Growth Factor-Bearing Polymer Brushes - Versatile Bioactive

Subscriber access provided by McMaster University Library

Article

Growth Factor-Bearing Polymer Brushes - Versatile Bioactive Substrates Influencing Cell Response Evmorfia Psarra, Elena Foster, Ulla König, Jungmok You, Yuichiro Ueda, Klaus-Jochen Eichhorn, Martin Mueller, Manfred Stamm, Alexander Revzin, and Petra Uhlmann Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.5b00967 • Publication Date (Web): 08 Oct 2015 Downloaded from http://pubs.acs.org on October 10, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Growth Factor-Bearing Polymer Brushes - Versatile Bioactive Substrates Influencing Cell Response Evmorfia Psarra1, 2‡, Elena Foster3‡, Ulla König1‡*, Jungmok You4, Yuichiro Ueda5§, Klaus-J. Eichhorn1, Martin Müller1, Manfred Stamm1, 2, Alexander Revzin3 and Petra Uhlmann1, 6* ‡ These authors contributed equally *Author to whom correspondence should be addressed: [email protected], [email protected]

1

Leibniz Institute of Polymer Research Dresden, Hohe Str. 6, 01069 Dresden, Germany

2

The Technische Universität Dresden, Faculty of Science, Department of Chemistry, Chair of Physical Chemistry of Polymeric Materials, Bergstrasse 66, 01069 Dresden, Germany

3

Department of Biomedical Engineering, University of California at Davis, 451 E. Health Sciences Drive, California 95616, USA

4

Department of Plant & Environmental New Resources, Kyung Hee University, South Korea, Gyeonggi-do 446-701

5

Institute for Biomaterial Science Teltow, Helmholtz-Zentrum Geesthacht, BerlinBrandenburg Center for Regenerative Therapies, Kantstr. 55, 14513 Teltow, Germany

6

Department of Chemistry, Hamilton Hall, University of Nebraska-Lincoln, 639 N 12th Street, Lincoln, NE 68588, USA

----------------------------------------------------------------------------------------------------------------------Current author address: §Institute of Anatomy and Cell Biology, Julius-Maximiliams University of Würzburg, Germany Koellikerstr.6, 9070 Würzburg

ACS Paragon Plus Environment

1

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 49

Abstract

In this study we present the development of responsive nanoscale substrates exhibiting cellguiding properties based on incorporated bioactive signaling cues. The investigative approach considered the effect of two different surface-bound growth factors (GFs) on cell behavior and response: hepatocyte growth factor (HGF) and basic fibroblast growth factor (bFGF). Two surface bio-functionalization strategies were explored in order to conceive versatile, bioactive thin polymer brush films. Polymer brushes made of tethered poly(acrylic)acid (PAA) polymer layers with a high grafting density of polymer chains were bio-functionalized with GFs either by physisorption or chemisorption. Both GFs showed high binding efficiencies to PAA brushes based on their initial loading concentrations. The GF release kinetics can be distinguished depending on the applied bio-functionalization method. Specifically, a high initial burst followed by a constant slow release was observed in the case of both physisorbed HGF and bFGF. In contrast, the release kinetics of chemisorbed GFs were quite different. Remarkably, chemisorbed HGF remained bound to the brush surface for over one week, whereas 50% of chemisorbed bFGF was released slowly. Furthermore, the effect of these GF-bio-functionalized PAA brushes on different cells was investigated. A human hepatoma cell line (HepG2) was used to analyze the bioactivity of HGFmodified PAA brushes by measuring cell growth inhibition and scattering effects. Additionally, the differentiation of mouse embryonic stem cells (mESCs) towards endoderm was studied on bFGF–modified PAA brush surfaces. Finally, the results illustrate that PAA brushes, particularly those bio-functionalized with chemisorbed GFs, produce an expected measurable effect on both cell types. Therefore, PAA polymer brushes bio-functionalized with GFs can be used as bioactive cell culture substrates with tuned efficiency.


2

Page 3 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Keywords: polymer brushes, growth factor, bio-functionalization, controlled release, HepG2 cell line, mouse embryonic stem cells.

1. Introduction

In the fields of tissue engineering and regenerative medicine inspiration for bioengineered constructs is traditionally derived from the extra cellular matrix (ECM) environment.1 In vivo, the ECM surrounding the cells plays a key instructive and supportive role supplying critical biochemical and physical signals to initiate, maintain and modify cellular functions. Basic requirements for the development of bioactive constructs such as biocompatibility, minimum cell toxicity, cell adhesiveness and mechanical support should be fulfilled in combination with cellguiding properties to specifically control the biological environment.2, 3 To regulate signaling and cellular behavior, and encourage tissue interaction, growth factor-delivery-based substrates and matrices are often used in tissue engineering.4-7 The ability of a growth factor (GF) to deliver a particular message to a cell is determined by its identity, the extent of its binding to the ECM, its local concentration gradient, its diffusion rate through the ECM and and in vitro, in the cell culture medium.4, 6, 8 Moreover, the cell membrane receptor levels as well as the binding efficiencies of the GF to the cell membrane receptors might regulate the induced GF cell signaling. 9, 10 Solid-phase presentation of growth factors by binding them to a carrier matrix has a few advantages over traditional addition to culture media (solution-phase). Since matrix-bound GF molecules are more rarely internalized and degraded less by the cells’ enzymatic machinery, it is probable that the signal transduction will continue for longer and the same GF molecules will be used repeatedly by different cell surface receptors. The reusability of the GFs has a positive effect on GF consumption. Moreover, high local concentrations of immobilized GFs lead to a ‘multivalency’ effect, where multivalent ligands have the ability to cluster signaling receptors and ACS Paragon Plus Environment

3

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 49

therefore effectively activate and enhance signaling pathways.11-16 Even in vivo matrix-bound growth factors might lead to different signal transduction compared to their soluble counterparts.17-19 Further, absolute surface GF immobilization might result in a slow, prolonged release when compared to the one achieved by physical adsorption. On that end, incorporation of GFs onto bioengineered surfaces with controlled release dynamics and well-designed localized concentrations may potentially allow control over regenerative and therapeutic processes.20, 21 In the present work we describe the use of nanoscale polymer brush layers for the incorporation of growth factors. Polymer brushes are composed of surface-tethered polymer chains in very high grafting densities.22, 23 Therefore, the polymer chains are forced to stretch away from the interface due to excluded volume interactions. A prerequisite for the brush formation is that the distance between two neighboring grafted chains be smaller than the radius of gyration of the polymer in solution.23 Here, a poly(acrylic) acid (PAA) polymer is grafted to the surface by the ‘grafting to’ approach in order to create chemically feasible polymer brushes that are prone to bio-functionalization. After annealing of the polymer, a Guiselin ‘pseudo’ brush with one to three surface anchoring points is formed.24, 25 The polymeric chains then form ‘loops and tails’. These brushes consist of weak polyelectrolytes and show a high degree of swelling which is responsive to pH and salt concentration changes.25 They can be considered to resemble ‘real’ endanchoring polymer brushes, since the swelling (scaling behavior of the brush thickness in a good solvent) and the pH responsiveness of both systems in situ are very similar.25 The use of GF-functionalized polymer brushes as nanoscale cell culture interfaces might be advantageous in several ways. Their soft, elastic polymer bulk surface is expected to favor cell adhesion. Moreover, the flexibility of the thin polymer film might positively affect the biological outcome, with respect to GF signal transduction. Polymer chains might provide the needed spacing for intra- and extracellular reorientation upon ligand-receptor binding. Another beneficial attribute is the nanometer size of the polymer brush structure. Surface features that are on the ACS Paragon Plus Environment

4

Page 5 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

same scale as the biomolecules involved in the desired bioengineering processes along with a favorable elastic modulus could allow better manipulation of expected biological responses.26, 27 In this work we describe the surface bio-functionalization of PAA polymer brushes with hepatocyte (HGF) and basic fibroblast growth factor (bFGF) and analyze their effect on two different cell types: HepG2 (human hepatocellular carcinoma cells) and mESC (mouse embryonic stem cells). The growth factors were incorporated onto the PAA polymer brushes through two different immobilization approaches: physical adsorption via electrostatic interactions (physisorption) and covalent binding via EDC/NHS chemistry (chemisorption). Covalent binding of growth factors to their carrier matrix can lead to more prolonged release than that achieved by physical adsorption. Scheme 1 below illustrates the basic steps of the surface modification with PAA polymer brushes by grafting-to and the subsequent bio-functionalization with growth factor molecules. In the last step, the effect of the GF bio-functionalized PAA brush surfaces on cultured HepG2 and mESC cells is analyzed. Soluble HGF is known to have anti-proliferative and scattering effects on HepG2 cells, which was the expected outcome.28, 29 bFGF has an effect on early differentiation of mESCs - in the presence of Activin A bFGF induces endoderm differentiation. 30, 31 We chose to assess these well-studied, predictable biological effects of GFs onto the cells in order to prove appropriate biological activity of bio-functionalized PAA polymer brushes.


5

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 49

Scheme 1: Schematic representation of the experimental workflow. A Grafting of anchoring PGMA and subsequently PAA polymer as a brush on SiO2 or glass substrates. B. Bio-functionalization of PAA brush with growth factor through physisorption or chemisorption. C. Interaction of GF-modified PAA brush with HepG2 cells (for HGF-PAA) or mESCs cells (for bFGF-PAA).

