Genotyping of Single-Nucleotide Polymorphisms by Primer Extension

Capillary electrophoresis combining three-step multiplex polymerase chain reactions for diagnosing α-thalassemia. Yen-Ling Chen. ELECTROPHORESIS 2011...
0 downloads 0 Views 359KB Size
Download PDF
Anal. Chem. 2007, 79, 395-402

Accelerated Articles

Genotyping of Single-Nucleotide Polymorphisms by Primer Extension Reaction in a Dry-Reagent Dipstick Format Ioannis K. Litos,† Penelope C. Ioannou,*,† Theodore K. Christopoulos,‡,§ Joanne Traeger-Synodinos,| and Emmanuel Kanavakis|

Laboratory of Analytical Chemistry, Department of Chemistry, Athens University, Athens 15771, Greece, Department of Chemistry, University of Patras, Patras 26500, Greece, Foundation for Research and Technology Hellas, Institute of Chemical Engineering and High Temperature Chemical Processes (FORTH/ICEHT), Patras 26504, Greece, and Medical Genetics Athens University, St. Sophia’s Children’s Hospital, Athens, Greece

The primer extension (PEXT) reaction is the most widely used approach to genotyping of single-nucleotide polymorphisms (SNPs). Current methods for analysis of PEXT reaction products are based on electrophoresis, fluorescence resonance energy transfer, fluorescence polarization, pyrosequencing, mass spectrometry, microarrays, and spectrally encoded microspheres. We report the first dry-reagent dipstick method that enables rapid visual detection of PEXT products without instrumentation. The method is applied to the analysis of six SNPs in the mannose-binding lectin gene (MBL2). The genomic region that spans each SNP of interest is amplified by PCR. Two primer extension reactions are performed with allelespecific primers (for one or the other variant nucleotide), which contain an oligo(dA) segment at the 5′-end. BiotindUTP is incorporated in the extended strand. The product is applied to the strip followed by immersion in the appropriate buffer. As the DNA moves along the strip by capillary action, it hybridizes with oligo(dT)-functionalized gold nanoparticles, such that only extended products are captured by immobilized streptavidin at the test zone, generating a red line. A second red line is formed at the control zone of the strip by hybridization of the nanoparticles with immobilized oligo(dA). The dipstick test is complete within 10 min. We analyzed six SNPs of the * To whom correspondence should be addressed. Tel: +30 210 7274574. Fax: +30 210 7274750. E-mail: [email protected]. † Athens University. ‡ University of Patras. § Foundation for Research and Technology Hellas. | Medical Genetics Athens University. 10.1021/ac061729e CCC: $37.00 Published on Web 12/08/2006

© 2007 American Chemical Society

mannose-binding lectin gene (MBL2) using genomic DNA from 27 patients, representing a total of 74 variant nucleotide positions. Patient genotypes showed 100% concordance with direct DNA sequencing data. The described PEXT-dipstick assay is rapid and highly accurate; it does not require specialized instrumentation or highly trained technical personnel. It is appropriate for a diagnostic laboratory where a few selected SNP markers are examined per patient with a low cost per assay.

Single-nucleotide polymorphisms (SNPs) are single-base changes that occur at specific positions in a genome and constitute the most common form of human genetic variation. SNP may affect gene function through amino acid substitution, modification of gene expression or alteration of gene splicing. SNPs are emerging as a new generation of markers for the diagnosis of disease, assessment of disease predisposition, pharmacogenetic analysis, and evolutionary studies.1-3 Amplification, usually by the polymerase chain reaction (PCR), of the genomic DNA region that spans the locus of interest is a central step of all SNP genotyping methods. Following PCR, there are four general genotyping strategies for discrimination of the two alleles:4-6 (a) Hybridization with allele-specific oligonucleotide (1) Collins, E.; Green, E. D.; Guttmacher, A. E.; Guyer, M. S. Nature 2003, 422, 835-47. (2) Kruglyak, L.; Nickerson, D. A. Nat. Genet. 2001, 27, 234-6. (3) Hirschhorn, J. N.; Daly, M. J. Nat. Rev. Genet. 2005, 6, 95-108. (4) Syvanen, A. C. Nat. Rev. Genet. 2001, 2, 930-42. (5) Kwok, P. Y. Annu. Rev. Genomics Hum. Genet. 2001, 2, 235-58. (6) Shi, M. M. Clin. Chem. 2001, 47, 164-72.

