GMI, an Immunomodulatory Protein from Ganoderma microsporum

Subscriber access provided by STEVENS INST OF TECH

Article

GMI, an immunomodulatory protein from Ganoderma microsporum, potentiates cisplatin-induced apoptosis via autophagy in lung cancer cells I-Lun Hsin, Chu-Chyn Ou, Ming-Fang Wu, Ming-Shiou Jan, Yi-Min Hsiao, Ching-Hsiung Lin, and Jiunn Liang Ko Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/mp500840z • Publication Date (Web): 26 Mar 2015 Downloaded from http://pubs.acs.org on March 30, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 45

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

GMI, an immunomodulatory protein from Ganoderma microsporum, potentiates cisplatin-induced apoptosis via autophagy in lung cancer cells I-Lun Hsin1, Chu-Chyn Ou2, Ming-Fang Wu1,3,4, Ming-Shiou Jan5,6, Yi-Min Hsiao7, Ching-Hsiung Lin3, 8, 9* and Jiunn-Liang Ko1, 3, 4* 1 Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan 2

School of Nutrition, Chung Shan Medical University, Taichung, Taiwan School of Medicine, Chung Shan Medical University, Taichung, Taiwan

3 4

Department of Medical Oncology and Chest Medicine, Chung Shan Medical University Hospital, Taichung, Taiwan

5

Institute of Microbiology and Immunology, Chung Shan Medical University, Taichung,

Taiwan Division of Allergy, Immunology, and Rheumatology, Chung Shan Medical University, Taichung, Taiwan 7 Department of Medical Laboratory Science and Biotechnology, Central Taiwan University of Science and Technology, Taichung 40601, Taiwan 8 Division of Chest Medicine, Department of Internal Medicine, Changhua Christian Hospital, Changhua, Taiwan 9 Department of Respiratory Care, College of Health Sciences, Chang Jung Christian University, Tainan, Taiwan

6

Running title: GMI-mediated autophagy enhances cisplatin-induced apoptosis

*Correspondence to: Jiunn-Liang Ko and Ching-Hsiung Lin Institute of Medicine Chung Shan Medical University 110, Sec. 1, Chien-Kuo N. Road, Taichung, Taiwan 40203 Tel:(886-4) 24730022-11694 Fax:(886-4) 24751101 E-mail: [email protected], [email protected]

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Cisplatin-based therapy is common to the treatment of several types of cancers, including lung cancers. In our previous study, GMI, an immunomodulatory protein cloned from Ganoderma microsporum, induced a cytotoxic effect in lung cancer cells via autophagy. The aim of this study is to examine the role of GMI in enhancing cisplatin-mediated cell death. Based on MTT assay and combination index, GMI and cisplatin co-treatment induced a synergistic cytotoxic effect. GMI and cisplatin-induced apoptosis was determined by sub-G1, nuclear condensation and annexin-V/propidium iodide analyses. On Western blot, expressions of γH2AX and cleaved forms of PARP, caspase-3 and caspase-7 were induced by combined treatment. Akt/mTOR pathway activity, LC3-II expression, and acidic vesicular organelle development demonstrated that cisplatin does not abolish GMI-mediated autophagy. Cyto-ID Green/hoechst 33342 double staining and time dependent experiment indicated that GMI and cisplatin-treated A549 cells simultaneously express autophagosomes and apoptotic nuclei. To elucidate the role of autophagy in inducing apoptosis by GMI and cisplatin, chemical inhibitors and LC3 shRNA were used to inhibit autophagy. The results showed that 3-methyladenine decreases, while chloroquine increases, GMI and cisplatin co-treatment-induced cleavage of caspase-7 and PARP. LC3 silencing abolished activation of apoptosis in A549 cells. Caspase inhibitors and caspase-7 silencing mitigated GMI and cisplatin-elicited cell viability inhibition and apoptosis. This is the first study to reveal the novel function of GMI in potentiating cisplatin-mediated apoptosis. GMI and cisplatin induce apoptosis via autophagy/caspase-7-dependent and survivin- and ERCC1-independent pathway. GMI may be a potential cisplatin adjuvant against lung cancer.