2. Experimental section

2.1

Materials

Silicon wafers, oriented in [100] direction and with a ~2 nm native SiO2 were purchased from SiMat (Landsberg, Germany), whereas glass slides were purchased from VWR, Germany. Poly(glycidylmethacrylate) (PGMA, Mn = 17500 g/mol, Mw/Mn = 1.7), Poly(acrylic acid) (PAA, Mn = 25000 g/mol, Mw/Mn = 1.16), were purchased from Polymer Source, Inc., Canada. Ethanol abs. was purchased from VWR, Germany. Chloroform (CHCl3) was purchased from Fisher, Germany. Phosphate buffer saline (PBS (tablets, pH 7.4) was obtained from Sigma Aldrich, Germany, whereas PBS powder 10X was purchased from Cambrex (Charles City, IA). MES hydrate and boric acid were purchased from Sigma Aldrich, Germany. Human hepatocyte and basic fibroblast growth factor were obtained from Sigma Aldrich. Capture antibodies human FGF basic MAb, and human HGF MAb, detection antibodies human FGF basic and


6

Page 7 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

human HGF, biotinylated MAb, and streptavidin-HRP were purchased from R&D, USA. 3, 3′,5 ,5′-tetramethylbenzidine substrate solution, bovine serum albumin lyophilized powder and tween 20, were purchased from Sigma Aldrich, Germany. Dulbecco’s modified Eagles’ medium (DMEM), minimal essential medium (MEM), Iscove’s Modified Dulbecco’s Medium (IMDM), sodium pyruvate, non-essential amino acids, L-glutamine, ES-qualified fetal bovine serum (FBS), certified FBS, 2-mercaptoethanol and phenylindole, diacetate (DAPI) were purchased from Invitrogen Life Technologies (Carlsbad, CA). Total mRNA isolation kit, QuantiTect Reverse Transcription Kit and FastStart Universal SYBR Master Mix were purchased from Roche (Indianapolis, IN). ESGRO (leukemia inhibitory factor: LIF), fibronectin, primary mouse embryonic fibroblasts (MEF) were obtained from Millipore (Temecula, CA). Mouse embryonic stem cells (mESCs) were purchased from ATCC (Manassas, VA). Primers were ordered from IDT Inc, Coralville, Iowa. Human liver carcinoma cell line (HepG2) was purchased from ATCC (Manassas, VA). 2.2 Polymer Brush Preparation Polymer brushes were grafter to Si wafers or glass slides substrates according to previously reported methods.32-34 Briefly, substrates were dipped in ethanol, sonicated for 10 min and dried with N2 gas. Afterwards, samples were placed into an oxygen plasma chamber for 1 min at 100 W to activate the sample surface with reactive oxygen species. Following oxygen plasma exposure, the polymer brush anchoring layer was spin coated onto the surface from a 0.02 wt% solution of poly(glycidyl methacrylate) PGMA in chloroform and annealed in vacuum for 20 min at 110 °C to chemically bind the polymer to the activated surface. Subsequently, a 1 wt% solution of poly(acrylic acid) PAA, dissolved in absolute ethanol, was spin coated onto the surface and


7

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 49

annealed in vacuum for 30 min at 80 °C to chemically react the PAA brush layer to the PGMA anchoring layer via covalent bonding and the formation of ether bonds. Finally, excess PAA polymer was extracted by stirring the sample in ethanol for 30 min at room temperature. 2.3 Surface Characterization After grafting the PAA brushes on silicon or glass substrates were characterized by the following surface analysis methods: Spectroscopic Ellipsometry (VIS-SE). VIS-SE was used to characterize the stepwise grafting of polymer brushes on the Si substrates in the dry state as well as the dynamic swelling behavior of the brushes in situ. The ellipsometric data, ∆ (relative phase shift) and tanΨ (relative amplitude ratio), obtained by VIS-SE (alpha-SE, Woollam Co., Inc., Lincoln NE, USA) were analyzed with CompleteEASE software version 4.46. The range of the spectroscopic analysis was set between 400 and 800 nm and the angle of incidence Φ0 was 70°. The optical model used for the evaluation of dry and /or swollen thickness and swollen refractive index of the polymer brush layer includes the underlying substrate (silicon), the silicon dioxide layer, the anchoring PGMA layer the PAA Guiselin brush and the ambient air or buffer on the top simulated by a multilayer- box-model with sharp interfaces. The dispersion relations for silicon and silicon oxide were taken from the software library and the refractive index of PGMA was set to nPGMA=1.525.35 The dependence of the refractive index on the wave length was described either by the Cauchy relation (n(λ) = A + B/ λ2) or, in case of thin dry films below 10 nm thickness fixed Cauchy parameter A = 1.502 and B = 0.0058 were applied to the Cauchy relationship. In situ dynamic swelling of the PAA brush layer was performed using batch cuvette (TSL Spectrosil, Hellma, Müllheim, Germany) mounted by a Teflon cover.


8

Page 9 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Atomic force microscopy (AFM) was performed with a Dimension 3100 (Digital Instruments, Inc., California, USA) microscope. To map the brush morphology at ambient conditions, AFM measurements were done with tapping mode. Tips type BSTap (Budget Sensors, Bulgaria) with resonance frequency of 75 kHz, spring constant of 3 N/m and radius < 10 nm were applied. The Nanoscope analysis software, version 1.40 was used in order to estimate the root mean square roughness of PAA brush surfaces in average (n=6). Electrokinetic measurements (EKA) were employed to determine the isolectric point of the PAA brush surface in electrolyte solution. The zeta-potential as a function of pH was measured with ElectroKinetic Analyzer (EKA, Anton PAAr GmbH, Graz, Austria). Captive bubble method in combination with the Axisymmetric Drop shape Analysis-Profile (ADSA-P) was used to record the advancing and receding contact angles of the swollen PAA brush layers in water. Contact angles were measured between a captive gas bubble and a swollen surface in a liquid chamber. The shape of the experimental bubble profile was fitted according to the Laplace equation of capillarity to a theoretical profile. For that, surface/interfacial tension as adjustable parameter was used. The analysis was performed with ADSA software. Attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR) was performed with IFS55 spectrometer (Bruker Optics GmbH, Leipzig, Germany) on silicon ATR crystals, using the single-beam-sample-reference-method (SBSR, OPTISPEC, Zurich, Switzerland). After spin-coating of the brush-polymer, half of the sample surface was wiped with the appropriate solvent, in order to create a reference area on the same crystal. Spectra of the reference area and the sample area were recorded alternately, by movement of the vertical position of the ATR


9

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 49

crystal in the IR-beam. Compensation of background intensities was achieved by recording the ratio of the two spectra. 2.4 Bio-functionalization with Growth Factors and Analysis PAA polymer brushes were functionalized with HGF or bFGF by two different procedures: physical adsorption (physisorption) and covalent binding (chemisorption). Prior to HGF or bFGF bio-functionalization, the PAA brush substrates were sterilized by immersion in absolute ethanol (10 min; stirring, at room temperature) and allowed to swell in PBS buffer solution for 15 min at room temperature, to ensure swelling equilibrium of the polymer brush. For the physisorption, 0.1, 0.5 or 1.0 µg/ml HGF or bFGF dissolved in PBS buffer was added to the brush substrates and let adsorb overnight at room temperature. In case of chemisorption, prior to reaction with GF molecules, brushes were first activated with EDC/NHS solution with a ratio of 0.25/0.1 mg/ml in MES buffer; pH 6.0. In particular, brushes were kept in EDC/NHS solution for 40 min while stirring to activate the COOH groups on PAA brushes. Subsequently, 0.1, 0.5 or 1.0 µg/ml HGF or bFGF in borate buffer; pH 8.0, was added to the activated PAA brush substrates. After the overnight reaction, the GFs solution was removed by aspiration and the GFs-modified PAA brushes were washed three times in PBS buffer (stirring for 10 min each time). Enzyme-linked immunosorbent assay (ELISA). PAA Guiselin brush surfaces were placed in custom-made incubation chambers that restrict the GF solution to the brush surface. A volume of 250 µl HGF or bFGF solution was physisorbed or chemisorbed onto the brush surface, as described above. After overnight adsorption, the GF solution was collected in low protein binding Eppendorf tubes and the substrates were washed three times with 500 µl PBS to remove any nontightly bound HGF or bFGF from the brush. The washing solution was also collected and kept for quantitative ELISA investigation. Each of these solutions was assayed in triplicates. Following bio-functionalization, the release kinetics of HGF or bFGF from the PAA brushes were studied by determining GF concentrations in ACS1 Paragon ml of 1%Plus BSAEnvironment PBS solution at 37 °C. Samples taken after 10

Page 11 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

certain time intervals over one week were stored at - 80 °C until determined by ELISA, and replaced with fresh buffer solution. The absorbance of each ELISA plate was read at 450 nm with a 620 nm reference absorbance. The GF concentrations were determined from a standard curve. 2.5 Cell Cultivation Prior to all cell culture experiments all PAA brush samples were placed in a conventional 24-well plate and equilibrated in the appropriate cell culture media. HepG2 cell culture. Human hepatoma HepG2 cells were maintained in Dulbecco's modified Eagle's medium in a humidified atmosphere of 5% CO2, 95% air at 37 °C. The medium was supplemented with 10% (v/v) fetal bovine serum (FBS), 100 U/ml penicillin, 100 µg/ml streptomycin. HepG2 cells were seeded in culture medium at a concentration of 100,000 cells/ml overnight at 37 °C (0.5 ml cell suspension per well of 24-well plate). After incubation, the medium containing unattached cells was removed. Prior to medium replacement surfaces were washed twice with PBS. HepG2 cells were cultured for 7 days on PAA brush surfaces as well as in TCPS wells for control. Several control samples were labeled as ‘soluble HGF’ or ‘HGF in media’; i.e. the growth factor was added directly to the cell culture medium instead of being immobilized on the brush surface. The indicated concentrations of soluble GFs in the cell culture media were 10, 25 or 50 ng/ml. mESC cell culture. Mouse embryonic stem cells (mESCs) were expanded by cultivating on growth-arrested murine embryonic fibroblast (MEF) feeder cells in gelatin-coated tissue culture plates at 37 °C and 5% CO2, 95% air. The culture medium consisted of DMEM supplemented with 15% ES-qualified FBS, 200 U/ml penicillin, 200 mg/ml streptomycin, 2 mM L-glutamine, 1mM non-essential amino acids, 100 nM 2-mercaptoethanol, and 1000 U/ml LIF. The cell seeding was carried out by incubating mES cell suspension with the brush or control samples in 24-well plates in culture medium at a concentration of 100,000 cells/ml. After overnight ACS Paragon Plus Environment

