Gold Nanoclusters-Mediated Efficient Delivery of Cas9 Protein through

Subscriber access provided by Nottingham Trent University

Biological and Medical Applications of Materials and Interfaces

Gold Nanoclusters-Mediated Efficient Delivery of Cas9 Protein through pH-Induced Assembly-Disassembly for Inactivation of Virus Oncogenes Enguo Ju, Tingting Li, Suzane Ramos da Silva, and Shou-jiang Gao ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b12335 • Publication Date (Web): 30 Aug 2019 Downloaded from pubs.acs.org on August 30, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Gold Nanoclusters-Mediated Efficient Delivery of Cas9 Protein through pH-Induced Assembly-Disassembly for Inactivation of Virus Oncogenes

Enguo Ju1, Tingting Li1, Suzane Ramos da Silva1, Shou-Jiang Gao*,1 1Cancer

Virology Program, UPMC Hillman Cancer Center, Department of

Microbiology and Molecular Genetics, University of Pittsburgh, Pittsburgh, PA 15232 (USA). E-mail: [email protected]

Keywords:

CRISPR/Cas9, gold nanoclusters, self-assembly, virus oncogene,

cancer therapy

Abstract: The CRISPR/Cas gene editing system has been successfully applied to combating bacteria, cancer, virus, and genetic disorders. While viral vectors have been used for the delivery of the CRISPR/Cas9 system, the time required for insert cloning, and virus packaging and standardization hinders its efficient use. Additionally, the high molecular weight of the Cas9 endonuclease makes it not easy for packing in the vehicles. Herein, we report the self-assembly of gold nanoclusters (AuNCs) with SpCas9 protein (SpCas9-AuNCs) at the physiological condition and efficient delivery of SpCas9 into the cell nucleus. This assembly process is highly dependent on pH. SpCas9-AuNCs is stable at a higher pH but is disassembled at a lower pH. Significantly, this assembly-disassembly process facilitates the delivery of SpCas9 into cells and cell nucleus, where the SpCas9 exerts its cleavage function. As a proof-of-concept, the assembled SpCas9-AuNCs nanoparticles are successfully used 1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

for efficient knockout of E6 oncogene, restoring the function of tumor suppressive protein p53 and inducing apoptosis in cervical cancer cells with little effect on normal human cells. The SpCas9-AuNCs is useful for sgRNA functional validation, sgRNA library screening, and genomic manipulation. 1. Introduction Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR) associated protein 9 (Cas 9) system has recently evolved to become a powerful and robust gene-editing technique for targeting specific loci in the genome using a programmable trans-activating CRISPR RNA (crRNA) as a guide to direct the Cas9 enzyme.1 Benefiting from its versatility, efficiency, and accuracy, the CRISPR/Cas9 system has revolutionized a wide range of fields, including agriculture, biological science, and medicine.2 From the perspective of therapy, the CRISPR/Cas9 system has been successfully applied to combating bacteria, cancer, viruses, and genetic disorders.3-7 Unlike the RNA interference technology that only achieves partial transient knockdown of gene expression, CRISPR-Cas9 system induces permanent damage of the target genes.8 Until now, different strategies have been developed to apply the CRISPR/Cas9 system to edit the genome.9 Compared with the plasmidbased CRISPR/Cas9 system or Cas9 mRNA, the use of purified Streptococcus pyogenes Cas9 (SpCas9) endonuclease is the most widely studied strategy, which has several advantages, including rapid action, high gene editing efficiency, and no requirement of codon optimization and promoter selection.10 Besides, this method is transient and therefore has no insertional mutagenesis and only low immunogenicity. Moreover, the ease of large scale production of SpCas9 protein and the excellent clinical track record of protein therapeutics have paved the way for clinical translation. However, significant challenges remain for efficient delivery of SpCas9 endonuclease 2 ACS Paragon Plus Environment

