Green Synthesis of Fluorescent Carbon Dots from Gynostemma for

Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE

Biological and Medical Applications of Materials and Interfaces

Green Synthesis of Fluorescent Carbon Dots from Gynostemma for Bioimaging and Antioxidant in Zebrafish Xinjing Wei, Li Li, Jinlong Liu, Lidong Yu, Hongbin Li, Feng Cheng, Xiaotong Yi, Jinmei He, and Bingsheng Li ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b00074 • Publication Date (Web): 13 Feb 2019 Downloaded from http://pubs.acs.org on February 14, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Green Synthesis of Fluorescent Carbon Dots from Gynostemma for Bioimaging and Antioxidant in Zebrafish Xinjing Wei, † Li Li, *, ‡ Jinlong Liu, ‡ Lidong Yu, § Hongbin Li, † Feng Cheng, † Xiaotong Yi, † Jinmei He,*, † and Bingsheng Li*, §, †MIIT

∥

Key Laboratory of Critical Materials Technology for New Energy Conversion and Storage,

School of Chemistry and Chemical Engineering, Harbin Institute of Technology, Harbin 150001, P.R. China ‡School

of Life Science and Technology, Harbin Institute of Technology, Harbin 150080, P.R. China

§School

of Science, Department of Physics, Harbin Institute of Technology, Harbin 150080, P.R.

China ∥

State Key Laboratory of Urban Water Resources and Water Environment, Harbin Institute of

Technology, Harbin 150001, P.R. China *Corresponding authors: Jinmei He (E-mail: [email protected]), Li Li (E-mail: [email protected]) and Bingsheng Li (E-mail: [email protected]).

ABSTRACT Fluorescent carbon dots (CDs) have been synthesized via the calcination method using natural gynostemma as precursor, without any toxic ingredients or surface passivation chemicals. The CDs have a narrow size distribution and the -mean particle size is about 2.5 nm. The CDs exhibit good water dispersibility and can emit intense blue fluorescence under 360 nm UV light in an aqueous solution, which can be stable in different conditions. The biotoxicity of CDs on the embryonic development of zebrafish are evaluated, the hatch rate and the survival rate of embryos are around 90%, and the malformation rate is less 1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

than 10%. Due to the excellent fluorescence stability and biocompatibility, CDs can be used in zebrafish for bioimaging. And the anti-oxidative stress property of CDs is investigated both in vitro and in vivo, the presence of CDs can promote mRNA expression of related genes to encode more antioxidant proteins in zebrafish. Therefore, the fluorescent CDs would be a potential candidate for bioimaging and treating diseases caused by excessive oxidation damage, such as cancer, senility and other diseases associated with aging.

KEYWORDS: Carbon dots, fluorescent, gynostemma, bioimaging, antioxidant, zebrafish 1.

INTRODUCTION Carbon nanomaterials, such as fullerene, carbon nanotube and graphene, due to their superior

performance, they have attracted tremendous attention around the world. The first accidental discovery of fluorescent carbon dots (CDs) was in the process of separating and purifying the single-walled carbon nanotube in 2004.1 Fluorescent CDs are a young member of carbon nanomaterials with the size less than 10 nm and their surface rich in functional groups.2 Compared with conventional semiconductor quantum dots and organic fluorescent dyes, the CDs have fascinating fluorescence performance, including photo-stability, no bleaching and blinking fluorescence, excitation-dependent emission fluorescence.3-4 In addition, fluorescent CDs have been proved to possess many other outstanding properties,

for example, brilliant

chemical stability, low cytotoxicity, good water dispersibility, superior biocompatibility, easy functionalization and catalytic properties. Therefore, fluorescent CDs have been widely applied in bioimaging,5-7 biosensing,8-9 drug delivery,10-11 catalysis12-13 and optoelectronic devices.14-16 Owing to these outstanding properties and extensive applications, numerous effective and eco-friendly

methods of

synthesizing fluorescent CDs have been developed, which can be divided into top-down and bottom-up.17-18 2


Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After a decade of efforts, a series of top-down methods have been achieved. These methods are used to obtain CDs from relatively large carbon structures by physical or chemical cutting treatment, such as arc-discharge carbon nanotubes,1 chemical oxidation of candle soot,19 and coal,20 laser ablation of graphite,21 and graphene nanosheets,22 electro-chemical oxidation of graphite rod.23 On the other hand, bottom-up methods to synthesis fluorescent CDs have been draw increasingly attention. Briefly, hydrothermal treatment, thermal decomposition, plasma treatment or ultrasonic/microwave irradiation were used to prepare the fluorescent CDs by choosing conventional organic molecules or biomass as precursors.24 There have been successfully synthesized fluorescent CDs using conventional organic molecules as precursors, for example, citric acid,25 chitosan,26 dopamine,27 amino acids,28 glucose29-30 and so on. Nevertheless, most of these methods usually require expensive energy-consuming equipment or large amount of strong oxidation reagents, which make them complex and extreme.31 Recently, natural biomass is not only abundant, sustainable and renewable, but also cheap, easily available and nontoxic, so lots of researchers have devoted to synthesizing the fluorescent CDs with biomass as precursor,32 such as grass,33 green tea,34 coffee grounds,35 plant-leaf,36 algal blooms,37 garlic,38 water chestnut and onion.39 In their works, fluorescent CDs have shown excellent potential for sensing, bioimaging and antioxidant applications.40-42 However, the antioxidation property of fluorescent CDs have explained only in cell level in previous works.43 To promote the practical application of fluorescent CDs, it would be highly significant to investigate the antioxidation property of CDs both in vitro and in vivo. Thus, it is necessary to look for appropriate synthetic routes and biomass to obtain CDs with brilliant properties. Herein, we present a facile, green, low-cost calcination method to synthesize CDs by using gynostemma as precursor for the first time, without any toxic agents or surface passivation chemicals. The morphology 3



structure and chemical composition of fluorescent CDs were analyzed. And the fluorescence properties and stability of CDs were also investigated. Zebrafish is small, transparent, mature quickly and shares homology with human genes.44-45 So we chose zebrafish as an ideal model to evaluate the developmental toxicity of fluorescent CDs. And these the fluorescent CDs were applied to transparency zebrafish embryos to observe the bioimaging in vivo. Additionally, the anti-oxidative stress property of fluorescent CDs both in vitro and in vivo was proved by measuring the content of biomarker, including reactive oxygen species (ROS) and the malondialdehyde (MDA).46-47 Meanwhile, the antioxidant of fluorescent CDs were demonstrated by the mRNA expression of related antioxidant genes in zebrafish, including glutamate cysteine ligase catalytic subunit (gclc), glutathione s-transferase P1 (gstp1), quinone oxidoreductase-1 (nqo1), Cu/Zn-superoxide dismutase (sod1) and manganese superoxide dismutase (sod2).48 Particularly, our work provides some insights into the antioxidant property of fluorescent CDs in zebrafish, and the fluorescent CDs might be a potential candidate for bioimaging in vivo.