11

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 49

incubation at 37 °C, unbound cells were removed by washing with warm PBS. Stem cell samples for differentiation purposes were maintained on brushes with immobilized bFGF (physi- or chemisorbed) or with soluble 25 ng/ml bFGF in media. Differentiation medium consisted of DMEM/F12 supplemented with 1% FBS for the first 3 days replaced then 1X B27 supplement for the last 3 days, 200 U/ml penicillin, 200 mg/ml streptomycin, 1 mM non-essential amino acids, and 50ng/ml Activin A. Control samples were seeded on fibronectin-incubated TCPS since it is the standard for mESC differentiation. 2.6 Cell Analysis In order to study cell attachment, morphology and proliferation the HepG2 and mES cells were imaged and counted by a bright field Zeiss microscope. For all quantification assays the modified or unmodified PAA brush sample number was n=3. To visualize the HepG2 scattering morphology, cells were stained for actin filaments using a red fluorescent rhodamine–phalloidin dye according to manufacturer protocol (product number R415, Invitrogen). Briefly, cells were washed several times with PBS, fixed with 3.7% paraformaldehyde for 5 minutes, permeabilized with 0.1% Triton-X100 solution for 3 minutes and blocked with 2% BSA for 30 minutes. Samples were then incubated with the phalloidin solution at room temperature for 20 minutes, washed 3 times in PBS, mounted with a DAPIcontaining mounting medium (blue staining nuclei-Vectashield) and imaged. Live/Dead staining of HepG2 cells was performed according to the manufacturer’s instructions by incubating samples washed with PBS in a solution of 2 µM calcein AM + 4 µM EthD-1 for 10 minutes, washing and imaging immediately (Invitrogen L3224 ). Quantitative real-time polymerase chain reaction (qRT-PCR) was used for the analysis of gene expression profiles after HepG2 or mES cell sample collection. Cells were trypsinized, resuspended in 200 µl of lysis bufferACS (Roche) and Plus then Environment stored at -80 °C. Total RNA was extracted Paragon 12

Page 13 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

from the cell lysates using the ‘Total mRNA isolation’ kit (Roche) according to the manufacturer’s instructions. The cDNA was synthesized using ‘Quantitest Reverse Transcription’ Kit (Roche) according to manufacturer’s instructions. In case of HepG2 cells qRT-PCR was used to determine the expression of albumin, alpha-fetoprotein (AFP) and hypoxia-inducible factor 1 (HIF1). Primers for human albumin (forward: 5′- CATCCTGAACCGTCTGTGTG and reverse: 5′-TTTCCACCAAGGACCCACTA), human AFP (forward: 5′AGAACCTGTCACAAGCTGTG and reverse: 5′-GACAGCAAGCTGAGGATGTC), human HIF1 (forward: 5′-GCCCTACGTGCTGTCTCA and

reverse: 5′-TGCGAATGCAAATCACTAGAA) and human GAPDH (forward: 5′AGACAGCCGCATCTTCTTGT and reverse: 5′-CTTGCCGTGGGTAGAGTCAT) genes were selected from a database (http://medgen.ugent.be/rtprimerdb). GAPDH was used as a housekeeping gene. All PCR reactions were done in duplicate. The relative expression level of each gene was calculated using the comparative threshold cycle (Ct) method with GAPDH as a housekeeping gene and an internal standard. The number of samples (culture surfaces) used for statistical analysis of PCR data was n = 3 for all conditions. Further, the same qRT-PCR method was used for mESCs to determine the expression of pluripotency as well as differentiation towards endoderm markers. Primers for mouse Sox17 (forward: 5′- GGCGCAGCAGAATCCAGA and reverse: 5′- CCACGACTTGCCCAGCAT), mouse Foxa2 (forward: 5′- GGGAGCGGTGAAGATGGA and reverse: 5′TCATGTTGCTCACGGAGGAGTA), mouse AFP (forward: 5′- TCGTATTCCAACAGGAGG and reverse: 5′- AGGCTTTTGCTTCACCAG), mouse Goosecoid (forward: 5′GCACCATCTTCACCGATGAG and reverse: 5′- AGGAGGATCGCTTCTGTCGT) and mouse GAPDH (forward: 5′- GCACAGTCAAGGCCGAGAAT and reverse: 5′GCCTTCTCCATGGTGGTGAA) genes were selected from the same database. ACS Paragon Plus Environment

13

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1.

Page 14 of 49

3. Results and Discussion

3.1 Surface Characterization The established ‘grafting to’ approach resulted in well-defined and homogenously distributed PAA brushes.32-34 A three-step surface modification technique was adapted in order to create an ultrathin polymer brush layer. The resulting brushes were bound with one or more anchoring points to the surface - they are thereinafter named pseudo or Guiselin brushes.24 The benefit of this particular grafting procedure is the one step reaction process. Yet, the grafting performance of the Guiselin brushes can be theoretically approximated, assuming full polymer dissociation in a charge-free solution.36 The average number of grafting points (g.paverage) can be approximated via the degree of dissociation and the average number of free monomer segments Nfree, i.e. g.paverage = N/Nfree.37 Nevertheless, this remains a coarse estimation, since the condition of no additional charges in solution is not fully satisfied (experiments performed in PBS). Accordingly, the number of grafting points per polymer, one or two, is an estimate. This type of loop-and-tail-forming brush has been proven to closely resemble in behavior a 'real' endanchoring brush since their swelling performance (or ratio) are comparatively similar.25

Table 1: Ellipsometric monitoring of polymer brush ‘grafting-to’ and swelling layer SiO2 PGMA PAA (dry) PAA (in PBS)

Refractive index (at λ= 632,8 nm) 1.4598 1.525 1.5222 1.355 ± 0.01

Thickness (nm) 1.2 ± 0.1 2.3 ± 0.2 7.9 ±0.4 74.0 ± 5.0


14

Page 15 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Along with each step of the grafting procedure, VIS-SE measurements were performed to monitor the successful grafting of the PAA brush on the silicon surface as well as the swelling behavior of the PAA brush in situ. The estimated mean values of each built-in layer are listed in Table 1. For the refractive index of the thin (less than 10 nm) dry PAA brush the Cauchy parameters of a 50 nm thick dry PAA layer were estimated and were applied as fixed values to the Cauchy relationship. The swelling thickness and refractive index were simultaneously estimated in situ, and the mean values are given on the last row. In PBS buffer (pH 7.4 and 0.132 M Na+ concentration) the COOH groups of the PAA brush are expected to be fully dissociated and the brush is found to be in the osmotic swelling regime.38

Table 2: Surface characteristics of PAA polymer brushes (editor 1; comment 4; table format was adjusted) PAA Brush characteristics

MN

(g/mol) 25000

Grafting density

Distance between grafting points

Roughness Rq, RMS

Isoelectric point

Contact angle

(nm-2) 0.28

(nm) 1.89

(nm) 0.208

(pH) 3.2

(°) θa=17.8

θr=17. 2

Table 2 summarizes the PAA brush characteristics. The grafting density was calculated using the bulk density of PAA = 1,22 g/cm3,39 and the ellipsometrically estimated dry brush thickness shown in Table 1, according to σ = h ρ Nfree / MN. The distance between the grafting points, dg, was calculated according to dg = 1/σ2. The homogeneity of the prepared layers, as well as the root mean square (Rq RMS) roughness of the polymer brush were monitored by AFM microscopy in tapping mode. The RMS value in Table 2 is a mean value of n = 6 scanned brush samples and a representative figure of such a PAA brush layer is given in Figure 1. The surface charge properties were determined by electrophoretic mobility measurements. The isoelectric point of the brush, given in Table 1, represents the pH value where zeta potential is zero. Finally, ACS Paragon Plus Environment

15

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 49

water contact angle was estimated by dynamic captive bubble measurements at room temperature. The advancing and receding angles are statistically estimated and are mean values of n = 3 samples.

Figure 1: AFM images of the PAA brush surface. Polymer chains are homogeneously distributed on the surface, conferring very small surface roughness (Rq = 0.208 nm).

