Subscriber access provided by University of Sussex Library
Article
A high-throughput microfluidic device for LAMP analysis of airborne bacteria Xiran Jiang, Wenwen Jing, Xiaoting Sun, Qi Liu, Chunguang Yang, Sixiu Liu, Kairong Qin, and Guodong Sui ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.6b00282 • Publication Date (Web): 30 Jun 2016 Downloaded from http://pubs.acs.org on July 3, 2016
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
ACS Sensors is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 7
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
A high-throughput microfluidic device for LAMP analysis of airborne bacteria †
‡
Xiran Jiang, Wenwen Jing, Xiaoting Sun, † ‡ Qin, and Guodong Sui*
§
‡
Qi Liu, Chunguang Yang,
§
†
Department of Biomedical Engineering, Dalian University of Technology, Dalian 116024, China
‡
Department of Environmental Science & Engineering, Fudan University, Shanghai 200433, China
§
‡
Sixiu Liu, Kairong
Research Center for Analytical Sciences, Northeastern University, Shenyang 110819, China
KEYWORDS: Airborne bacteria, microfluidics, point-of-care detection, LAMP ABSTRACT: Rapid capture and detection of airborne pathogen are essential for disease prevention and public safety. In this study, we presented a microfluidic system that could capture and enrich airborne pathogens as well as performing high-throughput LAMP analysis. The system was validated by five species of bacteria and showed good stability and specificity. Detection limit down to approximately 24 cells per reaction was achieved for Staphylococcus aureus, and without the process of DNA purification. To our knowledge, this is the first report to describe a microfluidic system for airborne pathogen capture and high-throughput LAMP analysis. The results could be detected by the naked eyes, suggesting that the system could have great potential application in clinical diagnostics and point-of-care detection.
Airborne pathogens usually cause respiratory infectious diseases, which frequently result in panic among the general public. Human being is weak and vulnerable to these diseases, and thus techniques that are capable of rapid detection of airborne pathogens such as SARs and H7N9 avian influenza would provide early warning of the spread of these diseases.
proteins and other biomarkers. Chips that integrate PCRs or DNA microarrays or immunoassays with sample-toanswer capability have been achieved and proven to be powerful in the diagnostics of bacteria.5-7 However, these techniques often depend on costly or time-consuming detection methods, which are not suitable for point-ofcare applications.8 Although various microfluidic-base cell-enrichment and analysis techniques have been tested,9-11 on-chip capture, enrichment and detection of airborne bacteria are rarely reported.
Conventional techniques (e.g. Anderson sampler, AGI sampler or gravitational samplers) that were designed for the diagnosis of airborne pathogens have serious defects because the capture of pathogens associated with these techniques needs a culturing step, which usually takes days, and thus cannot be directly used in field bioanalysis.1 Moreover, most of the environmental pathogen are in a viable but nonculturable (VBNC) state, and therefore they cannot be detected using culture methods.2 Due to the lack of fast and efficient techniques suitable for providing early warning of diseases caused by airborne pathogens, the bacteria transported by the air are hard to prevent and have become a serious threat to public health.
Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid analysis technique with high selectivity and sensitivity, and requires less time to perform. The results generated from LAMP are visible to the naked eyes, and therefore require no sophisticated instrument, which makes it a very convenient method for rapid bioanalysis and point-of-care diagnostics.4 Although the emergence of LAMP could be dated back to 2000,12 and that it has experienced rapid development in applications related to lab-on-a-chip,13-15 it is still limited in field application. One of the main problems is that LAMP fluorescence is very weak within a couple of microliters of solution, which makes the signal emanating from the chip difficult to see clearly with the naked eyes. As a result, deepened channels (deeper than 800 μm) or reaction chambers were introduced to enhanced the LAMP signal in previous reports.5, 16, 17 However, the
Microfluidic-based technique has recently drawn lots of attention due to its low reagent consumption, short analysis time and environmentally-friendly process that can be used to develop portable biosensors.3, 4 Pathogen analysis carried out in a microfluidic chip has been frequently reported, including the analyses of genes and 1
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 2 of 7
the LAMP chip had a height of 30 μm. The angle between two neighboring channels was 72 degrees. Access holes with diameter of 650 μm were drilled into the outer edges of the channels as outlets for primers and LAMP reaction mixture. The five channels were converged at the center of the chip, where a 650-μm diameter hole was drilled to be used as the inlet for the reaction mixture.
construction of such deep channels usually involves complex construction procedures, which can cause the photoresist structure for constructing the channels to become flimsy.18 Thus, novel methods to build LAMP reaction chambers are required for large-scale fabrications of LAMP chips. A microfluidic chip that has staggered herringbone mixer (SHM) structure and can perform rapid and efficient airborne bacteria capture and enrichment has previously been established.1 Based on a similar technique, we reported in this study, the capture and enrichment of five airborne bacteria, followed by on-chip LAMP amplification. To our knowledge, this study is the first report of an on-chip airborne bacteria capture and LAMP detection system. The results could be detected by the naked eyes, which could potentially make the device portable for rapid and point-of-care detections.