Analytical Chemistry, Vol. 79, No. 2, January 15, 2007 395

(ASO) probes under conditions (temperature, ionic strength, organic solvents) that favor perfect complementarity over mismatch binding. (b) Oligonucleotide ligation reaction, in which the target DNA is hybridized with allele-specific probes that bind adjacent to a common probe and have an allele-specific 3′- or 5′nucleotide. DNA ligase will join the probes only when they are perfectly complementary to the target sequence. (c) Invasive cleavage, which employs allele-specific probes containing a “tag” sequence at the 5′-end unrelated to the target. An invader probe hybridizes to the “tag” 5′ of the polymorphic site, and if there is a perfect match, a specific enzyme recognizes the overlapping structure formed and cleaves the 5′-segment of the allele-specific probe. (d) Primer extension (PEXT) reaction, which is the most commonly used approach to genotyping and is based on the high accuracy of nucleotide incorporation by DNA polymerase. A primer is designed to hybridize to the target sequence immediately 3′ of the polymorphic site and is extended by DNA polymerase with a single labeled ddNTP that is complementary to the nucleotide of the SNP. Alternatively, an allele-specific primer is used whose 3′-ends is complementary to the nucleotide at the polymorphic site. Under appropriate conditions, only the primers whose 3′-end perfectly matches the interrogated sequence are extended by the polymerase. Enzyme-based genotyping methods (b-d) are preferred because they provide higher specificity.4-6 The widespread acceptance of primer extension reaction lies in the fact that PEXT is robust; it only requires two oligonucleotides and can be easily optimized. Furthermore, it has been shown that PEXT offers 10 times higher genotype discrimination than hybridization with allele-specific oligonucleotide probes.7 Polyacrylamide gel electrophoresis and capillary electrophoresis have been used for analysis of the products of PEXT reactions with the use of primers that differ in size.8 In more recent heterogeneous assays, PEXT reactions are performed in the presence of ddNTP or dNTP labeled with a hapten or biotin. The extension products are immobilized on a solid support, such as microtiter wells or magnetic beads, and detection is carried out by adding antihapten antibody or (strept)avidin conjugated to an enzyme or photoprotein.9,10 Homogeneous assays of PEXT products are either based on fluorescence resonance energy transfer between primer and incorporated dNTP, which are modified with donor and acceptor dyes,11 or exploit the change of fluorescence polarization caused by the incorporation of fluorescent dNTP in the extension product.12 In the pyrosequencing method,13 primer extension is monitored by a luciferase-based chemiluminometric assay of the pyrophosphate that is released as a result of the incorporation of single dNTP added stepwise in the reaction mixture. Mass spectrometry (MALDI-TOF) has also been used (7) Pastinen, T.; Kurg, A.; Metspalu, A.; Peltonen, L.; Syvanen, A. C. Genome Res. 1997, 7, 606-14. (8) Pastinen, T.; Partanen, J.; Syvanen, A. C. Clin. Chem. 1996, 42, 1391-7. (9) Nikiforov, T. T.; Rendle, R. B.; Goelet, P.; Rogers, Y. H.; Kotewicz, M. L.; Anderson, S.; Trainor, G. L.; Knapp, M. R. Nucleic Acids Res. 1994, 22, 4167-75. (10) Zerefos, P. G.; Ioannou, P. C.; Traeger-Synodinos, J.; Dimissianos, G.; Kanavakis, E.; Christopoulos, T. K. Hum. Mutat. 2006, 27, 279-85. (11) Chem, X.; Kwok, P. Y. Nucleic Acids Res. 1997, 15, 347-53. (12) Kwok, P. Y. Hum. Mutat. 2002, 19, 315-23. (13) Alderbom, A.; Kristofferson, A.; Hammerling, U. Genome Res. 2000, 10, 1249-58.