2.

EXPERIMENTAL SECTION 2.1 Materials. Gynostemma was bought at the local market, Heilongjiang, China. Phosphate buffer

saline (PBS), hydrogen peroxide (H2O2), E3 culture medium (including 5 mM of sodium chloride, 0.17mM of potassium chloride, 0.33mM of calcium chloride dehydrate and 0.33 mM of magnesium sulfate heptahydrate). Commercially available MDA and ROS kits were provided by Nanjing Jiancheng Bioengineering Institute, China. All other chemical reagents were analytical grade and could be use without further purification. 2.2 Characterizations. Fluorescence spectra was recorded by the Varian Cary Eclipse fluorescence spectrophotometer at room temperature. UV-vis absorption spectra was recorded by using a Perkin Elmer 4


Page 4 of 26

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Lanmbda XLS+ UV-Vis spectrophotometer. Transmission electron microscopy (TEM) image was obtained with a HITACHI H-7650 electron microscope, the sample of TEM was prepared by dropping the CDs suspension onto the carbon-coated copper grid and dried in the air. Fourier Transform Infrared Spectroscopy (FT-IR) spectra was recorded with the KBr pellet technique ranging from 500 to 4000 cm-1 on a Nicolet iS50 FTIR spectrometer. X-ray photoelectron spectroscopy (XPS) measurements were carried out on the Rigaku D/max-rB X-ray diffractometer. 2.3 Preparation of Fluorescent CDs. Fluorescent CDs were prepared by direct calcination with gynostemma as precursor, the solution of CDs displays faint yellow in daylight and intense blue fluorescence under 365 nm UV light (Scheme 1). Briefly, dried gynostemma was ground into fine powders with the grinding machine primarily. These fine powder was placed into a porcelain boat and then calcined at 400℃ for 4 h with the heating rate of 5℃/min –in the N2 atmosphere. After dropping to room temperature naturally, dark black powder was dispersed into ultrapure water with continuous magnetically stirring to achieve a black solution. In order to obtain the pure CDs, the solution was centrifuged at 12000 rpm for 20 min and then the supernatant was filtrated with the 0.22 μm filtration membrane to remove larger particles. Finally, fluorescent CDs were collected by lyophilizing under a vacuum condition, and then kept at 4℃ for later use.

5



Scheme 1. Illustration for synthesizing CDs from gynostemma by calcination. 2.4 Biotoxicity of Fluorescent CDs on the Embryonic Development of Zebrafish. The AB-type zebrafish were raised in the cycles of light and dark (14/10 h) at 28℃ in an automatic photo-controlled aeration circulating freshwater system tank (AAE-022-AA-A) and kept at ideal breeding conditions following the standard husbandry protocols. Zebrafish (the ratio of female to male as 1:2) fed off newly hatched shelled brine shrimps twice a day. In the next light cycle, enough embryos were gathered at 2 h post-fertilization (hpf) and then washed several times by using standard E3 culture medium to remove the surrounding residua. Then zebrafish embryos were observed under the microscope and the normal development of embryos were distributed 30 embryos per well into 6-well plates in 4 mL different concentrations of fluorescent CDs solution (50, 100, 200, 400 μg/mL) and E3 medium without CDs as control. The solutions were renewed every 24 h. Afterwards, the biotoxicity of fluorescent CDs on the embryonic development of zebrafish were evaluated by the number of autonomic movements at 24 hpf, the heart rate at 48 hpf, the hatch rate at 54 hpf, the malformation rate and survival rate at 96 hpf under the microscope observation. Each group was repeated three times.

6


Page 6 of 26

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.5 The bioimaging of Fluorescent CDs in zebrafish. The 2 hpf embryos were incubated with 4 mL fluorescent CDs solution (400 μg/mL) in each well of 6-well plates (30 embryos per well) and E3 medium as control group. Then embryos were incubated for 22 h, after removing the solution and washing with E3 medium for 4 times, the fluorescence images were obtained by the fluorescence microscope under different excitation spectra. Additionally, the 5dpf healthy zebrafish were treated in the same method above, and incubated for 24 h with fluorescent CDs solution (0.4 and 1.6 mg/mL). Similarly, fluorescence images were obtained by the fluorescence microscope. 2.6 The Anti-oxidative stress of Fluorescent CDs. In order to evaluate anti-oxidative stress of fluorescent CDs in zebrafish, 2 hpf embryos were incubated in fluorescent CDs solution for 24 h and then treated by 0.1 mM H2O2 for 6h. Subsequently, the oxidative stress of H2O2 induced could be detected by measuring MDA content and ROS content in zebrafish. Briefly, 30 zebrafish embryos were homogenized in ice-cold physiological saline solution and then the concentration of protein in homogenate was determined by using coomassie blue staining kits. Then centrifuged the homogenate with 4000 rpm for 10 min, the MDA content of supernatant was measured by using commercially available kits. The OD values were obtained at 532 nm by spectrophotometer. The content of MDA was expressed as nM/mgprot. Additionally, the supernatant was collected and incubated at 37℃ for 1 h under dark condition and then the ROS in zebrafish was measured by using commercially available ROS kits (. The ROS content was expressed by fluorescence intensity/mgprot. Similarly, to evaluate anti-oxidative stress of fluorescent CDs in Hela Cells, the MDA and ROS content of Hela Cells were also obtained by the similar procedures. 2.7 Antioxidant Genes Expression analysis of Zebrafish. Briefly, the total RNA of zebrafish was extracted with Trizol reagent according to the manufacture’s protocol (Takara Biochemicals, Dalian, 7



China). Then the extracted RNA of each sample was tested and later stored in -80℃. Subsequently, cDNA was obtained by using the PrimeScriptTM RT reagent KitwithgDNA Eraser (Takara). Diluted 1 μL cDNA to 10 μL for real-time polymerase chain reaction (PCR). Quantitative real-time PCR used SYBR®Premix Ex TAqTM Ⅱ kit (Takara) according to these steps: heated to 95℃ for 30 s to denature, and then 40 cycles of 15s at 95℃ and 30s at 60℃. Then PCR was performed four times and the relative quantification of gene expression in each experiment group was analyzed by the 2-ΔΔCT method. Each mRNA level was expressed as the ratio with E3 control group. Primers were used to test the gene expression of ef1α, gclc, gstp1, nqo1, sod1 and sod2 in zebrafish. And the detail information is shown in Table 1. Table 1. Sequences of primer pairs in the quantitative real-time PCR.