After successful grafting of the PAA brush GFs were incorporated onto the surface either via physical adsorption (physisorption) or via covalent binding (chemisorption). For covalent binding, the carboxyl groups of the polymer chains were activated by means of EDC/NHS reaction. Following the activation step GFs (HGF and bFGF) were chemisorbed to the brush via amide bond formation. In order to gain further insight into the preparation protocol as well as on the chemical activation of the surface PAA brushes were grafted on an ATR-FTIR crystal and the internal reflection spectra were recorded. Figure 2a displays measurements at the end of each preparation step of the grafting process as well as after chemical activation of the COOH groups via EDC/NHS chemistry. After each preparation step and prior to each measurement the silicon ATR crystal was air-dried with N2. The spectra are shown in the frequency range of 1900 to 1500 cm-1. The spectrum shown in grey represents the compensation of the silicon crystal substrate which ACS Paragon Plus Environment

16

Page 17 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

was taken as the baseline and subtracted from all subsequent spectra. The ATR-FTIR spectrum of the PGMA layer is shown in blue. The vibrational band at 1730 cm-1 is attributed to the C=O stretching vibration of the PGMA. The purple spectrum represents the PGMA layer onto which the PAA brush layer is attached via the ‘grafting-to’ method. A shoulder at around 1705 cm-1 appeared, which is due to strongly hydrogen bonded COOH groups of the attached PAA brush, and the signal at 1730 cm-1 increased, which is due to both C=O stretching of PGMA and the formation of new ester bonds between PAA (carboxyls) and PGMA. Additionally, weakly hydrogen bonded COOH groups prevailing in distant PAA chains of a brush might also appear at 1730 cm-1. The ATR spectrum after EDC/NHS activation ( step III) is shown in cyan. Here two additional bands appear at 1760 and 1800 cm-1.40 These can be assigned to the symmetric and antisymmetric vibrations of the carbonyl groups in the succinimidyl ring.

Figure 2: (a) ATR-FTIR spectra of PAA polymer grafting and EDC/NHS activation of the COOH group. The experiment was performed in 4 discrete steps. Step 1 SiO2 substrate, step 2 PGMA grafting, step 3 PAA grafting to, step 4 EDC/NHS activation. Curves were shifted along the vertical axis for better display. (b) Dynamic in situ VISSE recording of grafting to, swelling and EDC/NHS activation of the PAA polymer brush.

The polymer brush comprises an ultra-thin dynamic polymer layer with swelling capacity depending on the ambient medium, which was assessed using dynamic in situ ellipsometry. Figure 2b shows the thickness and refractive indices of the PAA brush in three subsequent states. The dry brush thickness was steadily estimated to be d = 8.3 nm. The swelling performance of the brush ACS Paragon Plus Environment

17

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 49

was recorded for MES buffer pH 6.0, since this was the optimum swelling condition prior to EDC/NHS activation. At this pH, the COOH groups are dissociated and the brush swells to nearly maximum extent with a swelling ratio of dswollen/ddry = 9.2. According to E.Bittrich et al., who performed detailed analysis via QCMD coupled to VIS-SE, a high amount of buffer was found to be coupled to the brush-solution interface in addition to the content of buffer inside the brush layer. Finally, the de-swelling of the brush immediately after the exchange of the MES buffer to the EDC/NHS solution was recorded. After the rapid reaction of the COO- groups with EDC/NHS the brush collapses rapidly, i.e. decreases in thickness for about 55 nm accounting for a ~ 2.3 swelling ratio. This phenomenon is attributed to the decrease of the osmotic pressure inside the brush arising from the negative charges of the dissociated carbonyl groups.

3.2 Polymer Brush Bio-functionalization Incorporation of GFs. Polymer brush surfaces were successfully bio-functionalized with either human hepatocyte growth factor (HGF) or basic fibroblast growth factor (bFGF). Incorporation of the growth factors onto the PAA brush was performed with three different initial concentrations, 1 µg/ml, 0.5 µg/ml and 0.1 µg/ml. The GFs were either physically adsorbed onto the brush surface (physisorption) or chemically attached on the activated brush via covalent binding (chemisorption). The physisorption of GFs on the PAA brush is based on ionic attraction between the oppositely charged GF molecules and PAA brushes. At physiological conditions in PBS solution with a pH of 7.4 the net charge of both GF molecules is positive - in contrast, the PAA brush is negatively charged. The corresponding isoelectric points are pIHGF = 7.9 and pIbFGF = 9.6 (estimated by Fasta UniProt software) and pIPAA = 3.2 (Table 2). According to in situ ATR-FTIR (data not shown) and VIS-SE analysis of the swollen PAA brush, almost all COOH groups are expected to be dissociated under these conditions. The PAA brush is highly negatively charged and the swelling reaches maximum possible thickness in PBS (Table 2). As a ACS Paragon Plus Environment

18

Page 19 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

result, the tendency of the GF molecules to adsorb via electrostatic interactions (physisorption) onto the PAA brush surface is significant and their physisorbed amount is expected to be high.

Figure 3: Amount of GFs incorporated onto PAA polymer brushes estimated by individual sandwich ELISA assays. (a) Physi- and chemisorbed HGF amount on PAA brushes, and (b) Physi- and chemisorbed bFGF amount on PAA brushes.

As described, chemisorption refers to the covalent attachment of the HGF and bFGF on the PAA polymer chains via chemical bonds. This type of PAA brush bio-functionalization is expected to yield surfaces with constant GF presentation resulting from minimal amide bond dissociation rates. Figure 3 shows the content of the physi- and chemisorbed HGF and bFGF on the PAA polymer brushes, which was quantified by two individual sandwich ELISA assays specific for each GF. Table 3 summarizes the percentages of incorporated GF amounts with respect to initial loading concentrations. After washing, only small quantities of unbound GFs were detected for both physisorption and chemisorption techniques. Generally, it was observed that increasing GFs' initial concentration led to higher total immobilized GF amounts, as illustrated in Figure 3. Electrostatic attraction via physisorption resulted in higher initial amounts of bound GF compared to covalent binding, probably due to unspecific adsorption. However, it was obvious that the total bound GF amount for both bio-functionalization strategies increased with higher initial GF concentrations.


19

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 49

In conclusion, both GFs were successfully physically and chemically incorporated onto PAA brushes in similar quantities. In all cases the physisorbed GFs showed higher affinity to the PAA brush substrate. The incorporated amount was gradually regulated by variations in initial loading GF concentrations. Release of GFs. Release of both GFs from the PAA brush surface was analyzed after both physisorption and chemisorption, shown in Figure 4. Following overnight reactions, GFs were released at physiological conditions in PBS at 37 °C. Individual release solutions were subsequently analyzed with corresponding ELISA assays. Samples were collected at different time intervals starting from 2 hours up to 7 days. Overall, the amounts of GFs released after physisorption (Figure 4 a1,b1) were much higher than after chemisorption (Figure 4 a2, b2).

Figure 4: Release kinetics of HGF and bFGF from PAA brushes. Three initial loading concentrations were tested: 0.1 µg/ml, 0.5 µg/ml, 1.0 µg/ml for physisorped (a1, b1) and chemisorbed (a2, b1) HGF and bFGF respectively. Release GF % was calculated with respect to total incorporated amount per sample. GF release data shows total ACS Paragon Plus Environment cumulative release over 7 days.

20

Page 21 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

A common feature for all investigated physisorbed-GF brush systems was the initial burst release during the first hours, and the subsequent steady release for the rest of the time. In contrast, covalently-bound GFs released at a low, slow, steady rate from the brush surface. Thus, the released GF amount can be customized to various application needs by adjusting the initial GF loading concentration, the GF incorporation method and, additionally, by the brush composition (data not shown). In our studies the cumulative release for the lowest incorporated GF concentration (0.1 µg/ml) was close to zero of all sample groups. The amount of released GF increased for the other two (higher) initial concentrations of 0.5 µg/ml and 1.0 µg/ml (Figure 4). Interestingly, general differences can be observed between the cumulative release of HGF (Figure 4 a1, b1) and bFGF (Figure 4 a2, b2). bFGF-functionalized brush surfaces released the GF in higher amounts after both physisorption as well as chemisorption. In Figure 4 the cumulative released GF amounts are given in percentages relative to the incorporated total amount per sample. Specifically, for physisorbed GF surfaces, we found approximately 5 times more bFGF released over one week compared to HGF. The release kinetics of chemisorbed-GF release were even more surprising. Here, almost no HGF was released from PAA brushes over the course of the week (Figure 4 a2). In contrast, the amount released after bFGF chemisorption on PAA brushes was found to be up to 10-fold higher than that of HGF. This phenomenon could be explained by hydrolysis of the amide bonds41, 42 and possible dissociation of the bFGF from the brush. It is also possible that, due to bFGF protein characteristics, the released molecules were initially not bound as tightly to the PAA brush. Another reason for the different release behavior of HGF and bFGF could be their thermal stability in solution during the experimental procedures. Along these lines, H. Layman et al. had previously reported release of bFGF EDC/NHS-mediated

covalent

binding

onto

after

gelatin-based hydrogels.43 The

aforementioned study had also shown that release of covalently bound bFGF is indeed possible. ACS Paragon Plus Environment