396

Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

as a label-free method for detection of PEXT products.14 The number of SNPs studied per sample can be extended to thousands by using microarrays of allele-specific primers, incorporation of fluorescent nucleotides, and scanning the array.7,15 Alternatively, a suspension of spectrally encoded microspheres is used as a solid support for immobilization of the primers.16 Following PEXT reaction, the suspension is analyzed by flow cytometry. However, the optimization of multiplex PCR is the bottleneck of all highthroughput PEXT methods. High-throughput genotyping assays are necessary for carrying out large-scale association studies in which thousands of SNPs are analyzed in large numbers of patients for the identification of new markers of disease. It is expected, however, that in a clinical diagnostic setting a small number of selected SNP markers will be genotyped routinely for disease-related genes or genes encoding drug-metabolizing enzymes. Consequently, there is a need for simple and robust genotyping assays suitable for the routine clinical laboratory or even for bedside testing. Recently, we reported a novel DNA biosensor for the detection of PCR products in a dry-reagent dipstick format.17 The sensor allowed simple confirmation of the PCR products, but it was not suitable for genotyping studies. In the present work, we extend this study and report the first dry-reagent dipstick assay for SNP genotyping by primer extension. Contrary to the other genotyping methods described above, the proposed method enables visual detection of PEXT products, within minutes, without instrumentation. The extended product is applied directly to the strip without prior purification. Gold nanoparticles with oligo(dT) attached to their surface are used as reporters. As a model, we chose the genotyping of six SNPs of the mannose-binding lectin gene (MBL2), i.e., three structural mutations in exon 1 (c.154C>T, pArg52Cys; c.161A>G, p.Gly54Asp; c.170A>G, p.Gly57Glu), two SNPs at positions c.-619G>C and c.-290G>C (promoter region), and one SNP at position c.-66C>T of the 5′-untranslated region. In recent years, there has been a strong interest in mannosebinding lectin because it is an important component of the innate immune system and numerous reports have shown that its deficiency leads to increased susceptibility to various infections and autoimmune disorders.18-21 MATERIALS AND METHODS Instrumentation. PCR and primer extension reactions were performed in the MJ Research PTC-0150 thermal cycler (Watertown, MA). A digital camera, Kodak DC 120, and the Gel Analyzer software for DNA documentation were purchased from Kodak (14) Gut, I. G. Hum. Mutat. 2004, 23, 437-41. (15) Fortina, P.; Delgrosso, K.; Sakazume, T.; Santacroce, R.; Mouterau, S.; Su, H. J.; Graves, D.; McKenzie, S.; Surrey, S. Eur. J. Hum. Genet. 2000, 8, 884-94. (16) Bortolin, S.; Black, M.; Modi, H.; Boszko, I.; Kobler, D.; Fieldhouse, D.; Lopes, E.; Lacroix, J. M.; Grimwood, R.; Wells, P.; Janeczko, R.; Zastawny, R. Clin. Chem. 2004, 50, 2028-36. (17) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K.; Syriopoulou, V. Anal. Chem. 2003, 75, 4155-60. (18) Turner, M. W. Mol. Immunol. 2003, 40, 423-9. (19) Petersen, S. V.; Thiel, S.; Jensenious, J. C. Mol. Immunol. 2001, 38, 13349. (20) Ohlenschlaeger, T.; Garred, P.; Madsen, H. O.; Jacobsen, S. N. Engl. J. Med. 2004, 351, 260-7. (21) Yarden, J.; Radojkovic, D.; De Boeck, K.; Macek, M., Jr.; Zemkova, D.; Vavrova, V.; Vlietinck, R.; Cassiman, J. J.; Cuppens, H. J. Med. Genet. 2004, 41, 629-33.

Table 1. Oligonucleotides Used in the Present Study as Primers for PCR and PEXT sequence (5′f3′)

size (mer)

oligonucleotide

name

PCR primers 5′ primer (609-bp product) 3′ primer (609-bp product) 5′ primer (403-bp product) 3′ primer (403-bp product)

U609 D609 U403 D403

CTATATAGAAATAGATGACCCATC CCTGCCAGAAAGTAGAGAGG TCTGGAAGGTAAAGAATTGC AGTGTCACAAGGAATGTTTACTTT

24 20 20 24

genotyping primersa 3′ -550 (normal) 3′ -550 (mutant) 3′ -221 (normal) 3′ -221 (mutant) 5′ +4 (normal) 5′ +4 (mutant) 3′ CD52 (normal) 3′ CD52 (mutant) 5′ CD54 (normal) 5′ CD54 (mutant) 3′ CD57 (normal) 3′ CD57 (mutant)

N550 M550 N221 M221 N4 M4 N52 M52 N54 M54 N57 M57

(A)30GCTTCCCCTTGGTGTTTTAC (A)30GCTTCCCCTTGGTGTTTTAG (Α)27GGAAGACTATAAACATGCTTTCG (Α)27GGAAGACTATAAACATGCTTTCC (A)27ATTGTAGGACAGAGGGCATGCTG (A)27ATTGTAGGACAGAGGGCATGCTA (A)27TTTTCTCCCTTGGTGCCATCACC (A)27TTTTCTCCCTTGGTGCCATCACT (A)27CCAGGCAAAGATGGGCGTGATGC (A)27CCAGGCAAAGATGGGCGTGATGA (A)27CGTACCTGGTTCCCCCTTTTCTC (A)27CGTACCTGGTTCCCCCTTTTCTT

50 50 50 50 50 50 50 50 50 50 50 50

a For convenience, we have named the wild-type nucleotide sequences as “normal” or N and the variant nucleotide sequences as “mutant” or M.