Figure 1. Structure of the microfluidic chip for highthroughput LAMP and the metal half sphere on the silicon mold surface. (A) Schematic representation of the chip fabricated from two layers of PDMS. The upper layer contains five channels (30 μm thick, 17 mm long and 200 μm wide). The bottom layer contains the five half-sphere LAMP reaction chambers. (B) Microscopic image of the metal hemisphere on the silicon mold used for the construction of LAMP chamber. The photoresist structure (30 μm thick, 3 mm long and 200 μm wide) was used to mark the location for sticking the metal hemisphere onto the silicon mold.
METHODS AND MATERIALS Bacteria and Reagents. Saphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Citrobacter koseri and Klebsiella pneumonia were kindly provided by Neweast Hospital (Shanghai, China). All the bacteria were cultured in Luria-Bertani (LB) medium at 37oC for overnight. Airborne Bacteria Capture and Enrichment. The five overnight-cultured bacteria were mixed at a volume ratio of 1:1:1:1:1, and then used to generate bioaerosols by using an aerosol generator in a 125-L glass tank. The bacteria capture and enrichment process was performed according to a previous report.1 However, for the washing step that followed, 1 μl lysis buffer (DEAOU Biotechnology, China) was loaded into the staggered herringbone channel, and maintained at room temperature for 30 min for the DNA to be released from the collected bacteria. Next, the outlet of the bacteria capture chip was connected to the inlet of the LAMP chip by tubing. The lysed bacteria were then mixed with the LAMP reaction mixture and introduced into the LAMP chip through the tubing.
The double-layer structure of the microfluidic chip was constructed by standard soft lithography.6 The silicon mold for the upper flow layer of the microfluidic chip was fabricated using SU8-2025 (Microchem, USA), 30-μm thickness. To construct the silicon mold of the bottom layer of the chip, 2mm-diameter metal hemispheres were placed onto the surface of the silicon to form the LAMP chambers. The microfluidic chip was assembled from the two flow layers, both fabricated from polydimethylsiloxane (PDMS). After baking at 80oC for 1 h, the two PDMS layers were peeled off the mold and treated with oxygen plasma, then bonded together to form a LAMP chip. The double-layer airborne bacteria capture and enrichment chip consisting of a SHM structure was fabricated as previously described.1
To evaluate the limit of detection (LOD), serial dilution of the overnight-cultured S. aureus was performed to prepare the various bioaerosols. Two capture and enrichment chips were used in parallel, one was used for collecting and counting the captured bacteria, while the other one was used for the lysis of the bacteria. After the bioaerosol collection process, the capture chip was washed with 1μl ddH2O while the other one was washed with lysis buffer followed by cell lysis and LAMP amplification. The bacteria collected in ddH2O were counted using the dilution-plate counting method.
On-chip LAMP Amplification. The LAMP primers specific to each species of bacteria were designed using Primer Explorer V4 software (http://primerexplorer.jp/e/). The primers were synthesized by Invitrogen (Shanghai, China) and the sequences are shown in Table 1. The LAMP reaction mixture, which contained 20 mM TrisHCL (pH 8.8), 10mM (NH4)SO4, 10 mM KCl, 8 mM MgSO4, 1.4 mM dNTPs, 8U Bst Polymerase and calcein with manganese was obtained from Diaou Co. (China).