21

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 49

In conclusion, all bio-functionalized PAA brushes were able to release the two GFs in a time-controlled manner in different ratios. Almost all physisorbed bFGF was released into solution after 7 days, in contrast to the release of physisorbed HGF, which was 5 times less (Figure 4). Almost no release of chemisorbed HGF was found after a week, whereas almost 50 % bFGF was released after covalent binding at the same time point (Figure 4). We generally assume that the GF release kinetics depend on the polymer brush properties, the probable simultaneous occurrence of physi- and chemisorption as well as on specific relevant GF characteristics. Physiologically, growth factors differ in the mode of delivery and response. In vivo, the ECM can regulate the spatial and temporal presentation of GFs by controlling their binding extent to the matrix, often via glucosaminoglycans (GAG) like heparin.6, 44, 45 A multitude of GFs, including bFGF and HGF, contain one type of heparin-binding domain which allows GAG interactions. Heparin-binding motifs frequently contain clustered basic amino acid residues which permit favorable ionic interactions with the sulfate and carboxylic groups of the GAGs.46, 47 Spacing of such clusters with non-basic residues is relatively common. In case of bFGF, studies have shown that the spatial distribution of the basic amino acid residues has a three loop topology.48, 49 In contrast, the amino-terminal domain of HGF is the important binding epitope for most matrix and ligand interactions and has a hairpin loop structure with a highly positive net charge, responsible for a strong GF-matrix interaction.50, 51 Considering the natural interaction of both GFs with GAGs via their individual characteristic heparin-binding site gives us a potential indication about the different GF matrix binding affinities, possibly explaining their different affinities and the release kinetics from the brush matrix. With this in mind, the PAA brush is designed to act as a flexible, nano-scaled ECM substitute carrying essential functionalities like carboxylic groups similar to those of GAGs. 52


22

Page 23 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

3.3 Cell Studies Effect on human hepatoma cell line (HepG2). Cell experiments with HepG2 cells were performed in order to test the effect of bio-modified HGF-PAA polymer brushes. The main focus was on the potential difference in bioactivity between the physisorped HGF-PAA and chemisorbed HGF-PAA surfaces. Since certain effects of known concentrations of HGF on HepG2 cells have been well described in literature,29, 53-55 we performed similar assays and focused on the bioactivity and bioavailability of HGF in the PAA-brush system. HepG2 cells have an over-expression of the HGF receptor, the proto-oncogene c-Met, and, specifically, its high affinity form.53, 55 Soluble HGF has been shown to independently have anti-proliferative and scattering effects on these cells, although the two processes could be part of a tumor invasion mechanism.29

Figure 5: (a) HepG2 adhesion and live/dead assay on HGF-modified PAA brushes. (b) Growth arrest of HepG2 cells by HGF-functionalized PAA brushes. Cell proliferation results over 6 days. The highest proliferation inhibition is shown for chemisorbed HGF on PAA brushes (pink diamonds). Graph results are shown as mean value of n=3 individual samples.


23

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 49

Figure 5a shows the adhesion of the HepG2 cells on all investigated surfaces (grey). HepG2 cells seeded well on unmodified PAA brushes and physisorped HGF-PAA, at about 65% compared to the TCPS control. This was expected since HepG2 cells adhere very well to TCPS in serum-containing media. Moreover, at high salt concentration PAA brushes (25 kDa) most probably do not adsorb as much of the serum proteins as TCPS.34, 56 Interestingly, for chemisorbed HGF-PAA samples, the seeding density was the same as for TCPS surfaces. This could result from the presence of HGF on the surface that could potentially enhance adhesion. Viability of HepG2 cells on PAA brushes was further tested (Figure 5a green). All samples showed around 95 % viability. Thus, it can be concluded that PAA brush surfaces do not disturb cell viability, but do partially diminish cell seeding density. Nevertheless, HGF immobilization increases initial cell number on the brush surface (Figure 5a). HGF has been involved in metastasis and tumor invasiveness of HepG2 cells and this effect is known to proceed through a variety of pathways downstream of the HGF receptor cMet, including growth arrest, scattering, epithelial-to-mesenchymal transition (EMT) and upregulation of hypoxia-inducible factor 1 (HIF1) among others.10, 57 A widely known effect of HGF on HepG2 cells is the inhibition of proliferation, or growth arrest in G1 phase.58 HGF is reported to inhibit proliferation of these cells in predictable, dose-dependent manner.59, 60 Growth arrest effects are shown in Figure 5b. Cell numbers start to decrease observably compared to the control already on day 2 of culture. The proliferation rates seem similar for cells on brushes and TCPS without any HGF at all, and cells keep proliferating until day 6 of culture. In the HGF-containing samples, cells have a lower proliferation rate. Interestingly, the most dramatic proliferation inhibition was caused by chemisorbed HGF on PAA brushes, very similar to the TCPS samples that had an additional 10


24

Page 25 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

ng/ml of HGF in the medium. This effect is remarkable, since the amount of HGF released from the chemisorbed HGF-PAA samples is minimal, especially compared to the soluble amount added each day to the medium. It could be that the cells are continually exposed to the immobilized HGF on the surface of PAA brushes and are able to use it for the initiation of the growth-arrest signaling cascade.12, 21, 45 Another possible explanation is the better maintenance of HGF structural integrity after immobilization over longer time periods.12, 45 Another prominent effect that HGF is known to have on HepG2 cells is scattering, which could be part of the EMT process and/or metastasis program.61 Starting with very low concentrations of soluble HGF (often at 5 ng/ml and less) HepG2 cells separate from their colonies and acquire a scattering phenotype, losing expression of E-cadherin (a cell-cell adhesion molecule).61-64 Dissociation from the colony is accompanied by migration of cells away from the cluster, by way of formation of lamellipodia, extension of cell membrane and a spindle-shaped, fibrotic phenotype. The scattering phenomenon is associated with the fact that HGF induces invasiveness of carcinoma cells and contributes to metastasis formation of existing tumors.10, 64, 65 Figure 6 shows the results of cell scattering studies. Without HGF, on both TCPS and PAA brushes the cells are rounded and are seen in groups, as they proliferate and form regularly- shaped colonies (Figure 6 A1-A3). Even at 5 ng/ml of soluble HGF (A2), the TCPS sample in Figure 6 does not show significant phenotype changes. At concentrations of 25 ng/ml soluble HGF in medium the cells did scatter on TCPS (data not shown). The particular concentration of 5 ng/ml was used as a control, since it is comparable to the average amount released per sample from the physisorbed HGF on PAA brushes – approximately 4ng/ml daily. Thus, the scattering phenotype of cells on PAA brushes with soluble HGF and those on brushes


25

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 49

releasing physisorbed HGF in similar concentrations per day is comparable - cells acquiring a more fibrotic shape with numerous lamellipodia. Even more surprising is the cell behavior on PAA brushes with chemisorbed HGF. These samples release on average about 0.8 ng/ml HGF daily, and elicited a dramatic scattering response from the attached cells (Figure 6, A6). Thus, chemisorbed HGF released from the PAA brushes at a concentration roughly 10 times lower than that added to the media in soluble form shows superior bioactivity and fibrogenic potential.

Figure 6: HepG2 immunostaining shows the scattering effect of HGF on HepG2 cells. Nuclei are stained with DAPI (blue) and cytoskeletal F-actin filaments are rhodamine-phalloidin labeled (red). A1 - TCPS plate, A2-TCPS with soluble 5 ng/ml HGF, A3 - PAA brushes without HGF, A4- PAA brushes with soluble HGF, A5 PAA brushes with physisorped HGF, A6 - PAA brushes with chemisorbed HGF. Scale bars 50 µm.

Interestingly, 5 ng/ml soluble HGF was enough to induce a migrating phenotype of cells seeded on PAA brushes (Figure 6 A4), showing that possibly cells were more responsive to HGF when seeded on the brushes. Moreover, it could be that when seeded on the brush, cells had more


26

Page 27 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

accessibility to soluble HGF. The main samples under study were the chemisorbed and physisorbed HGF-PAA brushes (Figure 6 A5, A6), and the cells on them clearly showed an invasive phenotype and scattered away from their initial colonies. This clearly demonstrates that the HGF that was immobilized by covalent or physical interactions on the PAA brushes remained biologically active and available to the cells, in enough amounts to elicit a scattering response.

Besides the effects on cell migration, HGF also mediates the gene expression of multitude genes. Here, effects on a few genes were tested for immobilized growth factor on PAA brushes and were compared to its soluble form (control sample), Figure 7.

Figure 7: Effect of HGF-modified PAA brushes on HepG2 fate. (a) Down regulation of albumin and AFP genes by HGF in PAA-brush and control samples. (b) HGF effects on over-expression of HIF1 gene in HepG2 cells shown in control and PAA-brush samples. Graph results are shown as mean value of n=3 individual samples on day 3 of culture.

Previous studies have shown that HGF down-regulates both albumin and AFP production and gene expression in HepG2 cells, and upregulates HIF1 expression.57, 66 The two mechanisms are unrelated and the genes are expressed through different signaling pathways.


27

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 49

Therefore these were chosen in order to prove the bioactivity and biospecificity of the HGFPAA modified surface. Albumin and AFP gene expression is shown in Figure 7a. For control samples of soluble HGF, 25 ng/ml was added to the media every day, and cells were tested on day 3. All samples are normalized to TCPS values. As expected, all samples with HGF, either soluble or immobilized showed decreased gene expression for both genes, since they are both regulated by the AFP enhancer gene which is down-regulated by HGF.66 Interestingly, the AFP gene expression values are similar for samples of chemisorbed HGF on PAA brushes, soluble HGF on PAA brushes and soluble HGF on TCPS. This indicates, once again, that the HGF immobilized on the brushes, covalently and physically, is both available and active in controlling gene expression pathways along its signaling mechanism. Furthermore, a much smaller total amount of HGF on the brush surface elicits the same response than a higher soluble amount. This fact is confirmed by a similar effect in HIF1 gene expression studies (Figure 7b). In normoxic conditions, HIF1 is overexpressed by HGF in soluble form,57 and as seen from the Figure 7, also in immobilized form on the PAA brush. A similar effect is observed where PAA with chemically-bonded HGF has a similar, and slightly higher, gene expression compared to samples of TCPS or PAA where HGF was added in the medium in much higher amounts. HIF1 plays a central role in tumor progression through metabolic adaptation and angiogenesis and its upregulation is linked to tumor metastasis. In conclusion, bio-functionalized HGF-PAA brushes are proven to be functional since they were able to regulate HepG2 cell fate in a predictable manner. Chemisorbed HGF on PAA was found to be the most bioactive one. This phenomenon could be explained by the long term availability of the growth factor, successful exposure and preserved bioactivity due to protection from internalization and enzymatic degradation.12, 45


28

Page 29 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Effect of PAA brushes and bFGF immobilization on stem cells. Mouse embryonic stem cell studies have been performed on bio-functionalized bFGF-PAA brush surfaces. The aim of these experiments was to examine the specific cell response to the bioactive bFGF-brush substrates. Similar to the HGF bio-functionalization, two different approaches were followed: physisorption and chemisorption of bFGF.