(New York, NY). The TLC applicator, Linomat 5, and the software WinCats were from Camag (CH-4132 Muttenz, Switzerland). Reagents. QiaAmp DNA blood minikit and HotStar Taq Master Mix kit were from Qiagen (Hilden, Germany). Streptavidin from Streptomyces avidinii was purchased from Roche Diagnostics (Mannheim, Germany). Ultrapure 2′-deoxyribonucleoside 5′triphosphates (dNTPs) were purchased from Promega (Lyon, France). Biotin-11-dUTP was from Applichem (Darmstadt, Germany). Taq DNA polymerase Vent(exo-) was from New England Biolabs (Beverly, MA), and terminal transferase (TdT) was from MBI Fermentas (Vilnius, Lithuania). Sephadex G-25 Spin-pure purification columns were obtained from CPG (Lincoln Park, NJ). Gold nanoparticles (40 nm, 9 × 1010 particles/mL) were purchased from British Biocell (BB International, Cardiff, U.K.). Predator membranes were purchased from Pall and Gelman Co. (Port Washington, NY). The wicking pad, glass-fiber conjugate pad, and absorbent pad were from Schleicher & Schuell (Dassel, Germany). The oligonucleotides used in the present study were synthesized by the Research and Technology Institute (Irakleion, Crete, Greece) and Thermo Electron (Ulm, Germany). The sequence and use of each oligonucleotide are listed in Table 1. A 5′-thiolmodified (dT)30 oligonucleotide was used for conjugation with gold nanoparticles. A (dA)30 oligonucleotide was used for the construction of the dipstick’s control zone. All other common reagents were from Sigma (St. Louis, MO). Genomic DNA Isolation and Amplification of the MBL2 Gene. Genomic DNA was isolated from 200 µL of human whole blood using the QiaAmp DNA blood minikit. PCR was performed in a total reaction volume of 50 µL containing 2.5 units of HotStar Taq DNA polymerase, 1×PCR buffer, 1.5 mM MgCl2, 200 µM of each dNTP, 0.4 µM of each primer U609 and D609 or U403 and D403 for the amplification of 609- or 403-bp segment, respectively, and 50-100 ng of genomic DNA. The cycling parameters were as follows: initial denaturation at 95 °C for 15 min and 32 cycles of 95 °C for 1 min, 57 °C for 1 min and 72 °C for 1 min, and finally incubation at 72 °C for 8 min.

Primer Extension Reaction. All primer extension reactions were carried out in a total reaction volume of 20 µL, containing 20 mM Tris-HCl, pH 8.8, 10 mM (NH4)2SO4, 10 mM KCl, 1 mL/L Triton X-100, 1 mM MgSO4, 0.25 units of Vent (exo-) DNA polymerase, 0.2 pmol of amplified DNA, 2 pmol of the appropriate probe (normal or mutant), 2.5 µM each of dATP, dCTP, and dGTP, 1.875 µΜ dTTP, and 0.625 µΜ biotin-11-dUTP. Primer extension reactions for the detection of SNPs at positions -550 (c.-619G>C), +4 (c.-66C>T), CD52 (c.154C>T), CD54 (c.161A>G), and CD57 (c.170A>G) were performed in a thermal cycler as follows: an initial denaturation step at 95 °C for 5 min followed by three cycles of denaturation at 95 °C for 15 s and primer annealing/extension at 65 °C for 10 s, at 65 °C for 10 s, and 72 °C for 15 s. For the detection of the SNP at position -221 (c.-290G>C), the cycling parameters were as follows: 95 °C for 5 min, three cycles of 95 °C for 15 s, 55 °C for 10 s, and 72 °C for 15 s. All primer extension reaction products were subjected to a final denaturation step at 95 °C for 5 min and placed immediately on ice before the dipstick assay. Tailing of Probes with dTTP or dATP. The 5′-thiol-modified (dT)30 oligonucleotide and the (dA)30 oligonucleotide probes were elongated by tailing with dTTP and dATP, respectively, using terminal deoxynucleotidyl transferase (TdT). Both tailing reactions were performed in a total volume of 20 µL, containing 0.2 M potassium cacodylate (pH 7.2), 0.1 mM dithiothreitol, 0.1 mL/L Triton X-100, 1 mM CoCl2, 3.5 mM dTTP (or dATP), 30 units of TdT, and 700 pmol of probe. The mixture was incubated at 37 °C for 60 min and the reaction was terminated by the addition of 2 µL of 0.5 M EDTA (pH 8.0). The tailed 5′-thiol-modified poly(dT) probe was purified prior to use by size exclusion chromatography on Sephadex G-25 Spin-pure columns. The poly(dA) tailed probe was mixed with 1.5 µL of 40 mM N-methylmaleimide solution in DMSO (2.7 mM final concentration) and used without purification. The tailed probes were stored at -20 °C. Preparation of Dry Reagent Strip. The dry reagent strip (4 mm × 70 mm) consisted of a wicking pad, a glass-fiber Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

