis H10.

Figure 2. Caseinolytic activity of recombinant E. faecalis P36, E. faecalis JH2-2, E. faecium AR24, E. hirae AR14, E. faecalis DBH18, and E. faecalis V583 ΔgelE strains transformed with plasmids pMG36c, pCG, pCGSP, and pCSP.

or mutations in the regulatory fsr genes for induction of the production of both proteases could play a role in the hydrolysis of gelatin and bovine milk proteins. Heterologous Production and Functional Expression of GelE and SprE by Recombinant Enterococcus spp. Strains. To determine the role of GelE and SprE in the caseinolytic activity of the E. faecalis strains during their growth in BSM, the genes encoding GelE (gelE) and SprE (sprE) in E. faecalis DBH18 were cloned in the protein expression vector pMG36c, containing the constitutive P32 promoter, to generate the plasmid-derived vectors pCG, pCSP, and pCGSP encoding gelE, sprE, and gelE-sprE, respectively. Transformation of the noncaseinolytic E. faecalis P36, E. faecalis JH2-2, E. faecium AR24, and E. hirae AR14 strains with the above cited plasmids showed halos of variable size, indicating casein hydrolysis, produced by Enterococcus spp. strains transformed with pCG or pCGSP but not with pMG36c or pCSP (Figure 2). The largest caseinolytic activity was observed in E. faecalis DBH18 transformed with pCG or pCGSP. A lower caseinolytic activity (10000 units were considered as major fragments. Accordingly, the RP-HPLCMS/MS analysis of the BSM-derived hydrolysates of the recombinant E. faecalis P36, E. faecalis JH2-2, E. faecium AR24, E. hirae AR14, and E. faecalis DBH18 strains with high ACE-IA allowed the identification of 38 major peptide fragments, 26 of which corresponded to bovine β-casein fragments and 12 to αs1casein fragments, including peptides with previously reported ACE-IA (Table 4).

■

DISCUSSION LAB produce a broad range of bioactive peptides including those with ACE-IA due to the activity of bacterial extracellular proteases, cell-envelope associated proteases, and intracellular peptidases.9,33 However, few studies have considered the role of LAB other than Lactobacillus spp., Lactococcus spp., and Streptococcus spp. in the production of peptides with ACE-IA due to the fermentation of milk and other proteinaceous food 5559



Article

Figure 3. Peptide profiles by RP-HPLC of supernatants of E. faecalis P36 (pCG) (a−d) and E. faecalis P36 (pCGSP) (e−h) grown in bovine skim milk for 0 h (a, e), 24 h (b, f), 48 h (c, g), and 96 h (d, h).

to degradation of high molecular mass peptides with synergistic ACE-IA.40,41 Peptide profiles of BSM-derived hydrolysates of E. faecalis P36 (pCG) and E. faecalis P36 (pCGSP) grown in BSM are shown in Figure 3. No hydrolysis of BSM, evidenced by the absence of peptide fragments, was observed after growth of E. faecalis P36 (pCSP) and E. faecalis P36 (pMG36c) in BSM (results not shown). However, similar peptide profiles were generated by E. faecalis P36 (pCG) and E. faecalis P36 (pCGSP), suggesting that the hydrolysis of bovine caseins seems not to be affected by the coexpression of gelE and sprE. Similarly, few modifications were observed in the BSM-derived major peptide profiles during the fermentation process, suggesting that most of the release of ACEIP takes place during the first 24 h of growth of the E. faecalis P36 strains transformed with pCG or pCGSP. RP-HPLC-MS/MS analysis of BSM-derived hydrolysates from recombinant Enterococcus spp. with high ACE-IA permitted the identification of 38 major peptide fragments, including peptides with previously reported ACE-IA, antihypertensive

for 48 h may be considered satisfactory for production of BSMderived hydrolysates with high ACE-IA (Table 3). Because GelE may be produced by E. faecalis strains carrying antibioticresistance genes and/or genes coding other potential virulence factors, other enterococci as the recombinant E. faecium and/or E. hirae strains developed in this work could be used as safer and alternative bacterial hosts for production of GelE. Moreover, given that the N-terminal signal peptide of GelE (SPGelE) drives the processing and transport of GelE out of the heterologous Enterococcus spp. producer cells, chimeras of the SPgelE genetically fused to other enzymes, proteins, or biologically active peptides could permit their processing, heterologous production, and functional expression by other enterococci and, possibly, many other LAB.39 E. faecalis DBH18 transformed with pCG or pCGSP originated larger halos of caseinolytic activity (Figure 2) but lower ACE-IA than the parent E. faecalis DBH18 (pMG36c) (Table 3). This lower ACE-IA of the transformed E. faecalis DBH18 derivatives with a higher production of GelE may be due 5560