Figure 8: Effect of bFGF-modified PAA brushes on mESC cell fate. a. Attachment of cells to PAA brush surfaces, immobilized with bFGF or fibronectin as control. b. Pluripotency gene expression values for cells cultured in pluripotency-maintaining medium on unmodified PAA brushes, gelatin (negative control) or feeder cells (positive control). Results are normalized to the 'cells on gelatin' gene expression. c. Gene expression of endodermal markers of mESC cells maintained on PAA brushes or fibronectin (control) in endoderm-induction medium, with either soluble or immobilized bFGF.

Adherence of mESCs onto the polymer brush surfaces was initially investigated.


29

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 49

Conventionally, embryonic stem cells are cultured on underlying ECM molecules (collagen, fibronectin) that are pre-adsorbed onto the surface. Interestingly, PAA brushes incubated with serum-containing medium were found to be an appropriate system for cell adhesion (Figure 8a). For TCPS samples, presence of soluble bFGF in the medium did not change numbers of adherent cells, and the situation was similar for PAA brush samples. Presence of immobilized bFGF on the PAA brushes also did not influence cell adhesion to the brushes. Overall, about 45 % less cells attached to the PAA brush surfaces compared to fibronectin-coated TCPS (optimal condition). The number of adherent mES cells was appropriate to proceed with cell experiments. Pluripotency is the capacity of a stem cell to retain its phenotype, and its ability to differentiate into almost any cell under controlled circumstances. This issue is of prime importance in stem cell research, and the ideal conditions for pluripotency maintenance in vitro are of interest. To that end, mESC behavior on unmodified PAA brushes was analyzed in a medium that is consistently pluripotency-maintaining in the presence of mouse embryonic feeder cells (Figure 8b). Gene expression profiles were obtained for 3 main pluripotency genes: Oct3/4, Nanog and Rex1. The sample cells 'c' on feeders was analyzed as control (i.e. optimum) and, as expected, showed the highest gene expression values (Figure 8b). On the other hand, the sample cells 'c' on gelatin, which are known to spontaneously differentiate in the absence of feeders (i.e. negative control) showed the lowest pluripotency gene expression. All gene expression values were normalized to the latter samples. The main focus was on cultivation of cells on PAA brushes (Figure 8b). The brush surfaces showed an impressive trend: pluripotency gene expression values were higher for these cells compared to the gelatin control by 2.5 to 5 times.


30

Page 31 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

These results are consistent with bright field microscopy analysis where mESC colonies on brushes showed a rounded morphology and formed tighter aggregates (data not shown). This morphology is very different from monolayer structures seen on gelatin and more similar to pluripotent colony morphology seen on feeder cells. The fact that mESCs maintained pluripotency better on PAA brushes could be due to the elastic modulus (soft characteristic of the polymer chains) of the brush surfaces, since it has been shown that softer surfaces promote undifferentiated phenotype.67, 68 Nevertheless, further studies, including those comparing the mechanical properties of the two surfaces quantitatively, are needed to investigate this phenomenon. Another possible cause of the bioactivity and pluripotency potential of the brush surfaces might be the presence of the GAG-mimicking COOH functional group on the PAA molecules. Bio-functionalized PAA brushes that had bFGF either covalently or physically immobilized on the surface were also used for mESC cell studies. The intention of further investigations was the controlled differentiation of stem cells into a 'developed' cell type. As it has been previously discussed, bFGF had a different release profile than HGF, with about ~ 10 ng per brush sample released per day from either the chemisorbed or physisorped samples. This fact was used in endoderm differentiation experiments, where bFGF is known to enhance differentiation in synergy with Activin A.31, 69, 70 Cells were cultured in differentiation medium containing 50 ng/ml Activin A, and either brush-immobilized or 10 ng/ml soluble bFGF added to the medium (control sample). Gene expression levels of 3 endodermal markers69 on day 6 of culture are presented in Figure 8c. All sample data is normalized to the 'gold standard', which is currently mESCs on fibronectin. Foxa2 and Sox17 gene levels were similar to control for PAA brushes with soluble or physisorbed bFGF. Goosecoid, which is a mesendodermal marker, was


31

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 49

elevated compared to control for the PAA physisorbed bFGF group. Most interestingly, for the PAA brushes with covalently immobilized bFGF, the highest levels of all 3 endodermal genes were observed. On average, these values were 3 times higher than the control. These finding suggests that bFGF is possibly maintained in its bioactive form longer on the brushes than in solution, or is more available to the cells. It is also probable that the local gradient that is established on brush samples is more favorable for bFGF bioactivity and signaling. We have demonstrated that PAA-polymer brush systems are an adequate and at times superior system for cultivation of mouse embryonic stem cells and their differentiation into endodermal progenitor cells. In particular, the chemisorption of bFGF, which resulted in slower release rates, led to the highest endodermal marker expression with respect to control in stem cell differentiation. This ability to tune growth factor release kinetics is an important feature of the brush system, especially in the context of embryonic stem cells. Since stem cell differentiation is a complex process that depends in a major part on very specific concentrations of growth factors and their timing, spatiotemporal control over their presentation is crucial. Often, both a burst release and zero-order release of the same or different morphogens occurs in vivo during embryogenesis and is replicated in vitro.20, 71-73

4. Conclusion

Polymer brushes bio-functionalized with growth factors were used as active cell culture substrates in this study. The brushes were functionalized with HGF or bFGF. Two different approaches were used for GF immobilization: physisorption (adsorption via electrostatic interactions) and covalent binding of the growth factors (chemisorption). Growth factor release kinetics from the PAA polymer brush surfaces over one week showed


32

Page 33 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

contrasting results. Most chemisorbed HGF did not release from PAA brushes, whereas almost all physisorbed bFGF was released after 7 days, independent of initial loading concentration. The bioactivity of HGF-modified PAA homo-polymer brushes was tested with respect to human hepatoma cell line (HepG2) response. It was found that both physisorbed and chemisorbed HGF remained biologically active and available to the cells, causing an obvious scattering response. Further, gene expression was investigated as an additional surface bioactivity marker. As expected, albumin and AFP genes were down-regulated, whereas HIF1 was up-regulated by the presence of HGF on the PAA brushes. The chemisorbed form of HGF was found to have greater biological effect on HepG2 gene expression and the most significant effect on cell growth arrest. In order to define the effect of the bFGF-functionalized PAA brushes, culture studies with mouse embryonic stem cells (mESCs) were conducted. mESC adhesion to brushes was found to be sufficient, but smaller than that on fibronectin-coated tissue TCPS surfaces. Interestingly, unmodified PAA polymer brushes were found to assist in pluripotency maintenance in the absence of feeder cells. When combined with Activin A, use of bFGFmodified PAA brush surfaces resulted in guided differentiation of mESCs into endodermal cells, and this effect was found to be highly pronounced in case of chemisorbed bFGF. The results of the study show that growth factor-functionalized PAA polymer brushes can be used as versatile bioactive cell culture substrates. In particular, covalent immobilization of the growth factor molecules onto the brush substrate might enhance the biological response, even with lesser growth factor amounts than those contained in soluble culture media.

Acknowledgements This work was primarily supported by the German Science Foundation (DFG) within the


33

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 49

projects DFG-Nr. STA 324/49-1 and EI 317, in the context of the Materials World Network. This work was also supported in part by NIH R01DK079977. We thank Ms. Carolin Böhm who prepared polymer brush samples, Ms. Katrin Pöschel and Dr. Karina Grundke for captive bubble measurements, Ms. Anja Caspari for supervision of zeta potential measurements, Mr. Andreas Janke for supervision of AFM analysis. We also thank Dr. Amranul Haque for helpful discussions of cell culture experiments