397

Figure 1. Schematic illustration of SNP genotyping by PEXT reaction in a dipstick format. PCR-amplified DNA fragments that span the SNP of interest are subjected to two PEXT reactions using normal and mutant primers in the presence of biotin-dUTP (B-dUTP). Both primers contain a poly(dA) segment at the 5′-end but differ in the final nucleotide at the 3′-end. Under optimized conditions, only the primer that has perfect complementarity with the target DNA will be extended by DNA polymerase and lead to a biotinylated extension product. The products of the PEXT reaction are applied to the strip and only the biotinylated extension products will be captured by immobilized streptavidin at the test zone. Oligo(dT)-functionalized gold nanoparticles hybridize with the oligo(dA) segments at the 5′-end of the immobilized extended products, thus leading to accumulation of the nanoparticles at the test zone of the strip and generation of a red line (lower line on strip). Excess of nanoparticles are captured at the control zone of the strip by immobilized oligo(dA) strands, generating a second red line (upper line on strip).

conjugate pad, a polyethersulfone diagnostic membrane, an absorbent pad, and a plastic adhesive backing. The strip was assembled as described previously.17 Streptavidin and poly(dA) probe solutions were used for the preparation of the “test zone” and the “control zone” on the diagnostic membrane, respectively. For this purpose, a solution containing 4 g/L streptavidin, 150 mL/L methanol, and 20 g/L sucrose was loaded at a density of 1.6 µg (∼27 pmol)/4-mm membrane using the TLC applicator. A solution containing 4 µM poly(dA)-tailed probe, 500 mL/L methanol, and 20 g/L sucrose was loaded at a density of 2.4 pmol/ 4-mm membrane. Poly(dT)-functionalized gold nanoparticles (diameter 40 nm) were prepared as described previously.17 The nanoparticles were loaded on the conjugate pad at a density of 3.75 fmol/4 mm. The membranes were dried in an oven for 20 min at 70 °C, and the strips were assembled. Dipstick Assay of Primer Extension Reaction Products. A 5-µL aliquot of the denatured PEXT reaction product was applied onto the conjugate pad next to the immobilized gold nanoparticles. The wicking pad was then dipped into a microcentrifuge tube containing 200 µL of 10 mM phosphate buffer (pH 7.4), 75 mM NaCl, 30 mL/L glycerol, and 10 g/L SDS. The visual detection of the extension products was complete within 10 min. The intensity of the test zone was determined densitometrically by scanning the strip with a Hewlett-Packard ScanJet 3400C desktop scanner. 398

Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

RESULTS AND DISCUSSION Assay Principle. The principle of SNP genotyping using primer extension reaction combined with a dry-reagent dipstick assay is schematically illustrated in Figure 1. A 609-bp fragment in the promoter region containing polymorphisms at the c.619G>C and c.-290G>C positions, and a 403-bp fragment spanning a polymorphism at position c.-66C>T, in the 5′-untranslated region as well as three point mutations at codons 52, 54, and 57 (c.154C>T, c.161A>G, c.170A>G), in exon 1 of the MBL2 gene, are amplified from genomic DNA by PCR. For the genotyping of each SNP, aliquots of the PCR product are subjected to two separate primer extension reactions catalyzed by Vent(exo-) DNA polymerase and using primers specific for each of the two allelic variants. Each primer consists of a sequence adjacent to the polymorphic site with the 3′-end nucleotide complementary to the allelic variant and a poly(dA) “tag” at its 5′-end, for hybridization with the poly(dT) conjugated gold nanoparticles. Thus, the two allele-specific genotyping primers differ only in the last 3′nucleotide. Due to the high accuracy of nucleotide incorporation by Vent(exo-) DNA polymerase, extension occurs only if the primer has perfectly complementary the last nucleotide at the 3′end with the target sequence. The specificity of dNTP incorporation is a property of most DNA polymerases. A critical requirement in PEXT assays is to choose a DNA polymerase that lacks 3′f5′ exonuclease activity. If present, exonuclease activity cleaves the

Figure 2. (A) Effect of the concentration of streptavidin on the intensity and width of the test zone. The strips are numbered according to the concentration of streptavidin in the aqueous application solution containing 150 mL/L methanol and 50 g/L sucrose): (1) 1, (2) 2, (3) 4, (4) 8, and (5) 16 g/L. The zone density was plotted against the concentration of streptavidin in the application solution. (B) Effect of the amount of PEXT reaction mixture applied to the strip. Strip numbering is based on the amount of target DNA applied to the strip. (1) 25, (2) 50, (3) 75, and (4) 100 fmol. The density of the test zone is also plotted vs the amount of applied DNA. (C) Effect of the amount of functionalized gold nanoparticles on the performance of the strip. The sample is a homozygote C/C at position -550 (c.-619G>C). Each pair of strips corresponds to PEXT reactions performed with the normal primer (left strip of the pair) and the mutant primer (right strip of the pair). Conjugated gold nanoparticle: (1) 1.5, (2) 3, (3) 3.75, (4) 4.5, and (5) 7.5 fmol.