Article

Table 4. Major Peptide Fragments in Supernatants of Recombinant Enterococcus spp. Strains Grown in Bovine Skim Milk obsd mass

calcd massa

protein fragment

peptide sequence

477.2 558.4 561.2 656.5 671.3 674.3 688.4 697.2 740.6 761.3 772.4 779.4 788.6 801.6 804.5 849.7 871.4 903.3 939.5 996.5 1037.4 1112.8 1172.5 1196.4 1281.8 1323.0 596.3 633.2 633.4 639.5 656.5 706.6 825.6 872.6 949.4 1002.8 1141.4 1218.8

477.266 558.309 561.320 656.397 671.383 674.331 688.434 697.299 740.393 761.403 773.386 779.498 788.425 801.519 804.391 849.478 871.568 903.462 939.473 996.619 1037.609 1112.614 1172.572 1196.688 1281.636 1322.799 596.314 633.356 633.378 639.341 656.477 706.409 825.431 872.462 949.505 1002.630 1141.515 1218.636

β-CN f(187−190) β-CN f(77−81) β-CN f(165−169) β-CN f(82−87) β-CN f(201−206) β-CN f(1−5) β-CN f(133−138) β-CN f(119−124) β-CN f(62−68) β-CN f(191−196) β-CN f(88−94) β-CN f(170−176) β-CN f(148−154) β-CN f(133−139) β-CN f(155−161) β-CN f(45−51) β-CN f(23−29) β-CN f(125−132) β-CN f(127−134) β-CN f(201−209) β-CN f(197−206) β-CN f(192−201) β-CN f(177−186) β-CN f(77−87) β-CN f(144−154) β-CN f(165−176) αs1-CN f(150−153) αs1-CN f(104−108) αs1-CN f(1−5) αs1-CN f(76−80) αs1-CN f(99−103) αs1-CN f(31−36) αs1-CN f(182−189) αs1-CN f(149−154) αs1-CN f(127−134) αs1-CN f(101−108) αs1-CN f(158−168) αs1-CN f(25−35)

IQAF LTQTP LSQSK VVVPPF VRGPFP RELEE LHLPLP FTESQS FPGPIPN LLYQEP LQPEVMG VLPVPQK HQPLPPT LHLPLPL VMFPPQS LQDKIHP ITRINKK LTLTDVEN LTDVENLH VRGPFPIIV VLGPVRGPFP LYQEPVLGPV AVPYPQRDMP LTQTPVVVPPF HHQPHQPLPPT LSQSKVLPVPQK FRQF YKVPQ RPKHP VEQKH LRLKK VFGKEK IPNPIGSE LFRQFY IHAQQKEP LKKYKVPQ LDAYPSGAWY VAPFPEVFGKE

previously described ACE-inhibitory peptidesb RDMPIQAF

VVVPPF VRGPFP LHLPLP VYPFPGIPIPN

LHLPLPL DKIHP

VRGPFPIIV VLGPVRGPFP

VVVPPF

KKYNVPQ

E. faecalis strainc 1 14 4, 6 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15 9 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 2, 5, 12, 13, 14, 15 14 7, 8, 11, 12, 15 9 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15 2, 3, 6, 13, 14 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15 9 9 1, 2, 5, 9, 10, 11, 12, 15 4, 7, 11 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15 9, 10 6, 13, 14 3, 4, 7, 8, 13, 14 1, 2, 4, 5, 10, 11, 12, 15 7, 8, 12, 13, 14, 15 11 8, 10, 11 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 7, 8, 10, 11 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 2, 7, 8, 9, 13, 14 2 2, 5, 8, 10, 11 1, 2, 3, 5, 7, 11, 12, 13, 14, 15 12 1, 3, 4, 5, 7, 11, 12, 13, 14, 15 11