Bibliography 1. Lanza, R.; Langer, R.; Vacanti, J. P., Principles of tissue engineering. Academic press: 2011. 2. Hubbell, J. A., Biomaterials in tissue engineering. Nature Biotechnology 1995, 13, (6), 565-576. 3. Lutolf, M.; Hubbell, J., Synthetic biomaterials as instructive extracellular microenvironments for morphogenesis in tissue engineering. Nature biotechnology 2005, 23, (1), 47-55. 4. Tayalia, P.; Mooney, D. J., Controlled growth factor delivery for tissue engineering. Advanced materials 2009, 21, (32-33), 3269-85. 5. Cross, M.; Dexter, T. M., Growth factors in development, transformation, and tumorigenesis. Cell 1991, 64, (2), 271-280. 6. Lee, K.; Silva, E. A.; Mooney, D. J., Growth factor delivery-based tissue engineering: general approaches and a review of recent developments. Journal of the Royal Society, Interface / the Royal Society 2011, 8, (55), 153-70. 7. Lee, E. J.; Kasper, F. K.; Mikos, A. G., Biomaterials for tissue engineering. Annals of biomedical engineering 2014, 42, (2), 323-337. 8. Chen, R. R.; Mooney, D. J., Polymeric growth factor delivery strategies for tissue engineering. Pharmaceutical research 2003, 20, (8), 1103-1112. 9. Eswarakumar, V.; Lax, I.; Schlessinger, J., Cellular signaling by fibroblast growth factor receptors. Cytokine & growth factor reviews 2005, 16, (2), 139-149. 10. Goyal, L.; Muzumdar, M. D.; Zhu, A. X., Targeting the HGF/c-MET pathway in hepatocellular carcinoma. Clinical Cancer Research 2013, 19, (9), 2310-2318. 11. Schlessinger, J.; Ullrich, A., Growth factor signaling by receptor tyrosine kinases. Neuron 1992, 9, (3), 383-391. 12. Ito, Y.; Liu, S. Q.; Imanishi, Y., Enhancement of cell growth on growth factorimmobilized polymer film. Biomaterials 1991, 12, (5), 449-453. 13. Kiessling, L. L.; Gestwicki, J. E.; Strong, L. E., Synthetic multivalent ligands as probes of signal transduction. Angewandte Chemie 2006, 45, (15), 2348-68. 14. Reddy, C. C.; Niyogi, S. K.; Wells, A.; Wiley, H. S.; Lauffenburger, D. A., Engineering epidermal growth factor for enhanced mitogenic potency. Nature biotechnology 1996, 14, (13), 1696-1699.


34

Page 35 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

15. Ogiwara, K.; Nagaoka, M.; Cho, C. S.; Akaike, T., Effect of photo-immobilization of epidermal growth factor on the cellular behaviors. Biochemical and biophysical research communications 2006, 345, (1), 255-9. 16. Kuhl, P. R.; Griffith-Cima, L. G., Tethered epidermal growth factor as a paradigm for growth factor–induced stimulation from the solid phase. Nature medicine 1996, 2, (9), 10221027. 17. Carmeliet, P.; Ng, Y.-S.; Nuyens, D.; Theilmeier, G.; Brusselmans, K.; Cornelissen, I.; Ehler, E.; Kakkar, V. V.; Stalmans, I.; Mattot, V., Impaired myocardial angiogenesis and ischemic cardiomyopathy in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. Nature medicine 1999, 5, (5), 495. 18. Ruhrberg, C.; Gerhardt, H.; Golding, M.; Watson, R.; Ioannidou, S.; Fujisawa, H.; Betsholtz, C.; Shima, D. T., Spatially restricted patterning cues provided by heparin-binding VEGF-A control blood vessel branching morphogenesis. Genes & development 2002, 16, (20), 2684-2698. 19. De Smet, F.; Tembuyser, B.; Lenard, A.; Claes, F.; Zhang, J.; Michielsen, C.; Van Schepdael, A.; Herbert, J.-M.; Bono, F.; Affolter, M., Fibroblast growth factor signaling affects vascular outgrowth and is required for the maintenance of blood vessel integrity. Chemistry & biology 2014, 21, (10), 1310-1317. 20. Tuleuova, N.; Lee, J. Y.; Lee, J.; Ramanculov, E.; Zern, M. A.; Revzin, A., Using growth factor arrays and micropatterned co-cultures to induce hepatic differentiation of embryonic stem cells. Biomaterials 2010, 31, (35), 9221-9231. 21. Patel, D.; Haque, A.; Jones, C. N.; Tuleouva, N.; Foster, E.; Vu, T.; Reddi, A. H.; Revzin, A., Local control of hepatic phenotype with growth factor-encoded surfaces. Integrative Biology 2014, 6, (1), 44-52. 22. Krishnamoorthy, M.; Hakobyan, S.; Ramstedt, M.; Gautrot, J. E., Surface-initiated polymer brushes in the biomedical field: applications in membrane science, biosensing, cell culture, regenerative medicine and antibacterial coatings. Chemical reviews 2014, 114, (21), 10976-1026. 23. Zhao, B.; Brittain, W. J., Polymer brushes: surface-immobilized macromolecules. Progress in Polymer Science 2000, 25, (5), 677-710. 24. Guiselin, O., Irreversible adsorption of a concentrated polymer solution. EPL (Europhysics Letters) 1992, 17, (3), 225. 25. Bittrich, E.; Rodenhausen, K. B.; Eichhorn, K. J.; Hofmann, T.; Schubert, M.; Stamm, M.; Uhlmann, P., Protein adsorption on and swelling of polyelectrolyte brushes: A simultaneous ellipsometry-quartz crystal microbalance study. Biointerphases 2010, 5, (4), 159-67. 26. You, J.; Park, S.-A.; Shin, D.-S.; Patel, D.; Raghunathan, V. K.; Kim, M.; Murphy, C. J.; Tae, G.; Revzin, A., Characterizing the effects of heparin gel stiffness on function of primary hepatocytes. Tissue Engineering Part A 2013, 19, (23-24), 2655-2663. 27. You, J.; Raghunathan, V. K.; Son, K. J.; Patel, D.; Haque, A.; Murphy, C. J.; Revzin, A., Impact of Nanotopography, Heparin Hydrogel Microstructures, and Encapsulated Fibroblasts on Phenotype of Primary Hepatocytes. ACS applied materials & interfaces 2014. 28. Tsukada, Y.; Miyazawa, K.; Kitamura, N., High intensity ERK signal mediates hepatocyte growth factor-induced proliferation inhibition of the human hepatocellular carcinoma cell line HepG2. The Journal of biological chemistry 2001, 276, (44), 40968-76. 29. Lee, W.-J.; Wu, L.-F.; Chen, W.-K.; Wang, C.-J.; Tseng, T.-H., Inhibitory effect of luteolin on hepatocyte growth factor/scatter factor-induced HepG2 cell invasion involving both


35

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 49

MAPK/ERKs and PI3K–Akt pathways. Chemico-biological interactions 2006, 160, (2), 123133. 30. Cho, L. T.; Wamaitha, S. E.; Tsai, I. J.; Artus, J.; Sherwood, R. I.; Pedersen, R. A.; Hadjantonakis, A. K.; Niakan, K. K., Conversion from mouse embryonic to extra-embryonic endoderm stem cells reveals distinct differentiation capacities of pluripotent stem cell states. Development 2012, 139, (16), 2866-77. 31. Yasunaga, M.; Tada, S.; Torikai-Nishikawa, S.; Nakano, Y.; Okada, M.; Jakt, L. M.; Nishikawa, S.; Chiba, T.; Era, T.; Nishikawa, S.-I., Induction and monitoring of definitive and visceral endoderm differentiation of mouse ES cells. Nature biotechnology 2005, 23, (12), 15421550. 32. Aulich, D.; Hoy, O.; Luzinov, I.; Brucher, M.; Hergenroder, R.; Bittrich, E.; Eichhorn, K. J.; Uhlmann, P.; Stamm, M.; Esser, N.; Hinrichs, K., In situ studies on the switching behavior of ultrathin poly(acrylic acid) polyelectrolyte brushes in different aqueous environments. Langmuir 2010, 26, (15), 12926-32. 33. Uhlmann, P.; Ionov, L.; Houbenov, N.; Nitschke, M.; Grundke, K.; Motornov, M.; Minko, S.; Stamm, M., Surface functionalization by smart coatings: Stimuli-responsive binary polymer brushes. Progress in Organic Coatings 2006, 55, (2), 168-174. 34. Psarra, E.; Konig, U.; Ueda, Y.; Bellmann, C.; Janke, A.; Bittrich, E.; Eichhorn, K. J.; Uhlmann, P., Nanostructured Biointerfaces: Nanoarchitectonics of Thermoresponsive Polymer Brushes Impact Protein Adsorption and Cell Adhesion. ACS applied materials & interfaces 2015. 35. Van Krevelen, D. W.; Te Nijenhuis, K., Properties of polymers: their correlation with chemical structure; their numerical estimation and prediction from additive group contributions. Elsevier: 2009. 36. Pincus, P., Colloid stabilization with grafted polyelectrolytes. Macromolecules 1991, 24, (10), 2912-2919. 37. Bittrich, E., Design of new responsive materials based on functional polymer brushes. 2010, PhD Thesis, TUD. 38. Currie, E.; Sieval, A.; Fleer, G.; Stuart, M. C., Polyacrylic acid brushes: surface pressure and salt-induced swelling. Langmuir 2000, 16, (22), 8324-8333. 39. Brandrup, J.; Immergut, E. H.; Grulke, E. A.; Abe, A.; Bloch, D. R., Polymer handbook. Wiley New York: 1999; Vol. 89. 40. Sam, S.; Touahir, L.; Salvador Andresa, J.; Allongue, P.; Chazalviel, J. N.; GougetLaemmel, A. C.; Henry de Villeneuve, C.; Moraillon, A.; Ozanam, F.; Gabouze, N.; Djebbar, S., Semiquantitative study of the EDC/NHS activation of acid terminal groups at modified porous silicon surfaces. Langmuir 2010, 26, (2), 809-14. 41. Antonczak, S.; Ruiz-Lopez, M.; Rivail, J., Ab initio analysis of water-assisted reaction mechanisms in amide hydrolysis. Journal of the American Chemical Society 1994, 116, (9), 3912-3921. 42. Kirby, A.; Lancaster, P., Structure and efficiency in intramolecular and enzymic catalysis. Catalysis of amide hydrolysis by the carboxy-group of substituted maleamic acids. Journal of the Chemical Society, Perkin Transactions 2 1972, (9), 1206-1214. 43. Layman, H.; Sacasa, M.; Murphy, A. E.; Murphy, A. M.; Pham, S. M.; Andreopoulos, F. M., Co-delivery of FGF-2 and G-CSF from gelatin-based hydrogels as angiogenic therapy in a murine critical limb ischemic model. Acta biomaterialia 2009, 5, (1), 230-239. 44. Cabanas-Danés, J.; Huskens, J.; Jonkheijm, P., Chemical strategies for the presentation