Key words: Apoptosis, Autophagy, Caspase-7, Cisplatin, GMI Abbreviations: 3-MA, 3-methyladenine; ATGs, autophagy-related genes; PI, propidium iodide


Page 2 of 45

Page 3 of 45

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Lung cancer is one of the most common malignancies in the world and a leading cause of cancer-related death in men and women. Up to 85% of lung cancers are non-small cell lung cancer (NSCLC).1 Despite advanced medical therapy, the outcome of NSCLC patients remains poor. Apoptosis and autophagy are two types of programed cell death.2 Apoptosis can be triggered by intrinsic and extrinsic pathways. Caspase cascade activation is the key mechanism of apoptotic induction. Autophagy is a cellular self-digestion process through lysosomal degradation pathway that is activated as an adaptive response to stress and that promotes cell survival. Chemotherapy-induced autophagy mediates adaptive resistance. Inhibition of autophagy is a promising treatment in cancer 4

therapy.3 Autophagic cell death can be induced by high level of autophagy. It has been documented that apoptosis and autophagy are mutually inhibitory.5 However, autophagy-induced apoptosis has also been reported.6 Platinum-based therapy is commonly used in several types of cancers, including lung cancers.7 The prominent anticancer effects of cisplatin are induction of DNA damage and mitochondrial apoptosis.8 The intrinsic and adaptive resistances of tumor cells lower the efficacy of cisplatin.9 Nucleotide excision repair (NER), Akt, NF-κB and autophagy are involved in cisplatin resistance.3, 10-12 ERCC1, which participates in NER, plays an important role in cisplatin resistance in lung cancer.13 In non-small cell lung cancer, ERCC1-negative tumors benefit from cisplatin-based therapy.14 Cisplatin can cause side effects that affect patient quality of life, such as nephrotoxicity, ototoxicity and myelosuppresion.15 New strategies are needed to improve the therapeutic efficacy and side effects of cisplatin in NSCLC patients. Fungal immunomodulatory proteins (FIPs) are one functional family of Lingzhi components with anticancer effects. Lingzhi-8 (LZ-8), an immunomodulatory protein



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

from Ganoderma lucidum, inhibits proliferation of lung cancer cells and induces death of gastric cancer cells.16, 17 FIP-gts, an immunomodulatory protein from Ganoderma tsugae, induces telomerase inhibition and premature senescence in lung cancer cells.18, 19 FIP-gts also promotes autophagic cell death in cisplatin-resistant urothelial cancer cells.20 In our previous study, GMI, an immunomodulatory protein from Ganoderma microsporum, inhibited EGF- and TNF-α-induced metastatic ability of lung cancer cells.21, 22 We have also demonstrated that oral administration of GMI inhibits tumor growth by inducing autophagy and that GMI induces autophagic cell death via abundant autophagosome accumulation stress (referred to as AAA stress) in lung cancer cells.23, 24 Chemotherapy is the principal cancer treatment strategy. However, the effective dose of chemotherapy is often accompanied by side effects. FIPs have many benefits in cancer therapy, including modulation of immunity and inhibition of tumor progression. The aim of this study is to examine the effect of GMI on cisplatin-induced cytotoxicity. Our findings provide new insight into apoptotic induction by GMI and cisplatin via autophagy-dependent caspase-7 activation.


Page 4 of 45

Page 5 of 45

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Materials and methods Cell lines and chemicals A549 cells (ATCC, CCL-185) and CaLu-1 cells (ATCC, HTB-54) were obtained from the American Type Culture Collection and maintained as previously described 23. Cisplatin (P4394, Sigma), 3-methyladenine (3-MA) (M 9281, Sigma) and chloroquine diphosphate salt (C 6628, Sigma) were purchased from Sigma (St. Louis, MO, USA). Z-VAD-FMK (FMK001, R&D), Z-DEVD-FMK (FMK004, R&D), Z-VEID-FMK (FMK006, R&D) and Z-LEHD-FMK (FMK008, R&D) were purchased from R&D (Minneapolis, MN, USA).

Expression and purification of GMI protein GMITM, produced by Mycomagic Biotechnology Co., Ltd. (Taipei, Taiwan), was generated and ameliorated from G. microsporum. The protocol for GMI expression and extraction has been described in our previous study.21

MTT assay and combination index Lung cancer cells (5×103/well) were seeded onto 96-well plates containing 100 µl of culture medium. Following concurrent treatment with GMI and cisplatin for 48 h, the medium was removed and 100 µl of fresh medium containing 0.5 mg/ml MTT (Sigma, M 2128) were added to the wells. MTT assay was performed as described elsewhere.23 Combination Index was calculated using CalcuSyn software (Biosoft, Ferguson, MO, USA).

Clonogenic assay A total of 1.5×102 A549 cells were seeded onto 6-well plates containing 2 ml of culture medium. After 24 h incubation, medium was carefully removed and 2 ml of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

fresh medium containing various concentrations of GMI and cisplatin were added to the wells. After 24 h treatment, the drug-containing medium was removed and 5 ml of fresh medium were added to the wells, followed by incubation for 14 days. The cells were then fixed with 95% ethanol and stained with a 20% Giemsa solution (1.09204.0500, Merck, Darmstadt, Germany).