3.

Target gene

Primer sequences

ef1αF

CCTGGGAGTGAAACAGCTGATC

ef1αR

CCGATCTTCTTGATGTATGCGCTG

gstp1 F

CGACTTGAAAGCCACCTGTGTC

gstp1 R

CTGTCGTTTTTGCCATATGCAGC

gclc F

AACCGACACCCAAAGATTCAGCACT

gclc R

CCATCATCCTCTGGAAACACCTCC

nqo1 F

TTTGCAGAATCCCGAGCACT

nqo1 R

TCTTCTGCGATCAAGCTGAAAG

sod1 F

CTAGCCCGCTGACATTACATC

sod1 R

TTGCCCACATAGAAATGCAC

sod2 F

CGCATGTTCCCAGACATCTA

sod2 R

GAGCGGAAGATTGAGGATTG

RESULTS AND DISCUSSION.

8


Page 8 of 26

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.1 Structural Characterization of Fluorescent CDs. The morphology structure and size distribution of fluorescent CDs were characterized by TEM. Figure 1a shows TEM image of fluorescent CDs, it indicates that CDs could be highly dispersed without aggregation and spherical in shape. The inset HRTEM images reveal that fluorescent CDs are graphitic crystalline structure with clear lattice fringes, about 0.21 and 0.32 nm, which may correspond to the (100) and (002) diffraction facets of graphitic carbon.39,

45

Meanwhile, Figure 1b the histogram shows that CDs have a narrow size distribution and the mean particle size is 2.49 ± 0.43 nm by measuring more than 100 random nanoparticles.

Figure 1. (a) TEM and HRTEM (inset) images of CDs. (b) Particle size distribution histogram of CDs. The surface functional groups of fluorescent CDs were identified by FTIR spectrum (Figure 2a). The strong absorption at 3362 cm-1 is caused by the stretching vibrations of –OH group, and two peaks at 2961 cm-1 and 1401 cm-1 are identified as sp3 C-H stretching and in-plane bending vibrations of -CH3/-CH2- on the surface, the absorption peaks at 1656 cm-1 and 1571 cm-1 originate from C=O and C=C vibrational stretch separately. And the peak at 1264 cm-1 arises from the stretching vibration of C-O (C-OH), the absorption at 1126 cm-1 is identified as epoxy C-O-C stretching vibration. Thus, the FTIR spectrum reveals that the presence of oxygen-containing functional groups (hydroxyl, carbonyl, carboxyl and epoxy) of CDs resulted in fluorescent CDs becoming hydrophilic.34 9



Moreover, the surface state and composition of fluorescent CDs had been investigated in XPS spectrum. The XPS survey spectrum (Figure 2b) explains that as-prepared CDs comprise carbon and oxygen elements, which peaks at 284 eV and 530 eV, respectively. The signal of K is noticed, owing to the precursor gynostemma containing abundant mineral elements. The high resolution XPS spectrum of C1s (Figure 2c) exists three main peaks at 284.6, 285.2 and 287.8 eV, which are attributed to C-C(sp3)/C=C(sp2), C-O and C=O, respectively. The deconvolution of O1s spectrum (Figure 2d) shows two peaks at 531.8 and 532.9 eV, which can be separately assigned to C=O and C-OH/C-O-C groups. Specifically, the XPS analysis are well consistent with the FTIR results, and these surface hydrophilic groups make CDs have good water dispersibility.36

Figure 2. (a) FTIR spectrum of CDs. (b) XPS survey spectrum. (c) C1s and (d) O1s spectrum of CDs. 10


Page 10 of 26

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.2 Optical Properties of Fluorescent CDs. The optical properties of fluorescent CDs in distilled water had been investigated. The UV-vis absorption spectrum in Figure 3a has a characteristic absorption at 268 nm, which can be assigned to π-π* transition of C=C of as-prepared CDs.49-50 The excitation and emission fluorescence spectrums of CDs indicate that the maximum excitation is at 320 nm and the maximum emission is around 400 nm, which means that the successful carbonization of the gynostemma. The fluorescence quantum yield of CDs was calculated to be around 5.7% by comparing with quinine sulfate in the previous method.51 The fluorescence emission spectrum (Figure 3b) of CDs was obtained by increasing the excitation wavelength from 300 nm to 420 nm at 10 nm intervals. The red-shift of emission wavelength indicated that the emission of CDs were related to the excitation wavelength. The excitation-dependent characteristic of CDs might attribute to different particle sizes or the existence of diverse emissive traps on CDs surface.6

Figure 3. (a) UV-vis absorption spectrum, the excitation (λem = 400 nm) and emission (λex = 320 nm) fluorescence spectrum of CDs. (b) Fluorescence emission spectrum of CDs under different excitation wavelengths.

11



3.3 Stability of Fluorescent CDs. The fluorescent CDs would be applied in biological fields, so it is worthwhile to investigate the stability of fluorescent CDs solution to realize their practical applications. In Figure 4a, the fluorescence intensity of CDs was almost invariable in various concentrations (up to 1.5 M) of NaCl solution, which demonstrated that the as-prepared CDs can be stability even in a high sodium ions environment. Meanwhile, when using a 365 nm UV light irradiate the fluorescent CDs solution for 120 min, the fluorescence intensity of CDs didn’t change obviously in Figure 4b, which displayed that fluorescent CDs have outstanding photo-stability. In addition, Figure 4c shows that the fluorescence intensity of CDs only has a slight change in PBS solution during long-term storage at room temperature, and exhibits a homogeneous solution without obvious precipitation for 30 days, these results illustrate that the fluorescent CDs possess excellent stability for long-term storage. Moreover, Figure 4d shows the fluorescence intensity of CDs was affected by different concentration, the intensity increased gradually with the increasing concentration of CDs. Until the concentration of CDs exceeded 400 μg/mL, the fluorescence intensity was decreased, which implied that the excessive concentration of CDs may cause fluorescence quenching. Therefore, it is noteworthy that choosing the optimal CDs concentration for further experiment. All above results illustrate that the as-prepared CDs have excellent fluorescence properties for bioimaging.