36

Page 37 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

and delivery of growth factors. Journal of Materials Chemistry B 2014, 2, (17), 2381-2394. 45. Masters, K. S., Covalent growth factor immobilization strategies for tissue repair and regeneration. Macromolecular bioscience 2011, 11, (9), 1149-63. 46. Ashikari-Hada, S.; Habuchi, H.; Kariya, Y.; Itoh, N.; Reddi, A. H.; Kimata, K., Characterization of growth factor-binding structures in heparin/heparan sulfate using an octasaccharide library. Journal of Biological Chemistry 2004, 279, (13), 12346-12354. 47. Kim, S.-H.; Turnbull, J.; Guimond, S., Extracellular matrix and cell signalling: the dynamic cooperation of integrin, proteoglycan and growth factor receptor. Journal of Endocrinology 2011, 209, (2), 139-151. 48. Powers, C.; McLeskey, S.; Wellstein, A., Fibroblast growth factors, their receptors and signaling. Endocrine-related cancer 2000, 7, (3), 165-197. 49. Raman, R.; Venkataraman, G.; Ernst, S.; Sasisekharan, V.; Sasisekharan, R., Structural specificity of heparin binding in the fibroblast growth factor family of proteins. Proceedings of the National Academy of Sciences 2003, 100, (5), 2357-2362. 50. Zhou, H.; Mazzulla, M. J.; Kaufman, J. D.; Stahl, S. J.; Wingfield, P. T.; Rubin, J. S.; Bottaro, D. P.; Byrd, R. A., The solution structure of the N-terminal domain of hepatocyte growth factor reveals a potential heparin-binding site. Structure 1998, 6, (1), 109-116. 51. Zhou, H.; Casas-Finet, J. R.; Coats, R. H.; Kaufman, J. D.; Stahl, S. J.; Wingfield, P. T.; Rubin, J. S.; Bottaro, D. P.; Byrd, R. A., Identification and dynamics of a heparin-binding site in hepatocyte growth factor. Biochemistry 1999, 38, (45), 14793-14802. 52. Kunou, M.; Koizumi, M.; Shimizu, K.; Kawase, M.; Hatanaka, K., Synthesis of sulfated colominic acids and their interaction with fibroblast growth factors. Biomacromolecules 2000, 1, (3), 451-458. 53. Wang, S. Y.; Chen, B.; Zhan, Y. Q.; Xu, W. X.; Li, C. Y.; Yang, R. F.; Zheng, H.; Yue, P. B.; Larsen, S. H.; Sun, H. B.; Yang, X., SU5416 is a potent inhibitor of hepatocyte growth factor receptor (c-Met) and blocks HGF-induced invasiveness of human HepG2 hepatoma cells. Journal of hepatology 2004, 41, (2), 267-73. 54. Shiota, G.; Rhoads, D. B.; Wang, T. C.; Nakamura, T.; Schmidt, E. V., Hepatocyte growth factor inhibits growth of hepatocellular carcinoma cells. Proceedings of the National Academy of Sciences 1992, 89, (1), 373-377. 55. Maulik, G.; Shrikhande, A.; Kijima, T.; Ma, P. C.; Morrison, P. T.; Salgia, R., Role of the hepatocyte growth factor receptor, c-Met, in oncogenesis and potential for therapeutic inhibition. Cytokine & growth factor reviews 2002, 13, (1), 41-59. 56. Czeslik, C.; Jackler, G.; Hazlett, T.; Gratton, E.; Steitz, R.; Wittemann, A.; Ballauff, M., Salt-induced protein resistance of polyelectrolyte brushes studied using fluorescence correlation spectroscopy and neutron reflectometry. Physical Chemistry Chemical Physics 2004, 6, (24), 5557. 57. Tacchini, L.; Dansi, P.; Matteucci, E.; Desiderio, M. A., Hepatocyte growth factor signalling stimulates hypoxia inducible factor-1 (HIF-1) activity in HepG2 hepatoma cells. Carcinogenesis 2001, 22, (9), 1363-1371. 58. Han, J.; Tsukada, Y.-i.; Hara, E.; Kitamura, N.; Tanaka, T., Hepatocyte growth factor induces redistribution of p21CIP1 and p27KIP1 through ERK-dependent p16INK4a upregulation, leading to cell cycle arrest at G1 in HepG2 hepatoma cells. Journal of Biological Chemistry 2005, 280, (36), 31548-31556. 59. Michalopoulos, G. K.; Bowen, W.; Nussler, A. K.; Becich, M. J.; Howard, T. A., Comparative analysis of mitogenic and morphogenic effects of HGF and EGF on rat and human


37

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 49

hepatocytes maintained in collagen gels. Journal of cellular physiology 1993, 156, (3), 443-452. 60. Tajima, H.; Matsumoto, K.; Nakamura, T., Hepatocyte growth factor has potent antiproliferative activity in various tumor cell lines. FEBS letters 1991, 291, (2), 229-232. 61. Stella, M. C.; Comoglio, P. M., HGF: a multifunctional growth factor controlling cell scattering. The international journal of biochemistry & cell biology 1999, 31, (12), 1357-1362. 62. Tamagnone, L.; Comoglio, P. M., Control of invasive growth by hepatocyte growth factor (HGF) and related scatter factors. Cytokine & growth factor reviews 1997, 8, (2), 129-142. 63. Kawakami-Kimura, N.; Narita, T.; Ohmori, K.; Yoneda, T.; Matsumoto, K.; Nakamura, T.; Kannagi, R., Involvement of hepatocyte growth factor in increased integrin expression on HepG2 cells triggered by adhesion to endothelial cells. British journal of cancer 1997, 75, (1), 47. 64. Tajima, H.; Matsumoto, K.; Nakamura, T., Regulation of cell growth and motility by hepatocyte growth factor and receptor expression in various cell species. Experimental cell research 1992, 202, (2), 423-431. 65. You, H.; Ding, W.; Dang, H.; Jiang, Y.; Rountree, C. B., c-Met represents a potential therapeutic target for personalized treatment in hepatocellular carcinoma. Hepatology 2011, 54, (3), 879-89. 66. Iseki, K.; Nakao, K.; Nakata, K.; Shima, Y.; Hamasaki, K.; Kato, Y.; Ishii, N.; Eguchi, K., Diverse regulations of albumin gene expression by hepatocyte growth factor in HepG2 human hepatoma cells and primary culture of rat hepatocytes. International journal of oncology 2000, 16, (6), 1141-1146. 67. Schwarz, U., Soft matters in cell adhesion: rigidity sensing on soft elastic substrates. Soft Matter 2007, 3, (3), 263-266. 68. Chowdhury, F.; Li, Y.; Poh, Y.-C.; Yokohama-Tamaki, T.; Wang, N.; Tanaka, T. S., Soft substrates promote homogeneous self-renewal of embryonic stem cells via downregulating cellmatrix tractions. PloS one 2010, 5, (12), e15655. 69. McLean, A. B.; D'Amour, K. A.; Jones, K. L.; Krishnamoorthy, M.; Kulik, M. J.; Reynolds, D. M.; Sheppard, A. M.; Liu, H.; Xu, Y.; Baetge, E. E.; Dalton, S., Activin a efficiently specifies definitive endoderm from human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is suppressed. Stem cells (Dayton, Ohio) 2007, 25, (1), 29-38. 70. Tada, S.; Era, T.; Furusawa, C.; Sakurai, H.; Nishikawa, S.; Kinoshita, M.; Nakao, K.; Chiba, T.; Nishikawa, S.-I., Characterization of mesendoderm: a diverging point of the definitive endoderm and mesoderm in embryonic stem cell differentiation culture. Development (Cambridge, England) 2005, 132, (19), 4363-4374. 71. Warmflash, A.; Sorre, B.; Etoc, F.; Siggia, E. D.; Brivanlou, A. H., A method to recapitulate early embryonic spatial patterning in human embryonic stem cells. Nature methods 2014. 72. Kinney, M. A.; McDevitt, T. C., Emerging strategies for spatiotemporal control of stem cell fate and morphogenesis. Trends in biotechnology 2013, 31, (2), 78-84. 73. Ghaedi, M.; Duan, Y.; Zern, M. A.; Revzin, A., Hepatic differentiation of human embryonic stem cells on growth factor‐containing surfaces. Journal of tissue engineering and regenerative medicine 2014, 8, (11), 886-895.


38

Page 39 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

TOC


39

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC Graph 168x140mm (150 x 150 DPI)


Page 40 of 49

Page 41 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Scheme 1 255x155mm (150 x 150 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

449x184mm (276 x 276 DPI)


Page 42 of 49

Page 43 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

720x256mm (300 x 300 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

317x111mm (276 x 276 DPI)


Page 44 of 49

Page 45 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 4 406x282mm (254 x 254 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

234x84mm (276 x 276 DPI)


Page 46 of 49

Page 47 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

352x195mm (298 x 298 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

296x114mm (276 x 276 DPI)


Page 48 of 49

Page 49 of 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

244x166mm (276 x 276 DPI)


Growth Factor-Bearing Polymer Brushes - Versatile Bioactive

Recommend Documents