last 3′-nucleotide at a mismatch and extends the remaining primer, thus always giving an extension product. In order to avoid this activity, we chose Vent(exo-). During polymerization, biotin-dUTP is incorporated into the extended primer. The denatured PEXT reaction product is applied to the conjugate pad of the strip, next to the gold nanoparticles that carry poly(dT) strands on their surface. The bottom part of the strip is immersed into the hybridization buffer. Because of the capillary action, the buffer migrates upward allowing poly(dA)/(dT) hybridization and linking of the PEXT product to the nanoparticles. The hybrids migrate along the strip to the “test” zone, where streptavidin is immobilized. If the primer has been extended, the hybrids are captured on the test zone via biotin-streptavidin interaction forming a red line of accumulated gold nanoparticles. The red color is due to the plasmon resonance peak of the gold nanoparticles at 520 nm.22,23 The incorporation of biotin-dUTP is essential for the capture of the hybrids to the test zone. If primer extension has not taken place, then the dA/dT hybridization occurs but the hybrids are not captured by streptavidin, and as a result, the nanoparticles do not accumulate at the test zone (no red line is observed). The solution migrates further along the strip passing the control zone where the excess nanoparticles are bound to (22) Weller, M. G.; Fresenius, J. Anal. Chem. 2000, 366, 635-45. (23) Hayat, M. A., Ed. Colloidal Gold: Principles, Methods, and Applications; Academic Press: San Diego, CA, 1989.

immobilized poly(dA) strands. The formation of a red band at the control zone indicates the proper performance of the strip. Optimization of the Dry-Reagent Strip. The amounts of streptavidin and poly(dA) probe loaded on the membrane of the strip, the concentration and composition of the application solutions for streptavidin and poly(dA) probe, the amount of gold nanoparticles loaded on the conjugate pad, and the amount of PEXT reaction product used for the detection were all optimized. All optimization studies were performed by analyzing PEXT reaction products for the -550 polymorphic site. PEXT reactions were carried out with 200 fmol of amplified “mutant” DNA (609 bp) and a 10-fold molar excess of the appropriate primers (N and M). Other reaction conditions are described in the Experimental Section. The formation of narrow, intense, and uniform bands of the reagents immobilized on the membrane strongly depends on both the concentration and the composition of the application solution.24 First, the effect of the composition of streptavidin solution on the performance of the DNA strip was studied. For this purpose, three different aqueous solutions containing 4 g/L streptavidin along with (a) no additives, (b) up to 50 g/L sucrose, and (c) 150 mL/L methanol were used to construct “test zones” of 1.6, 2.0, and 2.4 µg of streptavidin per strip (4-mm width). It was observed that (24) Jones, K. D. IVD Technol. 1999, 5, 3241-61.

Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

399

the addition of methanol in the application solution results in sharper zones with higher intensity. This is because the solubility of the protein decreases in the presence of methanol, thus preventing its diffusion on the membrane. The addition of 20 g/L sucrose was necessary for the stability of the strips during storage. At higher sucrose concentrations, however, the intensity of the zone decreases. The influence of the initial concentration of streptavidin solution on the width of the test zone containing 1.6 µg of streptavidin (∼27 fmol) was studied in the range 1-16 g/L. As the concentration of streptavidin increases, the volume of the solution that is required to deposit a certain amount of the protein per strip increases. It is observed (Figure 2A) that the width of the test zone decreases with increasing concentration of the protein solution, whereas its intensity increases with streptavidin concentration up to 4 g/L. For further experiments, a streptavidin solution of 4 g/L was chosen as the optimum. A similar study was performed with the application of poly(dA) probe for construction of the control zone. We found that the most intense zones were obtained with 2.4 pmol of poly(dA) probe/ strip that was applied by using a 4 µM aqueous solution of the probe containing 500 mL/L methanol and 20 g/L sucrose. Next, the effect of the amount of PEXT reaction product on the performance of the strip was studied. Various aliquots of the product, in the range of 2.5-10 µL, were applied on the strip and the results are presented in Figure 2B, which also shows the data from densitometric analysis of the test zones. We observe that the intensity of the test zone increases with increasing amounts of PEXT reaction product up to 5 µL (50 fmol with respect to DNA), because more extended primer is available for capture on the test zone. At higher amounts of product, however, the zone intensity remains practically constant due to saturation of immobilized streptavidin. It should be noted that the free (unincorporated) biotin-dUTP is also captured by streptavidin. The amount of poly(dT) conjugated gold nanoparticles required for optimum discrimination between a positive and a negative test (extended and nonextended PEXT reaction product) was studied in the range of 1.5-7.5 fmol of particles/strip. The amount of gold nanoparticles was calculated by the nominal concentration (provided by the manufacturer) and the volume of the nanoparticle solution dispensed per strip. The results are presented in Figure 2C. The intensity of the test zone obtained with the extended PEXT reaction product increases with the number of loaded nanoparticles. However, if the number becomes higher than 3.75 fmol, the excess of nanoparticles is not removed efficiently from the zone, leading to the appearance of a nonspecific band. Thus, 3.75 fmol of nanoparticles/strip was selected for the optimized protocol. Optimization of the PEXT Reaction. We carried out optimization studies of the primer extension reaction using the optimized DNA strip for detection of the products. The parameters examined include Mg2+ concentration, annealing temperature, number of PEXT reaction cycles, ratio of biotin-dUTP/dTTP, amount of target DNA, and primer-to-target molar ratio. Mg2+ is necessary for the activity of DNA polymerase, and its concentration affects critically the specificity of the PEXT reaction. The effect of Mg2+ concentration was studied in the range of 0.53 mM, and the results are presented in Figure 3. The intensity of the test zone increases with Mg2+ concentration. At a Mg2+ 400 Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

Figure 3. Effect of the concentration of Mg2+ in the PEXT reaction mixture. The sample is a homozygote C/C at position -550 (c.-619G>C). Each pair of strips corresponds to PEXT reactions performed with the 3′ “G” primer (left strip of the pair) and the 3′ “C” primer (right strip of the pair). (1) 0.5, (2) 1.0, (3) 1.5, (4) 2.0, (5) 2.5, and (6) 3.0 mmol/L. In the lower panel, the density of the test zone is plotted against the concentration of Mg2+ in the PEXT reaction mixture for both PEXT reaction products, i.e., with the 3′ “G” primer and the 3′ “C” primer. The ratio of the test zone densities obtained with the 3′ “G” and the 3′ “C” primers (called M/N for convenience) is also plotted as a function of Mg2+ concentration.

concentration higher than 1 mM, however, there is a significant increase of the nonspecific signal, which is due to “illegitimate” extension of mismatched primers. The annealing temperature of the PEXT reaction is another crucial parameter that determines the specificity of the extension reaction. The annealing temperature was studied separately for each SNP, and the optimum was found to be 65 °C for -550, +4, CD52, CD54, and CD57 positions and 55 °C for the -221 position. It was observed that at lower annealing temperatures there is an increase of the nonspecific signal due to nonspecific extension, whereas at higher temperatures the specific signal decreases significantly. The effect of the PEXT reaction cycle number on the intensity of the test zone was studied for one, three, and six cycles. We observed (see Figure 4A) that the intensity of the test zone increases with the number of cycles, whereas there is no effect on the nonspecific signal. A clearly distinguishable specific signal is observed even by performing one PEXT reaction cycle. As a compromise between zone intensity and the time required performing the PEXT reaction we chose three cycles for further experiments. The influence of the biotin-dUTP/dTTP molar ratio was investigated at ratios of 25/75, 50/50, 75/25, and 100/0. According

Figure 4. (A) Different number of cycles in PEXT reaction. The sample is a homozygote C/C at position -550 (c.-619G>C). The left and right strips of each pair correspond to PEXT reactions with normal and mutant primer, respectively. Number of cycles: (1) 1, (2) 3, and (3) 6. (B) Effect of the amount of amplified DNA in the PEXT reaction. The sample is a homozygote C/C at position -550 (c.-619G>C). The left and right strips of each pair correspond to PEXT reactions with normal and mutant primer, respectively. DNA amount (fmol): (1) 50, (2) 100, (3) 200, (4) 300, (5) 400, and (6) 500. (C) Effect of the primer/target DNA ratio in the PEXT reaction mixture. The sample is a homozygote C/C at position -550 (c.-619G>C). The left and right strips of each pair correspond to PEXT reactions with the 3′ “G” primer and the 3′ “C” primer, respectively. Primer/target DNA ratios: (1) 1.25, (2) 2.5, (3) 5, (4) 10, (5) 20, (6) 25, and (7) 30.