12


Page 12 of 26

Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (a) Effect of ionic strength. (b) Effect of 365 nm UV irradiation time. (c) Long-term fluorescence stability in PBS. (d) Effect of different concentrations on the fluorescence intensity of CDs solution at 320 nm. 3.4 Biotoxicity of Fluorescent CDs on the Embryonic Development of Zebrafish. Even though the as-prepared CDs possess excellent fluorescence properties, the biotoxicity of different CDs concentrations (50, 100, 200, 400 μg/mL) on the embryonic development of zebrafish need to be examined. Generally, the zebrafish embryos have been considered as a model to evaluating developmental biotoxicity of CDs, we evaluated the biotoxicity of CDs in zebrafish at four periods (24, 48, 54 and 96 hpf), corresponding to the number of autonomic movements, heart rate, hatch rate, malformation rate and survival rate, respectively.

13



Under normal development period, the irregular autonomic movements of zebrafish occur from embryonic development to 24 hpf and the early development of their nervous system is evaluated by the number of autonomic movements within 1 min. Besides, the development of zebrafish embryos to 48 hpf is the critical period for the development of their heart, the heart rate within 15 s is an assessment of the development of heart and their circulatory system in early zebrafish embryos. As shown in Figure 5a, comparing with the control groups, both the number of autonomic movements within 1 min at 24 hpf and the heart rate within 15 s at 48 hpf of zebrafish embryos were developmentally normal with incubated in all CDs solutions. These results suggested that the nervous system and the circulatory system of zebrafish embryos were developed normally in the presence of CDs at a concentration lower than 400 μg/mL. Additionally, comparing with control groups, the hatch rate at 54 hpf and the survival rate at 96 hpf of embryos weren’t emerged significant differences as the CDs concentration increase in Figure 5b, which indicated that the high biocompatibility of as-prepared CDs. Meanwhile, the malformation rate at 96 hpf were calculated, when the CDs concentration was 400 μg/mL, the malformation rate was less than 10%, which demonstrated that the as-prepared CDs possess low-toxic on the embryonic development of zebrafish. Therefore, the excellent biocompatibility and low biotoxicity of fluorescent CDs clearly reveals a great potential in bioimaging.

14


Page 14 of 26

Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. The biotoxicity of different concentrations of CDs in zebrafish. (a) The effects of autonomic movements within 1 min at 24 hpf and the heart rate within 15 s at 48 hpf on zebrafish embryos. (b) The hatch rate at 54 hpf, the survival rate at 96 hpf and the malformation rate at 96 hpf of zebrafish. (n = 35, the results were represented the mean ± SD of three replicates.) 3.5 The bioimaging of Fluorescent CDs in zebrafish. The fluorescent CDs were applied in transparency zebrafish embryos to observe the bioimaging in vivo. As shown in Figure 6, 2 hpf zebrafish embryos in E3 control groups without CDs didn’t show obvious fluorescence. On the contrary, it was clear that embryos showed an intense fluorescence after incubating with CDs for 22 h, indicating that CDs might enter into embryos through the chorion. Furthermore, Figure 7 shows that the fluorescent CDs could accumulate in the digestive system of 5 dpf zebrafish after incubated in the CDs solution, suggesting that the CDs might tend to enter into the zebrafish by mouth. With the increasing concentration of CDs, the fluorescence signals become stronger. Therefore, these results illustrate that CDs might enter into the zebrafish by the chorion and mouth. Specially, there was a strong fluorescence intensity in the belly and intestine of zebrafish with the presence of 1.6 mg/mL CDs solution (Figure S1). And in the bright field images, these embryos had been developed normally in CDs solution, which was consistent with the

15



excellent biocompatibility of CDs. In addition, we used Image J to quantitatively analyze the fluorescence intensity of 2 hpf embryo in Figure 6 and 5 dpf zebrafish in Figure 7, and then the normalized fluorescence intensity in CDs groups were higher than those of control groups (Figure S2).52

Figure 6. The fluorescent images of 2 hpf embryos incubated in CDs solution (400 μg/mL).

16


Page 16 of 26

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. The fluorescent images of 5 dpf zebrafish incubated in CDs solution. 3.6 The Anti-oxidative stress of Fluorescent CDs. Oxidative stress refers to the imbalance between oxidation and anti-oxidation system in body, which tends to oxidize and produces a large number of reactive oxygen intermediates. ROS is defined as the general term for substances containing oxygen, including O2·-, ·OH, H2O2, which is related to redox balance and enzymatic antioxidation in cell. The normal level of ROS play a decisive role in signal regulation and homeostasis of cell, but excessive accumulation of ROS may lead to oxidative damage, inflammation, diseases and cancer.46 Comparing with other previous works,43 we investigated the anti-oxidative stress (H2O2 induced) of fluorescent CDs both in vitro and in vivo. And then the content of ROS and MDA in cell and zebrafish were measured to verify anti-oxidative stress of fluorescent CDs, respectively. The ROS content in Hela cells and zebrafish were shown in Figure 8a, compared with the E3 control groups, the ROS content in CDs groups without H2O2 induced treatment were obviously lower than the E3 groups. Besides, the ROS content were increased significantly in H2O2 induced groups, which suggested that exogenous H2O2 change the normal metabolism

17



and induce oxidative stress both in vitro and in vivo. Especially, ROS content in CDs groups under the H2O2 induced condition were significantly reduced, indicating that fluorescent CDs have effects on the ROS generation. Thus, the fluorescent CDs can be considered as antioxidant to fight with the oxidative stress, which efficiently decreases the damage of ROS both in Hela cells and in zebrafish.