a

Monoisotopic mass. bPreviously described ACE-inhibitory peptides with ACE-IA or sharing, at least, three C-terminal residues with those found in this study. cRecombinant strains: 1, E. faecalis P36 (pCG), 24 h; 2, E. faecalis P36 (pCG), 48 h; 3, E. faecalis P36 (pCG), 96 h; 4, E. faecalis P36 (pCGSP), 24 h; 5, E. faecalis P36 (pCGSP), 48 h; 6, E. faecalis P36 (pCGSP), 96 h; 7, E. faecalis JH2-2 (pCG), 48 h; 8, E. faecalis JH2-2 (pCGSP), 48 h; 9, E. faecium AR24 (pCG), 48 h; 10, E. hirae AR14 (pCG), 48 h; 11, E. hirae AR14 (pCGSP), 48 h; 12, E. faecalis DBH18 (pMG36c), 48 h; 13, E. faecalis DBH18 (pCG), 48 h; 14, E. faecalis DBH18 (pCGSP), 48 h; 15, E. faecalis DBH18 (pCSP), 48 h.

subject to variation due to complex interactions between growth of the enterococci and hydrolysis of their substrate. In this context, several β-casein-derived peptides such as VVVPPF, LHLPLP, and LHLPLPL or the αs1-casein-derived peptides, such as RPKHP, LRLKK, and YKVPQ, were present in the hydrolysates of all the active Enterococcus spp., whereas other BSM-derived peptides were less frequent (Table 4). Interestingly, all of the BSM-derived hydrolysates produced by E. faecalis DBH18 and the active recombinant E. faecalis, E. faecium, and E. hirae derivatives contained, at least, the ACE-IP peptides LHLPLP, LHLPLPL, and VVVPPF, the antihypertensive peptide LHLPLP, and the antioxidant peptide VLPVPQK. Most of the cleavage sites of the peptide fragments generated from β-casein and αs1-casein were located before the hydrophobic amino acid residues leucine (L), isoleucine (I), or phenylalanine (F) (Figure 4), as previously described for the

activity, and antioxidant activity. Peptides such as LQDKIHP, FPGPIPN, V VVPPF, LHLPLP, LHLPLPL, IQAF, VLGPVRGPFP, VRGPFP, and VRGPFPPIIV were generated from bovine β-casein, whereas others, such as LKKYKVPQ, were derived from bovine αs1-casein (Table 4). These peptide fragments are reported to be produced by E. faecalis strains from food, environmental, and clinical origins and show a high ACE-IA or share, at least, three C-terminal residues with those with known ACE-IA.15 Moreover, the peptide LHLPLP resistant to gastrointestinal proteases is a true competitive inhibitor of ACE and shows a potent antihypertensive activity in spontaneously hypertensive rats (SHR).42,43 On the other hand, the peptide VLPVPQK previously reported as antioxidant44 has been also identified among the major peptides present in most E. faecalis hydrolysates (Table 4). The major peptides identified in the BSM-derived hydrolysates may be 5561



Article

Figure 4. Location of the major peptides (doubled-ended arrows) identified in the primary sequences of β-casein (a) and αs1-casein (b) present in bovine skim milk (BSM)-derived hydrolysates originated by the gelatinase (GelE) produced by recombinant Enterococcus spp. encoding gelE and sprE from E. faecalis DBH18.

purified GelE produced by E. faecalis OG1-10.16 However, no glutamic acid (E)-Xaa cleavage fragments derived from a putative SprE proteolytic activity were detected.24 Consequently, the pattern of β-casein and αs1-casein breakdown and the release of bioactive peptides produced by the recombinant E. faecalis P36, E. faecalis JH2-2, E. faecium AR24, and E. hirae AR14, during growth in BSM, corresponds to the activity of the strongly hydrophobic metalloendopeptidase GelE from E. faecalis DBH18. It has been reported that the GelE+ phenotype of E. faecalis requires the concomitant presence of both the fsr and gelE genes and that loss of the GelE+ phenotype is usually attributed to a 23.9 kb chromosomal deletion involving fsrABC that likely results from horizontal gene transfer and recombination.19,45 However, in E. faecalis strains with apparently complete fsr and gelE loci, the Gel− phenotype also correlates with a specific nonsense codon in the FsrC protein, which prevents these isolates from sensing GBAP,19 whereas in certain E. faecalis strains, even in the absence of a functional fsr system, a basal level of GelE and SprE is produced.46 Furthermore, although the presence of a functional Fsr system and/or GelE production increases the severity of disease in animal, plant, and nematode models of E. faecalis infection, none of them are required for the organism to cause the disease.45 Accordingly, it may be considered that E. faecalis strain producers of GelE may play an additional role, not associated with virulence, in the production of bioactive peptides with human health connotations and potential biotechnological applications. To the best of our knowledge, the present study is the first to describe the genetic and biochemical implication of the GelE produced by E. faecalis in the production of BSM-derived