Page 2 of 35

Page 3 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


because of the large size (about 160 kDa), which is not easy for packing in the vehicles. Synthetic vehicles such as lipid,11-13 gold nanoparticles,14-16 DNA nanoclew,17 hydrogels,18 metal-organic frameworks,19 and graphene oxide20 have recently been used for delivery of CRISPR/Cas9 system. However, incorporation of additional spare DNA or co-transcriptional activator complex for multiple applications, such as gene knock-in and regulation of endogenous gene expression, often complicate these delivery systems. One solution is to deliver the Cas9 protein and other component elements separately, which greatly simplifies the delivery process. For example, Liao et al. generated a dual adeno-associated viral system for separate delivery of Cas9 protein and the modified gRNA to induce epigenetic remodeling of targeted loci.21 Although promising, it is limited by cell type specificity, tissue tropism, and inevitable immunogenicity. Therefore, the development of vehicles for separate delivery of CRISPR components to the cell nucleus remains an urgent need for a safe and efficient gene-based therapy. Self-assembly is a facile and efficient way to synthesize large molecular aggregates in the natural process. Multiple copies of subunits such as proteins can spontaneously agglomerate into hierarchical architectures like spherical virus capsids.22 Inspired by nature, scientists have devoted to the construction of superstructures of multi-component self-assembled from different building blocks through entropic effects, van der Waals force, and electrostatic interaction. These new structures have the potential for unique and improved functions for diverse technological applications.23-28 Especially, the metal nanoclusters provide an ideal platform for exploiring self-assembly because of its ultrasmall size, customizable and controllable surface composition, and availability of a diverse library of building blocks.29-32 Herein, we report, for the first time, that gold nanoclusters (AuNCs) can 3 ACS Paragon Plus Environment


self-assemble with SpCas9 protein (SpCas9-AuNCs), and the complexes efficiently deliver SpCas9 protein into cell nucleus (Figure 1). This assembly process is highly dependent on pH. SpCas9-AuNCs are stable at a higher pH but are disassembled at a lower pH. The assembly-disassembly process enables the delivery of SpCas9 into cells and cell nucleus, where the SpCas9 exerts its cleavage function. Furthermore, as a proof-of-concept, we used the self-assembled SpCas9-AuNCs nanoparticles to effectively knockout of E6 oncogene following transfection of HPV18 E6 sgRNA into cervical cancer cells, hence restoring the function of tumor suppressive protein p53 and inducing apoptosis. Importantly, knockout of the E6 gene by SpCas9-AuNCs and E6 sgRNA had little effect on the normal cells. These unique features make SpCas9AuNCs an exciting biomaterial for gene-based cancer therapy.

4 ACS Paragon Plus Environment

Page 4 of 35

Page 5 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic illustration of pH-induced assembly-disassembly of SpCas9AuNCs. AuNCs self-assemble with SpCas9 at a higher pH through the electrostatic interaction whereas the disassembly of SpCas9-AuNCs occurs at a lower pH, which weakens the interaction between AuNCs and SpCas9. 2. Experimental Section 2.1 Reagents and materials Gold(III)

chloride

trihydrate,

glutathione,

3-[4,5-dimethylthiazolyl-2-]-2,5-

diphenyltetraolium bromide (MTT), and fetal bovine serums (FBS) were purchased from Sigma-Aldrich. Trypsin was obtained from Genesee. Dulbecco’s modified 5 ACS Paragon Plus Environment