Figure 8. The anti-oxidative stress of CDs. The content of (a) ROS and (b) MDA both in Hela cells and in zebrafish oxidative damaged by H2O2 induced. *** is P＜0.001 (t-test). Furthermore, MDA can be the main biomarker for evaluating the oxidative stress, because MDA is produced by the oxidation between oxygen free radicals and polyunsaturated fatty acids, which may cause cross-linking polymerization of proteins, nucleic acid and other living macromolecules. The MDA content in Hela cells and zebrafish were shown in Figure 8b, compared with the E3 control groups, the MDA content in the H2O2 induced treatment groups were increased remarkably, which indicated that H2O2 induced more lipid peroxidation reactions. However, the MDA content in the present of CDs groups were obviously reduced, which indicated that fluorescent CDs can reduce the damage from H2O2 induced oxidative stress. In conclusion, the anti-oxidative stress property of fluorescent CDs was demonstrated by the change of ROS and MDA both in Hela cells and zebrafish, and the fluorescent CDs might reduce the

18


Page 18 of 26

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


oxidative damage by controlling the ROS generation. Therefore, as-prepared CDs could be used to cure diseases caused by excessive oxidation damage, such as cancer, senility and other diseases associated with aging. 3.7 Effects of Fluorescent CDs on Antioxidant Genes Expression analysis of Zebrafish. Recently, some genes associated with the oxidative stress were found in zebrafish.53 And the expression of these genes had been used to investigate the toxicity of chemicals.48, 54 Then the antioxidant property of CDs was demonstrated by evaluating the expression of related antioxidant genes (including gclc, gstp1, nqo1, sod1 and sod2) in zebrafish through the quantitative real-time PCR. As shown in Figure 9, comparing with the E3 control groups, the mRNA level of gclc, gstp1, nqo1, sod1 and sod2 were increased in the fluorescent CDs treatment groups, respectively. These results suggest that the presence of fluorescent CDs can promote the mRNA expression to achieve the antioxidant property. Moreover, sod1 and sod2 genes encoded more antioxidant proteins under the fluorescent CDs treatment to prevent the oxidative damage in zebrafish. On the other hand, gclc, gstp1 and nqo1 mRNA expression were up-regulated significantly in response to CDs treatment, which might reduce the damage of oxidative stress in zebrafish. Thus CDs could protect zebrafish against oxidative stress by the increasing of ROS related enzymes to reduce the content of ROS with compensatory mechanisms. Besides, we preliminarily speculated that CDs might activate the pathway of nuclear factor eryrhroid-2 related factor 2 (Nrf2)/antioxidant response element (ARE), who play a key role in zebrafish defense against oxidative stress. Therefore, the detailed antioxidant mechanisms of CDs still need further discussion.

19



Figure 9. Expression of gclc, gstp1, nqo1, sod1 and sod2 mRNA in zebrafish after CDs treatments by PCR. * is P＜0.05, ** is P＜0.01 and *** is P＜0.001 (t-test).

4.

CONCLUSIONS In summary, fluorescent CDs have been successfully synthesized via a facile, green, low-cost and

efficient calcination method by using gynostemma as precursor, without any toxic agents or surface passivation chemicals. The obtained CDs have a narrow size distribution and the mean particle size is around 2.5 nm. The CDs solution can emit intense blue fluorescence under 365 nm UV light and the emission wavelength has been red-shifted with the increasing excitation wavelengths. These CDs have good fluorescence stability in high ionic strength environments. The biotoxicity of different concentrations (up to 400 μg/mL) of CDs on the embryonic development of zebrafish are inappreciable, the nervous system and circulatory system of zebrafish can develop normally. Due to the excellent fluorescence stability and biocompatibility of CDs, the bioimaging in zebrafish can be observed, and CDs might enter into zebrafish embryos by chorion or mouth. Moreover, the anti-oxidative stress property of CDs is

20


Page 20 of 26

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


investigated by H2O2 induced both in vitro and in vivo, the ROS content and MDA content of CDs treatment groups are obviously lower than the E3 control groups, which indicates that the fluorescent CDs can reduce the oxidative damage by controlling the ROS generation. Furthermore, the presence of CDs can promote the mRNA expression of related genes to encode more antioxidant proteins to prevent the oxidative damage in zebrafish. Therefore, the fluorescent CDs would be a potential candidate to be used in treating some diseases associated with oxidative damage.

Acknowledgments This work was financially supported by the “Research on the Ultrafine Oxide Regenerated Cellulose Hemostatic Materials” from Application Technology Research and Development of Harbin Science and Technology Bureau (No. 2017RAQXJ039), the National Natural Science Foundation of China (31701296 and 11474076), and Open Project of State Key Laboratory of Urban Water Resources and Water Environment, Harbin Institute of Technology (No. ES201702).

*Supporting Information The measurement of fluorescence quantum yield of CDs has been described in detail. Figure S1: The fluorescent microscopic images of 5 dpf zebrafish embryos incubated in the CDs solution (1.6 mg/mL) for 24 h. Strong fluorescence intensity in the belly and intestine of zebrafish can be observed. Figure S2: The normalized fluorescence intensity of 2 hpf embryo and 5 dpf zebrafish in fluorescent images.

References (1) Xu, X. Y.; Ray, R.; Gu, Y. L.; Ploehn, H. J.; Gearheart, L.; Raker, K.; Scrivens, W. A. Electrophoretic Analysis and Purification of Fluorescent Single-walled Carbon Nanotube Fragments. J Am Chem Soc 2004, 126 (40), 12736-12737, DOI: 10.1021/ja040082h.