Chip design and Fabrication. The structure of the LAMP chip is shown in Figure 1 a. Metal hemispheres with diameter of 2 mm were stuck onto the surface of the silicon mold and used as the mold for LAMP reaction chambers (Figure 1 b). Each of the five channels within 2
ACS Paragon Plus Environment
Page 3 of 7
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors Table 1. Primer sequences
Primer
Oligonucleotide sequence (5’-3’)
Target sequence
Reference or source
NucF3
CAAGTCTAAGTAGCTCAGCAA
Staphylococcus aureus, nuc
19
NucB3
CCAAGCCTTGACGAACTAA
Escherichia coli, UidA
This study
NucFIP
TCTGAATGTCATTGGTTGACCTACATAAAGAA
NucBIP
AATATGGTCCTGAAGCAAGTGCGCTAAGCCAC
UidAF3
AGCAAGCGCACTTACAGG
UidAB3
GTGAGCGTCGCAGAACAT
UidAFIP
GACGGGTATCCGGTTCGTTGGCGTGACAAAAACCACCC AAG UidABIP GCACGGGAATATTTCGCGCCCATTGACGCAGGTGATCG G ecfXF3 GGATGAGCGCTTCCGTG Pseudomonas aeruginosa, ecfX ecfXB3
AAGTTGCGGGCGATCTG
ecfXFIP
CTTGCGCAGGAAGCGCAGCGTTCCGTCTCGCATGCCTA
ecfXBIP
GCCGACCTCGCCCAGGATAGCTCGACCGATTGCCG
CkoF3
CATGCCCGGATTGGCATTG
CkoB3
GGCGCCACATGTTTTTCAG
CkoFIP KheF3
AGCGGCTTGTGCGTACTGTTTAGGTACTTGATACGGCGA CC ATGCGCAGCGTTATTACGCGAACACCAGTTGTGAGGGTT CAA ACCTGATTGCATTCGCCACT Klebsiella pneumoniae, khe
KheB3
GCCCTCCAGCACGTAGATGAAC
KheFIP
GTTGAGACGTAAACCGCGCCCGACGATGCCACTTATCCC G GATCCACCACGAGCGACTGCTTCCTCATCGCTCTCCGC
CkoBIP
KheBIP
Citrobacter koseri, cko
20
This study
This study
reaction chambers 1,2,3,4 and 5 were pre-coated with specific LAMP primers targeting Saphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Citrobacter koseri and Klebsiella pneumonia, respectively.
The bacterial lysate was mixed with the LAMP reaction mixture. The on-chip LAMP was performed by loading the solution into the chip through the Teflon tube that was connected to the inlet, from which the solution would fill all the five LAMP chambers. After the injected solution had filled the half hemisphere reaction chamber and reached the outlets of the chip, about 0.5 μl mineral oil (Sigma) was dispensed into the inlet (via the Teflon tube) to prevent cross-talk of primers among the different reaction chambers. After that, the Teflon tube was then clamped with a hemostat. To facilitate on-chip LAMP amplification, the chip was placed over a heating membrane21 and incubated at 63oC for 50 min. In order to detect the resulting signal, all the Teflon tubes were pulled out, and an UV transilluminator (Kylin-Bell Lab Instruments Co., China) was placed beneath the chip for fluorescence excitation. The on-chip LAMP results were directly determined by the naked eyes.
Figure 2. Photograph of the airborne bacterial capture and LAMP system. (i) Bacteria capture and enrichment chip. (ii) High-throughput LAMP chip.
RESULETS AND DISCUSSION Chip Design and Fabrication. The fabricated airborne bacteria analysis system is shown in Figure 2. The system consisted of a bacterial capture and enrichment chip (Figure 2, i), and a high-throughput LAMP chip (Figure 2, ii). To facilitate the high-throughput LAMP amplification, the chip was designed to contain five 2-mm-diameter hemisphere LAMP chambers, and each chamber was individually connected to the corresponding channel. The
It is worth mentioning that previous studies of on-chip LAMP reactions have shown that the LAMP reaction channels need to be fabricated deep enough (deeper than 800 μm) so that the LAMP signals can be clearly seen with the naked eyes.5, 16, 17 However, the construction of 3
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 7
distance from each LAMP reaction chamber to the central hole was designed to be long (about 8 mm), so as to decrease the cross talks among the primers from the five reaction chambers.
such deep channels using PDMS usually involves complex construction procedures. Due to the property of the photoresist and the limitation of lithography technology, deep pipeline is difficult to obtain, even if it can be constructed. Even if deep pipeline was obtained it would still be broad and the wall would still be rough.18 Furthermore, the photoresist structure on the surface of the mold with a greater depth for constructing the channels would be more flimsy, and would be more likely to break after several uses in the fabrication of PDMS chips.
On-chip LAMP. The five bacteria were used individually or as a mixture for air aerosol generation in the glass tank. The bacteria that were collected by the airborne bacteria capture and enrichment chip were mixed with lysis buffer and directly injected into the LAMP chip without any pretreatment. As shown in Figure 3 a-e, specific LAMP result was achieved for each of the five bacteria, showing the specificity of the device. Combinations of E. coli and C. koseri, as well as P. aeruginosa with C. koseri and K. pneumonia served as templates for the on-chip LAMP amplifications, and the expected LAMP patterns were obtained for the different combinations (Figure 3 f-g). Furthermore, the five bacteria were mixed to generate bioaerosols for use as LAMP template. Positive results were observed for all the five bacteria (Figure 3 h).