Figure 5. Application of the proposed PEXT-dipstick method to the genotyping of SNPs at the following positions: (A) -550, c.-619G>C. (B) -221, c.-290G>C. (C) +4, c.-66C>T. (D) exon 1, codon 52, c.154C>T. (E) exon 1, codon 54, c.161A>G. (F) exon 1, codon 57, c.170A>G.

to the results, there is no significant effect of the ratio on the zone intensity. Thus, a 25/75 ratio was selected. We studied the effect of the amount of target DNA as well as the primer/target DNA molar ratio on the ability of the PEXT dipstick assay to discriminate two alleles. A series of PEXT reactions were set up using a constant amount of primer (1 pmol) and varying amounts of target DNA in the range of 50-500 fmol.

It was observed (Figure 4B) that the intensity of the test zone increases with increasing amount of target DNA up to 300 fmol and then remains practically constant. Another series of PEXT reactions was performed using a constant amount of target DNA (200 fmol) and varying primer/target molar ratios in the range of 1.25-30. The results are presented in Figure 4C. The intensity of the test zone increases with increasing primer/target ratio up to Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

401

a ratio of 25 as a result of the improved kinetics and yield of the PEXT reaction. At higher ratios, the zone intensity decreases slightly due to competition between the excess of primer (carrying a (dA)30 segment at the 5′-end) and the extended product for hybridization with poly(dT) strands attached on the surface of gold nanoparticles. Genotyping of Single-Nucleotide Polymorphisms in the MBL2 Gene. The proposed PEXT-dipstick assay was evaluated by analyzing SNPs in the MBL2 gene at positions -550 and -221 (c.-619G>C and c.-290G>C) (17 samples), SNP at position +4 (c.-66C>T), and three structural mutations in exon 1 at codons 52, 54, and 57 (c.154C>T, pArg52Cys; c.161A>G, p.Gly54Asp; c.170A>G, p.Gly57Glu) (10 samples), i.e., a total of 74 variant nucleotide positions. The results for each polymorphic site are presented in Figure 5. The results were fully concordant with those previously obtained by direct DNA sequencing.10 The reproducibility of the detection of the alleles by the dipstick assay, given by the coefficient of variation of the densitometric signal obtained from the test zone for an extended PEXT reaction product, was found to be 9.9% (n ) 4). The overall reproducibility of the method (including the PEXT reaction and the dipstick assay) was assessed by analyzing, 6 times, PCR products from genomic DNA and was found to be 7.2%. MBL2 genotyping has been accomplished by various methods including restriction enzyme analysis of PCR products:25 ASO hybridization with radioactive probes,25 nondenaturing polyacrylamide gel electrophoresis,26 denaturing gradient gel electrophoresis,27 spott-blotting of PCR fragments and ASO hybridization,28 amplification refractory mutation system,29,30 and real-time PCR (25) Madsen, H. O.; Garred, P.; Kurtzhals, J. A. L.; Lamm, L. U.; Ryder, L. P.; Thiel, S.; Svejgaard, A. Immunogenetics 1994, 40, 37-44. (26) Jack, D.; Bidwell, J.; Turner, M.; Wood, N. Hum. Mutat. 1997, 9, 41-6.

402

Analytical Chemistry, Vol. 79, No. 2, January 15, 2007

combined with melting temperature curve analysis.31 Many of the above methods are either time-consuming or very expensive. The only PEXT-based method for SNP in the MBL2 gene was reported recently by our group,10 and the products were analyzed by a microtiter well-based bioluminometric assay using the photoprotein aequorin as reporter. The proposed PEXT-dipstick assay offers the following distinct advantages: (a) It enables visual detection of PEXT products and genotype assignment without the need for specialized instrumentation. (b) The assay does not require the incubation and washing steps that are necessary for microtiter well-based assays. (c) It is very simple to perform and does not require training of highly qualified technical personnel. We anticipate that the PEXT-dipstick method will be appropriate for diagnostic laboratories that focus on the genotyping of a few selected SNP markers for each disease. ACKNOWLEDGMENT We thank Gerasimos Dimissianos for assisting in the sequencing reactions to characterize the samples used in this study.

Received for review September 14, 2006. Accepted November 17, 2006. AC061729E (27) Gabolde, M.; Muralitharan, S.; Besmond, C. Hum. Mutat. 1999, 14, 803. (28) Boldt, A. B. W.; Petzl-Erler, M. Hum. Mutat. 2002, 19, 296-306. (29) Sullivan, K. E.; Wooten, C.; Goldman, D.; Petri, M. Arthritis Rheum. 1996, 39, 2046-51. (30) Steffensen, R.; Thiel, S.; Varming, K.; Jersild, C.; Jensenius, J. C. J. Immunol. Methods 2000, 241, 33-42. (31) Steffensen, R.; Hoffmann, K.; Varming, K. J. Immunol. Methods 2003, 278, 191-9.