21



(2) Niu, N.; Ma, Z. M.; He, F.; Li, S. J.; Li, J.; Liu, S. X.; Yang, P. P. Preparation of Carbon Dots for Cellular Imaging by the Molecular Aggregation of Cellulolytic Enzyme Lignin. Langmuir 2017, 33 (23), 5786-5795, DOI: 10.1021/acs.langmuir.7b00617. (3) Zheng, M.; Li, Y.; Liu, S.; Wang, W. Q.; Xie, Z. G.; Jing, X. B. One-Pot To Synthesize Multifunctional Carbon Dots for Near Infrared Fluorescence Imaging and Photothermal Cancer Therapy. Acs Appl Mater Inter 2016, 8 (36), 23533-23541, DOI: 10.1021/acsami.6b07453. (4) De, B.; Karak, N. A Green and Facile Approach for the Synthesis of Water Soluble Fluorescent Carbon Dots from Banana Juice. Rsc Adv 2013, 3 (22), 8286-8290, DOI: 10.1039/c3ra00088e. (5) Huang, H.; Xu, Y.; Tang, C.-J.; Chen, J.-R.; Wang, A.-J.; Feng, J.-J. Facile and Green Synthesis of Photoluminescent Carbon Nanoparticles for Cellular Imaging. New J Chem 2014, 38 (2), 784, DOI: 10.1039/c3nj01185b. (6) Sahu, S.; Behera, B.; Maiti, T. K.; Mohapatra, S. Simple One-step Synthesis of Highly Luminescent Carbon Dots from Orange Juice: Application as Excellent Bio-imaging Agents. Chem Commun (Camb) 2012, 48 (70), 8835-7, DOI: 10.1039/c2cc33796g. (7) Jiang, K.; Sun, S.; Zhang, L.; Lu, Y.; Wu, A.; Cai, C.; Lin, H. Red, Green, and Blue Luminescence by Carbon Dots: Full-color Emission Tuning and Multicolor Cellular Imaging. Angew Chem Int Ed Engl 2015, 54 (18), 5360-3, DOI: 10.1002/anie.201501193. (8) Gu, D.; Shang, S. M.; Yu, Q.; Shen, J. Green synthesis of Nitrogen-doped Carbon Dots from Lotus Root for Hg(II) Ions Detection and Cell Imaging. Appl Surf Sci 2016, 390, 38-42, DOI: 10.1016/j.apsusc.2016.08.012. (9) Zhao, C. X.; Jiao, Y.; Hu, F.; Yang, Y. L. Green Synthesis of Carbon Dots From Pork and Application as Nanosensors for Uric Acid Detection. Spectrochim Acta A 2018, 190, 360-367, DOI: 10.1016/j.saa.2017.09.037. (10) Liu, C. J.; Zhang, P.; Zhai, X. Y.; Tian, F.; Li, W. C.; Yang, J. H.; Liu, Y.; Wang, H. B.; Wang, W.; Liu, W. G. Nano-carrier for Gene Delivery and Bioimaging Based on Carbon Dots with PEI-passivation Enhanced Fluorescence. Biomaterials 2012, 33 (13), 3604-3613, DOI: 10.1016/j.biomaterials.2012.01.052. (11) Yang, X.; Wang, Y.; Shen, X.; Su, C.; Yang, J.; Piao, M.; Jia, F.; Gao, G.; Zhang, L.; Lin, Q. One-step Synthesis of Photoluminescent Carbon Dots with Excitation-independent Emission for Selective Bioimaging and Gene delivery. J Colloid Interface Sci 2017, 492, 1-7, DOI: 10.1016/j.jcis.2016.12.057. (12) Arul, V.; Edison, T. N. J. I.; Lee, Y. R.; Sethuraman, M. G. Biological and Catalytic Applications of Green Synthesized Fluorescent N-doped Carbon Dots Using Hylocereus Undatus. J Photoch Photobio B 2017, 168, 142-148, DOI: 10.1016/j.jphotobiol.2017.02.007. (13) Zhu, C.; Zhai, J.; Dong, S. Bifunctional Fluorescent Carbon Nanodots: Green Synthesis via Soy Milk and Application as Metal-free Electrocatalysts for Oxygen Reduction. Chem Commun (Camb) 2012, 48 (75), 9367-9, DOI: 10.1039/c2cc33844k. (14) Singh, V.; Mishra, A. K. White Light Emission from a Mixture of Pomegranate Extract and Carbon Nanoparticles Obtained from the Extract. J Mater Chem C 2016, 4 (15), 3131-3137, DOI: 10.1039/c6tc00480f. (15) Sarswat, P. K.; Free, M. L. Light Emitting Diodes Based on Carbon Dots Derived from Food, Beverage, and Combustion Wastes. Phys Chem Chem Phys 2015, 17 (41), 27642-27652, DOI: 10.1039/C5CP04782J.

22


Page 22 of 26

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(16) Jin, X.; You, L.; Chen, Z.; Li, Q. High-efficiency Platinum-free Quasi-solid-state Dye-sensitized Solar Cells from Polyaniline (polypyrrole)-carbon Nanotube Complex Tailored Conducting Gel Electrolytes and Counter Electrodes. Electrochim Acta 2018, 260, 905-911, DOI: 10.1016/j.electacta.2017.12.066. (17) Miao, P.; Han, K.; Tang, Y. G.; Wang, B. D.; Lin, T.; Cheng, W. B. Recent Advances in Carbon Nanodots: Synthesis, Properties and Biomedical Applications. Nanoscale 2015, 7 (5), 1586-1595, DOI: 10.1039/C4NR05712K. (18) Xue, M.; Zhan, Z.; Zou, M.; Zhang, L.; Zhao, S. Green Synthesis of Stable and Biocompatible Fluorescent Carbon Dots from Peanut Shells for Multicolor Living Cell Imaging. New J Chem 2016, 40 (2), 1698-1703, DOI: 10.1039/c5nj02181b. (19) Liu, H. P.; Ye, T.; Mao, C. D. Fluorescent Carbon Nanoparticles Derived From Candle Soot. Angew Chem Int Edit 2007, 46 (34), 6473-6475, DOI: 10.1002/anie.200701271. (20) Hu, S.; Wei, Z.; Chang, Q.; Trinchi, A.; Yang, J. A Facile and Green Method Towards Coal-based Fluorescent Carbon Dots with Photocatalytic Activity. Appl Surf Sci 2016, 378, 402-407, DOI: 10.1016/j.apsusc.2016.04.038. (21) Sun, Y. P.; Zhou, B.; Lin, Y.; Wang, W.; Fernando, K. A. S.; Pathak, P.; Meziani, M. J.; Harruff, B. A.; Wang, X.; Wang, H. F.; Luo, P. J. G.; Yang, H.; Kose, M. E.; Chen, B. L.; Veca, L. M.; Xie, S. Y. Quantum-sized Carbon Dots for Bright and Colorful Photoluminescence. J Am Chem Soc 2006, 128 (24), 7756-7757, DOI: 10.1021/ja062677d. (22) Qin, Y.; Cheng, Y.; Jiang, L.; Jin, X.; Li, M.; Luo, X.; Liao, G.; Wei, T.; Li, Q. Top-down Strategy toward Versatile Graphene Quantum Dots for Organic/Inorganic Hybrid Solar Cells. Acs Sustain Chem Eng 2015, 3 (4), 637-644, DOI: 10.1021/sc500761n. (23) Kong, W. Q.; Liu, J.; Liu, R. H.; Li, H.; Liu, Y.; Huang, H.; Li, K. Y.; Liu, J.; Lee, S. T.; Kang, Z. H. Quantitative and Real-time Effects of Carbon Quantum Dots on Single Living HeLa Cell Membrane Permeability. Nanoscale 2014, 6 (10), 5116-5120, DOI: 10.1039/C3NR06590A. (24) Zhang, X.; Jiang, M.; Niu, N.; Chen, Z.; Li, S.; Liu, S.; Li, J. Natural-Product-Derived Carbon Dots: From Natural Products to Functional Materials. Chemsuschem 2018, 11 (1), 11-24, DOI: 10.1002/cssc.201701847. (25) Qu, S.; Wang, X.; Lu, Q.; Liu, X.; Wang, L. A Biocompatible Fluorescent Ink Based on Water-soluble Luminescent Carbon Nanodots. Angew Chem Int Ed Engl 2012, 51 (49), 12215-8, DOI: 10.1002/anie.201206791. (26) Yang, Y.; Cui, J.; Zheng, M.; Hu, C.; Tan, S.; Xiao, Y.; Yang, Q.; Liu, Y. One-step Synthesis of Amino-functionalized Fluorescent Carbon Nanoparticles by Hydrothermal Carbonization of Chitosan. Chem Commun (Camb) 2012, 48 (3), 380-2, DOI: 10.1039/c1cc15678k. (27) Qu, K.; Wang, J.; Ren, J.; Qu, X. Carbon Dots Prepared by Hydrothermal Treatment of Dopamine as an Effective Fluorescent Sensing Platform for the Label-free Detection of Iron(III) Ions and Dopamine. Chemistry 2013, 19 (22), 7243-9, DOI: 10.1002/chem.201300042. (28) Pei, S.; Zhang, J.; Gao, M.; Wu, D.; Yang, Y.; Liu, R. A Facile Hydrothermal Approach Towards Photoluminescent Carbon Dots from Amino Acids. J Colloid Interf Sci 2015, 439, 129-133, DOI: 10.1016/j.jcis.2014.10.030.