Sub-G1 population analysis using propidium iodide staining After treatment of GMI and cisplatin, A549 and CaLu-1 cells were fixed using cooled 70% ethanol and stained with propidium iodide. The sub-G1 phase fraction was analyzed by flow cytometry. The complete protocol has been described in a previous study.25

Nuclear condensation analysis A total of 2×105 A549 cells were seeded onto 6-well plates. After GMI and cisplatin treatment for 48 h, cells were fixed with 95% ethanol, permeabilized with 0.1% Triton X-100 and stained with DAPI (D1306, Life Technologies, Carlsbad,CA, USA) solution. Then, the cells were observed under fluorescence microscope. A minimum of 100 cells per treatment in three independent experiments were counted to quantify the percentages of cells with apoptotic nuclei.

Annexin V/Propidium iodide apoptosis assay Annexin V-FITC Apoptosis Detection Kit (AVK250, Strong Biotech Corp., Taipei, Taiwan) was purchased from Strong Biotech Corporation. Annexin V and propidium iodide (PI) staining were performed according to the manufacturer’s instructions. Stained cells were analyzed by flow cytometry and CellQuest software.


Page 6 of 45

Page 7 of 45

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Western blot assay Anti-LC3 (AM1800a, Abgent, San Diego, CA, USA), anti-ATG5 (AP1812b, Abgent, San Diego, CA, USA), anti-phospho-p70S6K Thr389 (ab32359, Abcam, San Francisco, USA), anti-ERCC1 (＃3885, Cell Signaling, Danvers, MA, USA), anti-survivin (＃2808, Cell Signaling, Danvers, MA, USA), anti-PARP (＃9542, Cell Signaling, Danvers, MA, USA), anti-cleaved caspase-3 (＃9661, Cell Signaling, Danvers, MA, USA), anti-cleaved caspase-7 (＃9491, Cell Signaling, Danvers, MA, USA), anti-phospho-Akt Ser473 (＃9271, Cell Signaling, Danvers, MA, USA), anti-Akt (＃9272, Cell Signaling, Danvers, MA, USA), anti-Beclin-1 (＃3495, Cell Signaling, Danvers, MA, USA), anti-ATG12 (＃4180, Cell Signaling, Danvers, MA, USA), anti-γH2AX (＃05-636, Millipore, Billerica, MA, USA) and anti-β-actin (AC-40, Sigma, St. Louis, MO, USA) were used to detect the expressions of LC3, ATG5, phospho-p70S6K, PARP, cleaved caspase-3, cleaved caspase-7, phospho-Akt, Akt, Beclin-1, ATG12 (ATG12-ATG5 complex), γH2AX and β-actin, respectively. The complete protocol for Western blot analysis has been described elsewhere.26

Cyto-ID Green autophagy detection assay The formation of autophagosomes was analyzed using Cyto-ID® Autophagy Detection Kit (ENZ-51031-K200, Enzo Life Sciences, Farmingdale, NY, USA). Briefly, 1×105 A549 cells were seeded onto 24-well plates. GMI and cisplatin-treated cells were stained with Cyto-ID® Green Detection Reagent and Hoechst 33342 Nuclear Stain for 20 min and observed under fluorescence microscope. A minimum of 100 cells per treatment in three independent experiments were counted to quantify the percentages of cells with autophagosomes and apoptotic nuclei.

VSV-G pseudotyped lentivirus–shRNA system



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RNAi reagents were obtained from the National RNAi Core Facility, located at the Institute of Molecular Biology/Genomic Research Center, Academia Sinica, which is supported by the National Research Program for Genomic Medicine Grants of the National Science Council (NSC97-3122-B-001-016). VSV-G pseudotyped lentivirus–shRNA production and infection Lentiviral infection of A549 cell line led to stable integration and expression of short hairpin RNA (shRNA) targeting the LC3 and caspase-7 mRNA sequences. The detailed steps of lentivirus production and infection have been previously described.23 Individual clones were identified by their unique TRC number: shLuc TRCN0000072246 for vector control targeted to luciferase; shLC3 (87) TRCN0000243387 (responding sequence: GGTGATCATCGAGCGCTACAA) and shLC3 (91) TRCN0000243391 (responding sequence: AGCGAGTTGGTCAAGATCATC) targeted to LC3; and shcaspase-7 (72) TRCN0000320872 (responding sequence: GTATGTCTGTTACCTTGTTAA) and shcaspase-7 (45) TRCN0000320945 (responding sequence: TACTTCAGTCAATAGCCATAT) targeted to caspase-7.

Statistical analysis Statistical comparisons between two groups were conducted using One-sample t-test by Predictive Analytics SoftWare (PASW) Statistics 18. P values of

GMI, an Immunomodulatory Protein from Ganoderma microsporum

Recommend Documents