bioactive peptides with ACE-IA, antihypertensive, and antioxidant activities. These results may strengthen the potential of GelE in the production of BSM-derived peptides with human health connotations and potential biotechnological applications. Furthermore, safer LAB and other microbial hosts could be engineered as heterologous producers of GelE to determine the biotechnological, medical, and veterinary applications of bioactive peptides derived from the GelE-mediated fermentation and/or hydrolysis of BSM and many other food substrates.47−49

■

AUTHOR INFORMATION

Corresponding Author

*(P.E.H.) Mail: Departamento de Nutrición, Bromatologı ́a y Tecnologı ́a de los Alimentos, Facultad de Veterinaria, Universidad Complutense de Madrid (UCM), Avenida Puerta de Hierro s/n, 28040 Madrid, Spain. Phone: +34-913943752. Fax: +34-913943743. E-mail: [email protected]. Funding

This work was supported by Project AGL2012-34829 from the Ministerio de Economı ́a y Competitividad (MINECO), by Projects AGL2009-08348 and AGL2011-24643 from the Ministerio de Ciencia e Innovación (MICINN), by a CENIT project (2006−2009) from the MITC-CDTI, by Grant GR3510A from the BSCH-UCM, and by Grants S2009/AGR-1489 and P2013/ABI-2747 from the Comunidad de Madrid (CAM). L.G. holds a fellowship (FPU) from the Ministerio de Educación y Ciencia (MEC), J.B. held a research contract from the CAM, and J.J.J. was the recipient of a fellowship from the MICINN, Spain. 5562