23



Page 24 of 26

(29) Li, H.; He, X.; Liu, Y.; Huang, H.; Lian, S.; Lee, S.-T.; Kang, Z. One-step Ultrasonic Synthesis of Water-soluble Carbon Nanoparticles with Excellent Photoluminescent Properties. Carbon 2011, 49 (2), 605-609, DOI: 10.1016/j.carbon.2010.10.004. (30) Long, P.; Feng, Y. Y.; Li, Y.; Cao, C.; Li, S. W.; An, H. R.; Qin, C. Q.; Han, J. K.; Feng, W. Solid-State Fluorescence of Fluorine-Modified Carbon Nanodots Aggregates Triggered by Poly(ethylene glycol). Acs Appl Mater Inter 2017, 9 (43), 37981-37990, DOI: 10.1021/acsami.7b13138. (31) Wei, J. M.; Zhang, X.; Sheng, Y. Z.; Shen, J. M.; Huang, P.; Guo, S. K.; Pan, J. Q.; Feng, B. X. Dual Functional Carbon Dots Derived from Cornflour via a Simple One-pot Hydrothermal Route. Mater Lett 2014, 123, 107-111, DOI: 10.1016/j.matlet.2014.02.090. (32) Das, R.; Bandyopadhyay, R.; Pramanik, P. Carbon Quantum Dots from Natural Resource: A review. Mater Today Chem 2018, 8, 96-109, DOI: 10.1016/j.mtchem.2018.03.003. (33) Liu, S.; Tian, J. Q.; Wang, L.; Zhang, Y. W.; Qin, X. Y.; Luo, Y. L.; Asiri, A. M.; Al-Youbi, A. O.; Sun, X. P. Hydrothermal Treatment of Grass: A Low-Cost, Green Route to Nitrogen-Doped, Carbon-Rich, Photoluminescent Polymer Nanodots as an Effective Fluorescent Sensing Platform for Label-Free Detection of Cu(II) Ions. Advanced Materials 2012, 24 (15), 2037-2041, DOI: 10.1002/adma.201200164. (34) Hsu, P.-C.; Chen, P.-C.; Ou, C.-M.; Chang, H.-Y.; Chang, H.-T. Extremely High Inhibition Activity of Photoluminescent Carbon Nanodots Toward Cancer Cells. J Mater Chem B 2013, 1 (13), 1774, DOI: 10.1039/c3tb00545c. (35) Hsu, P. C.; Shih, Z. Y.; Lee, C. H.; Chang, H. T. Synthesis and Analytical Applications of Photoluminescent Carbon Nanodots. Green Chem 2012, 14 (4), 917-920, DOI: 10.1039/C2GC16451E. .(36) Zhu, L. L.; Yin, Y. J.; Wang, C. F.; Chen, S. Plant Leaf-derived Fluorescent Carbon Dots for Sensing, Patterning and Coding. J Mater Chem C 2013, 1 (32), 4925-4932, DOI: 10.1039/C3TC30701H. (37) Ramanan, V.; Thiyagarajan, S. K.; Raji, K.; Suresh, R.; Sekar, R.; Ramamurthy, P. Outright Green Synthesis of Fluorescent Carbon Dots from Eutrophic Algal Blooms for In Vitro Imaging. Acs Sustain Chem Eng 2016, 4 (9), 4724-4731, DOI: 10.1021/acssuschemeng.6b00935. (38) Zhao, S. J.; Lan, M. H.; Zhu, X. Y.; Xue, H. T.; Ng, T. W.; Meng, X. M.; Lee, C. S.; Wang, P. F.; Zhang, W. J. Green Synthesis of Bifunctional Fluorescent Carbon Dots from Garlic for Cellular Imaging and

Free

Radical

Scavenging.