Eagle’s Medium (DMEM) was purchased from VWR. All chemical reagents were of analytical grade and were directly used without further purification. Deionized water (18.2 MΩ; Millipore) was used in all experiments. 2.2 Expression and purification of Streptococcus pyogenes Cas9 protein (SpCas9) Plasmid pET-NLS-Cas9-6xHis (a gift from David Liu, Addgene #62934) encoding the S. pyogenes Cas9 fused with a N-terminal nuclear localization sequences (NLS) and C-terminal His-tag were transformed into E. coli BL21 (DE3) competent cells. The cells were inoculated into Luria-Bertani (LB) broth containing 100 μg ampicillin and cultured at 37 °C overnight. Then the cells were diluted 1:100 into the same medium and allowed to grow until the OD600 reached 0.6. The culture was incubated at 20 °C for 20 min, and isopropyl β-D-thiogalactopyranoside (IPTG) was added at 0.1 mM to induce the expression of SpCas9. After 16h, the cells were centrifuged and the pellet was suspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% (vol/vol) glycerol, 20 mM imidazole and 1 mM PMSF with 1 mg/mL of lysozyme. The cells were lysed by sonication (3s pulse on, and 3s pulse off for a total 10 min at 30% amplitude).The lysate was centrifuged at 16,000 g for 30 min and the supernatant was transferred to a fresh tube. The soluble lysate was then incubated with HispurTM Ni-NTA resin (Thermo Fisher #88221) at 4 °C for 45 min. The resin was transferred to a gravity column and washed with 20 column volumes of washing buffer containing 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% (vol/vol) glycerol, and 20 mM imidazole until no protein was detected in washing buffer. Finally, SpCas9 was eluted with the elution buffer containing 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% (vol/vol) glycerol and 250 mM imidazole, and the fractions containing the SpCas9 protein were determined using Quick Start Bradford Protein Assay (BIORAD). After dialyzing against the storage buffer containing 50 mM Tris-HCl pH 8.0, 6 ACS Paragon Plus Environment

Page 6 of 35

Page 7 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


200 mM NaCl, 20% (vol/vol) glycerol, and 0.5 mM PMSF overnight, the SpCas9 protein was concentrated using a 100K centrifugal filter (Millipore, UFC810008) and stored in aliquots at -80 °C. The concentration of the SpCas9 protein was quantified and analyzed by SDS-PAGE. 2.3 Design, synthesis and purification of sgRNA Single guide RNA (sgRNA) specific to HPV18 E6 gene was designed using the online tool Benchling. The template for the sgRNA was generated by repeated annealing and extension of complementary oligonucleotide primers with 30 cycles of annealing at 60 °C for 40 s, extension at 72 °C for 30 s, following by gel extraction (Qiagen). In vitro transcription was performed using the HiScribeTM Quick T7 High Yield RNA Synthesis Kit (NEB #E2050). After the reaction, DNase was used to remove the DNA template. The transcribed sgRNA was purified by phenol-chloroform extraction followed by ethanol precipitation according to the kit’s manual. The purified sgRNA was analyzed by agarose gel electrophoresis in TBE buffer using RiboRuler Low Range RNA Ladder (SM1833, ThermoFisher) as a reference and the concentration was quantified with a Synergy Multi-Mode Reader (Biotek). The primers for HPV18 E6 sgRNA was listed as follows: Forward: 5’GAAATTAATACGACTCACTATAGGGACAGTATTGGAACTTACAGGTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGGCTAGTCCG-3’ Reverse: 5’AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATT TTAACTTGC-3’ (the underline region is the targeted region for HPV18 E6) 2.4 Synthesis of glutathione (GSH) protected gold nanoclusters (AuNCs)



GSH protected AuNCs were prepared. Typically, 2.5 mL of 4 mM aqueous HAuCl4 and 2.5 mL of 8 mM GSH solution were mixed under vigorous stirring at room temperature for 5 min. Then, the mixture was allowed to react at 70 °C for 24 h. The solution was first centrifuged at 16,000 g for 1 min to remove the insoluble aggregates as well as large nanoparticles. The obtained supernatant was further purified using a dialysis bag with a MW cut-off of 14 kDa in double distilled water for 48h to remove any free GSH and gold ions. The obtained final AuNCs were stored at 4 °C for further use. 2.5 Formation of AuNCs and SpCas9 nanoassembly (SpCas9-AuNCs) The assembly of AuNCs and SpCas9 was formed through electrostatic action. Briefly, the above prepared AuNCs and SpCas9 were first dissolved in a phosphate buffered saline (PBS) solution (pH at 7.4) at a concentration of 1 mg/mL and 500 μg/mL, respectively. Then, 100 μL of the positively charged SpCas9 at 500 μg/mL was added dropwise into 1 mL of the negatively charged AuNCs solution at 1 mg/mL with stirring, and the mixture was incubated at room temperature for 30 min. The prepared SpCas9-AuNCs nanoassembly was used for the in vitro plasmid cleavage assay and transfection experiments. The mixture of different ratios of SpCas9 and AuNCs were also prepared with the same method as described above. 2.6 Plasmid DNA cleavage assay for endonuclease activity Plasmid pLXSN18E6E7 (Addgene #53459) containing the HPV E6 gene was linearized with PvuI (NEB), purified by QIAquick Gel Extraction Kit (Qiagen) and used as the substrate for spCas9 activity assay. In a typical reaction, the linearized plasmid was treated with SpCas9 complexed with E6 sgRNA with or without AuNCs at a molar ratio of SpCas9:sgRNA:plasmid at 10:10:1 in he Cas9 Nuclease Reaction Buffer containing 20 mM HEPES at pH 6.5, 100 mM NaCl, 5 mM MgCl2, and 0.1 mM