Article

Notes

metalloendopeptidase (“gelatinase”) from Streptococcus faecalis (OG110). J. Biol. Chem. 1989, 264, 3325−3334. (17) Qin, X.; Singh, K. V.; Weinstock, G. M.; Murray, B. E. Effects of Enterococcus faecalis fsr genes on production of gelatinase and a serine protease and virulence. Infect. Immun. 2000, 68, 2579−2586. (18) Thomas, V. C.; Hiromasa, Y.; Harms, N.; Thurlow, L.; Tomich, J.; Hancock, L. E. A fratricidal mechanism is responsible for eDNA release and contributes to biofilm development in Enterococcus faecalis. Mol. Microbiol. 2009, 72, 1022−1036. (19) Teixeira, N.; Santos, S.; Marujo, P.; Yokohata, R.; Iyer, V. S.; Nakayama, J.; Hancock, L. E.; Serror, P.; Silva Lopes, M. F. The incongruent gelatinase genotype and phenotype in Enterococcus faecalis are due to shutting off the ability to respond to the gelatinase biosynthesis-activating pheromone (GBAP) quorum-sensing signal. Microbiology 2012, 158, 519−528. (20) Bourgogne, A.; Hilsenbeck, S. G.; Dunny, G. M.; Murray, B. E. Comparison of OG1RF and an isogenic fsrB deletion mutant by transcriptional analysis: the Fsr system of Enterococcus faecalis is more than activator of gelatinase and serine protease. J. Bacteriol. 2006, 188, 2875−2884. (21) Sánchez, J.; Basanta, A.; Gómez-Sala, B.; Herranz, C.; Cintas, L. M.; Hernán dez, P. E. Antimicrobial and safety aspects, and biotechnological potential of bacteriocinogenic enterococci isolated from mallard ducks (Anas platyrhynchos). Int. J. Food Microbiol. 2007, 117, 295−305. (22) Su, Y. A.; Sulavik, M. C.; He, P.; Mäkinen, K. K.; Mäkinen, P. L.; Fielder, S.; Wirth, R.; Clewell, D. B. Nucleotide sequence of the gelatinase gene (gelE) from Enterococcus faecalis subsp. liquefaciens. Infect. Immun. 1991, 59, 415−420. (23) Del Papa, M. F.; Hancock, L. E.; Thomas, V. C.; Perego, M. Full activation of Enterococcus faecalis gelatinase by a C-terminal proteolytic cleavage. J. Bacteriol. 2007, 189, 8835−8843. (24) Kawalec, M.; Potempa, J.; Moon, J. L.; Travis, J.; Murray, B. E. Molecular diversity of a putative virulence factor: purification and characterization of isoforms of an extracellular serine glutamyl endopeptidase of Enterococcus faecalis with different enzymatic activities. J. Bacteriol. 2005, 187, 266−275. (25) Holo, H.; Nes, I. F. High frequency transformation by electroporation of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 1989, 55, 3119−3123. (26) Citti, R. Aislamiento e identificación de bacterias lácticas bacteriocinogénicas de leches y quesos de búfala de Venezuela: actividad antimicrobiana y caracterización bioquı ́mica y genética de sus bacteriocinas. Ph.D. thesis, Universidad Complutense de Madrid, Madrid, Spain, 1989. (27) Eaton, T. J.; Gasson, M. J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. 2001, 67, 1628−1635. (28) Ruiz-Garbajosa, P.; Bonten, M. J.; Robinson, D. A.; Top, J.; Nallapareddy, S. R.; Torres, C.; Coque, T. M.; Canton, R.; Baquero, F.; Murray, B. E.; del Campo, R.; Willems, R. J. L. Multilocus sequence typing scheme for Enterococcus faecalis reveals hospital-adapted genetic complexes in a background of high rates of recombination. J. Clin. Microbiol. 2006, 44, 2220−2228. (29) Maguin, E.; Prévost, H.; Ehrlich, S. D.; Gruss, A. Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 1996, 178, 931−935. (30) Jönsson, M.; Saleihan, Z.; Nes, I. F.; Holo, H. Construction and characterization of three lactate dehydrogenase-negative Enterococcus faecalis V583 mutants. Appl. Environ. Microbiol. 2009, 75, 4901−4903. (31) Biswas, I.; Gruss, A.; Ehlrich, S. D.; Maguin, E. High-efficiency gene inactivation and replacement system for Gram-positive bacteria. J. Bacteriol. 1993, 175, 3628−3635. (32) Quirós, A.; Ramos, M.; Muguerza, B.; Delgado, M. A.; Miguel, M.; Aleixandre, A.; Recio, I. Identification of novel antihypertensive peptides in milk fermented with Enterococcus faecalis. Int. Dairy J. 2007, 17, 33− 41. (33) Hebert, E. M.; Mamone, G.; Picariello, G.; Raya, R. R.; Savoy, G.; Ferranti, P.; Addeo, F. Characterization of the pattern of αS1- and β-

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Dr. T. Eaton, Institute of Food Research, Norwich (UK), Dr. Rosa del Campo, Hospital Universitario Ramón y Cajal, Madrid (Spain), and Dr. Carmen Torres, Universidad de La Rioja, Logroño (Spain), for providing strains and Prof. I. F. Nes, Prof. D. B. Diep, and Z. Saleihan for help in obtaining E. faecalis V583 ΔgelE.