Acs

Appl

Mater

Inter

2015,

7

(31),

17054-17060,

DOI:

10.1021/acsami.5b03228. (39) Hu, Y. F.; Zhang, L. L.; Li, X. F.; Liu, R. J.; Lin, L. Y.; Zhao, S. L. Green Preparation of S and N Co-Doped Carbon Dots from Water Chestnut and Onion as Well as Their Use as an Off On Fluorescent Probe for the Quantification and Imaging of Coenzyme A. Acs Sustain Chem Eng 2017, 5 (6), 4992-5000, DOI: 10.1021/acssuschemeng.7b00393. (40) Das Purkayastha, M.; Manhar, A. K.; Das, V. K.; Borah, A.; Mandal, M.; Thakur, A. J.; Mahanta, C. L. Antioxidative, Hemocompatible, Fluorescent Carbon Nanodots from an "End-of-Pipe" Agricultural Waste: Exploring Its New Horizon in the Food-Packaging Domain. J Agr Food Chem 2014, 62 (20), 4509-4520, DOI: 10.1021/jf500138f. (41) Zhang, X.; Wang, H.; Ma, C.; Niu, N.; Chen, Z.; Liu, S.; Li, J.; Li, S. Seeking Value from Biomass Materials: Preparation of Coffee Bean Shell-derived Fluorescent Carbon Dots via Molecular Aggregation for Antioxidation and Bioimaging Applications. Mat Chem Front 2018, 2 (7), 1269-1275, DOI: 10.1039/c8qm00030a.

24


Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(42) Zhang, W.; Chavez, J.; Zeng, Z.; Bloom, B.; Sheardy, A.; Ji, Z.; Yin, Z.; Waldeck, D. H.; Jia, Z.; Wei, J. Antioxidant Capacity of Nitrogen and Sulfur Codoped Carbon Nanodots. ACS Applied Nano Materials 2018, 1 (6), 2699-2708, DOI: 10.1021/acsanm.8b00404. (43) Roy, P.; Periasamy, A. P.; Lin, C. Y.; Her, G. M.; Chiu, W. J.; Li, C. L.; Shu, C. L.; Huang, C. C.; Liang, C. T.; Chang, H. T. Photoluminescent Graphene Quantum Dots for in Vivo Imaging of Apoptotic Cells. Nanoscale 2015, 7 (6), 2504-10, DOI: 10.1039/c4nr07005d. (44) Gong, X.; Lu, W.; Liu, Y.; Li, Z.; Shuang, S.; Dong, C.; Choi, M. M. F. Low Temperature Synthesis of Phosphorous and Nitrogen Co-doped Yellow Fluorescent Carbon Dots for Sensing and Bioimaging. J Mater Chem B 2015, 3 (33), 6813-6819, DOI: 10.1039/c5tb00575b. (45) Zhang, J. H.; Niu, A.; Li, J.; Fu, J. W.; Xu, Q.; Pei, D. S. In Vivo Characterization of Hair and Skin Derived Carbon Quantum Dots with High Quantum Yield as Long-term Bioprobes in Zebrafish. Sci Rep 2016, 6, 37860, DOI: 10.1038/srep37860. (46) Du, Z.; Zhu, L.; Dong, M.; Wang, J.; Wang, J.; Xie, H.; Zhu, S. Effects of the Ionic Liquid [Omim]PF6 on Antioxidant Enzyme Systems, ROS and DNA Damage in Zebrafish (Danio Rerio). Aquat Toxicol 2012, 124-125, 91-3, DOI: 10.1016/j.aquatox.2012.08.002. (47) Chai, Z.; Huang, W.; Zhao, X.; Wu, H.; Zeng, X.; Li, C. Preparation, Characterization, Antioxidant Activity and Protective Effect Against Cellular Oxidative Stress of Polysaccharide from Cynanchum Auriculatum

Royle

ex

Wight.

Int

J

Biol

Macromol

2018,

119,

1068-1076,

DOI:

10.1016/j.ijbiomac.2018.08.024. (48) Jin, Y.; Zhang, X.; Shu, L.; Chen, L.; Sun, L.; Qian, H.; Liu, W.; Fu, Z. Oxidative Stress Response and Gene Expression with Atrazine Exposure in Adult Female Zebrafish (Danio Rerio). Chemosphere 2010, 78 (7), 846-52, DOI: 10.1016/j.chemosphere.2009.11.044. (49) Atchudan, R.; Edison, T. N. J. I.; Chakradhar, D.; Perumal, S.; Shim, J.-J.; Lee, Y. R. Facile Green Synthesis of Nitrogen-doped Carbon Dots using Chionanthus Retusus Fruit Extract and Investigation of Their Suitability for Metal Ion Sensing and Biological Applications. Sensors and Actuators B: Chemical 2017, 246, 497-509, DOI: 10.1016/j.snb.2017.02.119. (50) Zhang, Z.; Hao, J. H.; Zhang, J.; Zhang, B. L.; Tang, J. L. Protein as the Source for Synthesizing Fluorescent Carbon Dots by a One-pot Hydrothermal Route. Rsc Adv 2012, 2 (23), 8599-8601, DOI: 10.1039/c2ra21217j. (51) Wang, W.; Lai, H.; Cheng, Z.; Kang, H.; Wang, Y.; Zhang, H.; Wang, J.; Liu, Y. Water-induced Poly(vinyl alcohol)/carbon Quantum Dot Nanocomposites with Tunable Shape Recovery Performance and Fluorescence. J Mater Chem B 2018, 6 (45), 7444-7450, DOI: 10.1039/c8tb02064g. (52) Shi, Q.-Q.; Li, Y.-H.; Xu, Y.; Wang, Y.; Yin, X.-B.; He, X.-W.; Zhang, Y.-K. High-yield and High-solubility Nitrogen-doped Carbon Dots: Formation, Fluorescence Mechanism and Imaging Application. RSC Adv. 2014, 4 (4), 1563-1566, DOI: 10.1039/c3ra45762a. (53) Liu, Y.; Wang, J. S.; Wei, Y. H.; Zhang, H. X.; Xu, M. Q.; Dai, J. Y. Induction of Time-dependent Oxidative Stress and Related Transcriptional Effects of Perfluorododecanoic Acid in Zebrafish Liver. Aquatic Toxicology 2008, 89 (4), 242-250, DOI: 10.1016/j.aquatox.2008.07.009. (54) Woo, S.; Yum, S.; Kim, D. W.; Park, H. S. Transcripts Level Responses in a Marine Medaka (Oryzias Javanicus) Exposed to Organophosphorus Pesticide. Comp Biochem Phys C 2009, 149 (3), 427-432, DOI: 10.1016/j.cbpc.2008.10.100.

25



Abstract Graphic

26


Page 26 of 26

Green Synthesis of Fluorescent Carbon Dots from Gynostemma for

Recommend Documents