Page 8 of 35

Page 9 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EDTA at 37 °C for 1h. The final products were analyzed by electrophoresis with a 1.0% agarose gel to confirm the presence and sizes of the DNA fragments. 2.7 Cell culture The human cervical cancer HeLa cells contain integrated HPV18 DNA and express E6 gene. HEK-293T cells were negative for HPV. Cells were maintained in DMEM, supplemented with 10% FBS at 37 °C in a humidified atmosphere containing 5.0% CO2. 2.8 Immunofluorescence assay To investigate the uptake of SpCas9-AuNCs, HeLa cells were seeded on coverslips in 24-well plates at 5x104 cells per well overnight. The cells were incubated with SpCas9-AuNCs (containing 50 nM or ~ 8 μg/mL SpCas9) for the indicated time (1h, 2h or 4h) and then washed with PBS for 3 times. After that, the treated cells were fixed with 4% paraformaldehyde for 15 min at room temperature. The cells were washed with cold PBS twice and then incubated with 0.25% Triton X100. Cells were then washed and blocked with 1% BSA in PBS for 30 min and then incubated with the anti-Cas9 antibody for 1 h at room temperature. After washing with PBS three times, cells were further incubated with the corresponding secondary antibody conjugated with Alexa Fluor 488 for 1 h in the dark at room temperature. The cell nucleus were stained with Hoechst 33342 dye for 5 min, and the slides were mounted with FluorSave Reagent (Cat. #345789, Calbiochem, Billerica, MA, USA). Samples were then observed with a laser-scanning confocal Nikon Eclipse Ti fluorescence microscope (Nikon Instruments). Alexa Fluor 488 was observed with an excitation wavelength of 488 nm and an emission wavelength of 500-550 nm. Hoechst 33342 was observed with an excitation wavelength of 405 nm and an emission wavelength of 425-475 nm. AuNCs was observed with an excitation wavelength of 561 nm and an emission wavelength of 575-625 nm. 9 ACS Paragon Plus Environment


For detecting the expression of HPV18 E6 and p53 proteins, HeLa cells were seeded on coverslips in 24-well plates at 5x104 per well overnight. The cells were incubated with SpCas9-AuNCs (containing 50 nM or ~ 8 μg/mL SpCas9) for 4 h and then washed with PBS for 3 times. After that, sgRNA (1.92 μg/mL) was then transfected into the cells using Lipofectamine RNAiMAX. After 3 days, the treated cells were fixed with 4% paraformaldehyde for 15 min at room temperature. The cells were washed with cold PBS twice and then incubated with 0.25% Triton X-100. After that, the cells were washed and blocked with 1% BSA in PBS for 30 min and then incubated with an anti-HPV18 E6 antibody or anti-p53 antibody for 1 h at room temperature. After washing with PBS three times, cells were further incubated with the corresponding secondary antibody conjugated with Alexa Fluor 488 for 1 h in the dark at room temperature. The cell nucleus were stained with Hoechst 33342 dye for 5 min, and the slides were mounted with FluorSave Reagent. Samples were then observed with a laser-scanning confocal Nikon Eclipse Ti fluorescence microscope. Alexa Fluor 488 was observed with an excitation wavelength of 488 nm and an emission wavelength of 500-550 nm. Hoechst 33342 was observed with an excitation wavelength of 405 nm and an emission wavelength of 425-475 nm. 2.9 Mechanism of cellular internalization To study the mechanism of cellular internalization, several inhibitors of the cellular uptake pathways were used, including chlorpromazine hydrochloride (an inhibitor of clathrin-dependent endocytosis), nystatin (an inhibitor of caveolindependent endocytosis), methyl-β-cyclodextrin (an inhibitor of cholesterol-dependent membrane fusion) and amiloride (an inhibitor of macropinocytosis). HeLa cells were seeded in a 24-well plate at a density of 2X105 cells/well. Cells were then washed with PBS and incubated with 0.5 μg/mL of chlorpromazine hydrochloride, 25 μg/mL of nystatin, 50 μg/mL of methyl-β-cyclodextrin, or 20 μg/mL of amiloride in serum-free 10 ACS Paragon Plus Environment