■

REFERENCES

(1) Hernández-Ledesma, B.; Contreras, M. M.; Recio, I. Antihypertensive peptides: production, bioavailability and incorporation into foods. Adv. Colloid Interface. Sci. 2011, 165, 23−35. (2) Mills, S.; Ross, R. P.; Hill, C.; Fitzgerald, G. F.; Stanton, C. Milk intelligence: mining milk for bioactive substances associated with human health. Int. Dairy J. 2011, 21, 377−401. (3) Martínez-Maqueda, D.; Miralles, B.; Recio, I.; HernándezLedesma, B. Antihypertensive peptides from proteins: a review. Food Funct. 2012, 3, 350−361. (4) Phelan, M.; Kerins, D. The potential role of milk-derived peptides in cardiovascular disease. Food Funct. 2011, 2, 153−167. (5) Contreras, M. M.; Carrón, R.; Montero, M. J.; Ramos, M.; Recio, I. Novel casein-derived peptides with antihypertensive activity. Int. Dairy J. 2009, 19, 566−573. (6) Ryan, J. T.; Ross, R. P.; Bolton, D.; Fitzgerald, G. F.; Stanton, C. Bioactive peptides from muscle sources: meat and fish. Nutrients 2011, 3, 765−791. (7) Yu, Z.; Yin, Y.; Zhao, W.; Chen, F.; Liu, J. Antihypertensive effect of angiotensin-converting enzyme inhibitory peptide RVPSL on spontaneously hypertensive rats by regulating gene expression of the renin− angiotensin system. J. Agric. Food Chem. 2014, 62 (4), 912−917. (8) Nielsen, M. S.; Martinussen, T.; Flambard, B.; Sørensen, K. I.; Otte, J. Peptide profiles and angiotensin-I-converting enzyme inhibitory activity of fermented milk products: effect of bacterial strain, fermentation pH, and storage time. Int. Dairy J. 2009, 19, 155−165. (9) Otte, J.; Lenhard, T.; Flambard, B.; Sørensen, K. I. Influence of fermentation temperature and autolysis on ACE-inhibitory activity and peptide profiles of milk fermented by selected strains of Lactobacillus helveticus and Lactococcus lactis. Int. Dairy J. 2011, 21, 229−238. (10) Franz, C. M. A. P.; Huch, M.; Abriouel, H.; Holzapfel, W.; Gálvez, A. Enterococci as probiotics and their implications in food safety. Int. J. Food Microbiol. 2011, 151, 125−140. (11) Willems, R. J. L.; Hanage, W. P.; Bessen, D. E.; Feil, E. J. Population biology of Gram-positive pathogens: high-risk clones for dissemination of antibiotic resistance. FEMS Microbiol. Rev. 2011, 35, 872−900. (12) Muguerza, B.; Ramos, M.; Sánchez, E.; Manso, M. A.; Miguel, M.; Aleixandre, A.; Delgado, M. A.; Recio, I. Antihypertensive activity of milk fermented by Enterococcus faecalis strains isolated from raw milk. Int. Dairy J. 2006, 16, 61−69. (13) Chaves-López, C.; Serio, A.; Matruscelli, M.; Papparella, A.; Osorio-Cadavid, E.; Suzzi, G. Microbiological characteristics of kumis, a traditional fermented Colombian milk, with particular emphasis on enterococci population. Food Microbiol. 2010, 28, 1041−1047. (14) Regazzo, D.; Da Dalt, L.; Lombardi, A.; Andrighetto, A.; Negro, A.; Gabai, G. Fermented milks from Enterococcus faecalis TH563 and Lactobacillus delbrueckii subsp. bulgaricus LA2 manifest different degrees of ACE-inhibitory and immunomodulatory activities. Dairy Sci. Tecnol. 2010, 90, 469−476. (15) Gútiez, L.; Gómez-Sala, B.; Recio, I.; del Campo, R.; Cintas, L. M.; Herranz, C.; Hernández, P. E. Enterococcus faecalis strains from food, environmental, and clinical origin produce ACE-inhibitory peptides and other bioactive peptides during growth in bovine skim milk. Int. J. Food Microbiol. 2013, 166, 93−101. (16) Mäkinen, P. L.; Clewell, D. B.; An, F.; Mäkinen, K. K. Purification and substrate specificity of a strongly hydrophobic extracellular 5563



Article

resistant Enterococcus faecalis. Antimicrob. Agents Chemother. 1989, 133, 1588−1591.

casein breakdown and release of a bioactive peptide by a cell envelope protease from Lactobacillus delbrueckii subsp. lactis CRL 581. Appl. Environ. Microbiol. 2008, 74, 3682−3689. (34) Gobbetti, M.; Di Cagno, R.; De Angelis, M. Functional microorganisms for functional food quality. Crit. Rev. Food Sci. Nutr. 2010, 50, 716−727. (35) Miclo, L.; Roux, E.; Genay, M.; Brusseaux, E.; Poirson, C.; Jameh, N.; Perrin, C.; Dary, A. Variability of hydrolysis of β-, αs1-, and αs2caseins by 10 strains of Streptococcus thermophilus and resulting bioactive peptides. J. Agric. Food Chem. 2012, 60, 554−565. (36) van de Guchte, M.; van der Vossen, J. M.; Kok, J.; Venema, G. Construction of a lactococcal expression vector: expression of hen egg white lysozyme in Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 1989, 55, 224−228. (37) Mohamed, J. A.; Murray, B. E. Influence of the fsr locus on biofilm formation by Enterococcus faecalis lacking gelE. J. Med. Microbiol. 2006, 55, 1747−1750. (38) Engelbert, M.; Mylonakis, E.; Ausubel, F. M.; Calderwood, S. B.; Gilmore, M. S. Contribution of gelatinase, serine protease, and fsr to the pathogenesis of Enterococcus faecalis endophtalmitis. Infect. Immun. 2004, 72, 3628−3633. (39) Borrero, J.; Jiménez, J. J.; Gútiez, L.; Herranz, C.; Cintas, L. M.; Hernández, P. E. Protein expression vector and secretion signal peptide optimization to drive the production, secretion, and functional expression of the bacteriocin enterocin A in lactic acid bacteria. J. Biotechnol. 2011, 156, 76−86. (40) Gobetti, M.; Ferranti, P.; Smacchi, E.; Goffredi, F.; Addeo, F. Production of angiotensin-I-converting-enzyme-inhibitory peptides in fermented milks started by Lactobacillus delbrueckii subsp. bulgaricus SS1 and Lactococcus lactis subsp. cremoris FT4. Appl. Environ. Microbiol. 2000, 66, 3898−3904. (41) Raghavan, S.; Kristinsson, H. ACE-activity of tilapia protein hydrolysates. Food Chem. 2009, 117, 582−588. (42) Miguel, M.; Recio, I.; Ramos, M.; Delgado, M. A.; Aleixandre, M. A. Antihypertensive effect of peptides obtained from Enterococcus faecalis-fermented milk in rats. J. Dairy Sci. 2006, 89, 3352−3359. (43) Quirós, A.; Contreras, M. M.; Ramos, M.; Amigo, L.; Recio, I. Stability to gastrointestinal enzymes and structure-activity relationship of β-casein-peptides with antihypertensive properties. Peptides 2009, 30, 1848−1853. (44) Rival, S. G.; Boeriu, C. G.; Wichers, H. J. Caseins and casein hydrolysates. 2. Antioxidative properties and relevance to lipoxygenase inhibition. J. Agric. Food Chem. 2001, 49, 295−302. (45) Galloway-Peña, J. R.; Bourgogne, A.; Qin, X.; Murray, B. E. Diversity of the fsr-gelE region of the Enterococcus faecalis genome but conservation in strains with partial deletions of the fsr operon. Appl. Environ. Microbiol. 2011, 77, 442−451. (46) Singh, K. V.; Nallaparedy, S. R.; Nannini, E. C.; Murray, B. E. Fsrindependent production of protease(s) may explain the lack of attenuation of an Enterococcus faecalis fsr mutant versus a gelE-sprE mutant in induction of endocarditis. Infect. Immun. 2005, 73, 4888− 4894. (47) Koyama, M.; Naramoto, K.; Nakajima, T.; Aoyama, T.; Watanabe, M.; Nakamura, K. Purification and identification of antihypertensive peptides from fermented buckwheat sprouts. J. Agric. Food Chem. 2013, 61, 3013−3021. (48) Liu, L.; Liu, L.; Lu, B.; Chen, M.; Zhang, Y. Evaluation of bamboo shoot peptide preparation with angiotensin converting enzyme inhibitory and antioxidant abilities from byproducts of canned bamboo shoots. J. Agric. Food Chem. 2013, 61, 5526−5533. (49) Estrada-Salas, P. A.; Montero-Morán, G. M.; Martínez-Cuevas, P. P.; González, C.; Barba de la Rosa, A. P. Characterization of antidiabetic and antihypertensive properties of canary seed (Phalaris canariensis L.) peptides. J. Agric. Food Chem. 2014, 62, 427−433. (50) Jacob, A.; Hobbs, S. J. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J. Bacteriol. 1974, 117, 360−372. (51) Sahm, D. F.; Kissinger, J.; Gilmore, M. S.; Murray, P. R.; Mulder, R.; Solliday, J.; Clarke, B. In vitro susceptibility studies of vancomycin5564


Genetic and Biochemical Evidence That Recombinant Enterococcus

Recommend Documents