Page 10 of 35

Page 11 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


medium at 37 °C for 1 h. Then the medium was replaced with fresh medium containing the inhibitors and SpCas9-AuNCs. The cells were further incubated for another 4 h at 37 °C. Cells were washed three times with PBS and the intracellular fluorescence intensities were observed using an Olympus IX 81 confocal laser scanning microscope. 2.10 Western blot assay Total cell lysates were separated in SDS polyacrylamide gels, electrophoretically transferred to nitrocellulose membranes (GE Healthcare). The membranes were incubated sequentially with primary and secondary antibodies, respectively. The signal was detected with Luminiata Crescendo Western HRP substrate (Millipore Sigma, #WBLUR0500). Primary antibodies to β-actin (Santa Cruz, #SC-47778), HPV18 E6 (Santa Cruz, #SC-460), Cas9 (Abcam, #ab191468), p53 (Cell Signaling Technology, #2524s) and p21 (Santa Cruz, #sc-397) were used. 2.11 T7E1 assay to detect genomic indel formation. Genomic DNA of HeLa cells was harvest using QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions. The targeted HPV18 genome encoding E6 gene was amplified by PCR. Then the PCR products were annealed and digested with T7 Endonuclease I. Finally, the fragments were analyzed to determine the efficiency of indel induction in the targeted genome. 2.12 Cell survival assay HeLa cells seeded at a density of 5,000 cells/well (100 μL) in 96-well plates for 24 h were incubated with SpCas9-AuNCs for 4 h and washed with PBS for 3 times. sgRNA was then transfected into the cells using Lipofectamine RNAiMAX. Finally, cell cytotoxicity was measured at day 3 using the MTT assay. Briefly, the cell culture medium was removed and the cells were washed with PBS twice. Then, 10 μL of MTT solution at 5 mg/mL was added to each well to a final volume of 100 μL. The 11 ACS Paragon Plus Environment


plate was placed in the CO2 incubator for an additional 4 h. The medium was removed and 100 μL DMSO as added into each well. The plate was then gently swirled for 2 min at room temperature at dark to dissolve all formed precipitate. Absorbance values were determined with a Synergy Multi-Mode Reader (Biotek) at 570 nm with a reference filter of 650 nm. 2.13 Cell apoptosis assay. Apoptosis was examined to determine the effect of SpCas9-AuNCs and sgRNA by staining the cells with Annexin V Alexa Fluor 488 and propidium iodide according to the instructions of the manufacturer (Thermo Scientific). Briefly, HeLa cells and HEK-293T cells seeded in 6-well plates at a density of 1X105 cells per well overnight were incubated with SpCas9-AuNCs for 4 h and then washed with PBS for 3 times. SgRNA was transfected into the cells. After incubation for 3 days, cells were collected for the detection of apoptotic cells. Quantitative analysis was carried out on flow cytometry. 2.14 Statistical Analysis. All data were expressed as means ± standard errors of the means (SEMs) from at least three independent experiments, each with three repeats unless stated otherwise. Two-tailed t-test was performed, and P

Gold Nanoclusters-Mediated Efficient Delivery of Cas9 Protein through

Recommend Documents