We have previously reported the use of chip resistor to build a 1.25 μl DNA hybridization chamber.22 However, the rectangular chamber within the chip usually causes the generation of air bubbles at the corner of the chamber when the solution present in the chamber is heated to high temperature. Here, we first used a metal hemisphere to construct LAMP reaction chambers, which could significantly facilitate the fabrication process of LAMP chambers. The
Figure 3. On-chip LAMP fluorescence image for analyzing five airborne bacteria. (A)-(E) Reaction showing the specificity of LAMP primers. LAMP primer specificity was determined by using each target individually to generate the bioaerosol, which was then collected by the airborne bacteria capture chip, washed and injected into the LAMP chip and amplified with all five sets of primers that were pre-deposited in the five reaction chambers. Microchamber 1,2,3,4 and 5 were pre-deposited with LAMP primers targeting S. aureus, E. coli, P. aeruginosa, C. koseri and K. pneumonia, respectively. Along the clockwise direction, the analyzed single targets were S. aureus, E. coli, P. aeruginosa, C. koseri and K. pneumonia, respectively. (F)-(H) Tests with a variety of target combinations. (F) E. coli plus C. koseri; (G) P. aeruginosa plus C. koseri and K. pneumonia; and (H) and all five targets. The obtained LAMP fluorescence was bright enough to read by the naked eyes and meet the need for rapid and low-cost diagnostic of airborne bacteria. Compared to the previously reported LAMP chip with deepened channels for enhancing the LAMP signal,5, 16, 17 which involves complex construction techniques, the low-cost metal
hemisphere used in the present study could still facilitate the fabrication of LAMP reaction chambers. Cross-contamination was mainly caused by the different sets of mixed primers because the solution within the channels would start to flow when heated at 63oC. Here, a mineral oil plug was injected into the inlet 4
ACS Paragon Plus Environment
Page 5 of 7
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
(central hole) to reduce the cross-talk among the solutions within the five LAMP channels. No non-specific signal was detected in our assay. Another drawback for the on-chip LAMP is the generation of air bubbles when the solution in the LAMP channels is heated to high temperature (63oC). In this study, the design of the hemisphere structure used for the reaction chambers could reduce the generation of air bubbles compared to the square chamber,22 because the four-perpendicular structure within a square chamber often leads to the generation of air bubbles. However, only a little air bubble was generated at the edge of the hemisphere chambers (Figure 3 e, h), which had little effect on the detection of LAMP result.
Figure 4. Comparison of S. aureus cells collected by the plate sedimentation method with those collected by the airborne bacteria capture and enrichment chip.
Sensitivity of the Device. The sensitivity of the chip was validated by S. aureus bioaerosols containing the bacteria ranging from 1.7×104 to 1.7×102 CFU/mL. After the capture and enrichment step, the number of cells was counted by the dilution-plate counting method and compared with the number that was obtained by plate sedimentation method (Figure 4). The numbers of S. aureus cells collected at a cell concentrations of 1.7×104, 1.7×103 and 1.7×102 CFU/mL were 280, 122 and 14, respectively, which were approximately 5 times more than those collected by the plate sedimentation method.
Visible LAMP fluorescence was obtained when the average number of S. aureus cells captured by the airborne bacteria capture chip was 280 or 122. Since the suspension of lysed bacteria was loaded into the five LAMP chambers in parallel, approximately 56 or 24 cells (20% of the total quantity) were loaded into a single chamber. Further reduction of the captured bacteria to 14 cells (about 2 cells were loaded into a single LAMP chamber) did not yield any detectable signal (Figure 5). Therefore, the detection limits of the system and the LAMP chip were about 122 and 24 CFU, respectively, for S. aureus.
Figure 5. LAMP analysis of the sensitivity of the airborne capture and enrichment chip using diluted S.aureus. LAMP fluorescence signal obtained with about 56 cells. (A) 24 cells; (B) or 2 cells; (C) in the LAMP reaction chamber. the cell to perform the analysis. To our knowledge, this is the first report of on-chip airborne bacteria capture and high-throughput LAMP identification. The combination of LAMP and airborne bacteria capture chip would enable rapid diagnostics of airborne pathogens to be carried out at minimal cost, as well as providing a new and reliable technique for the prewarning of airborne diseases.
CONCLUSION In this study, a high-throughput airborne bacteria capture and LAMP analysis system was presented. Five frequently encountered bacterial species were used to validate the system. The whole analysis took about 1.5 h from loading the bioaerosol to LAMP amplification. The detection limit of the system was approximately 24 cells per reaction using S. aureus as a representative bacterium. This method did not require the purification of DNA from
AUTHOR INFORMATION 5
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 7
(13) Rane, T. D.; Chen, L.; Zec, H. C.; Wang, T. H. Microfluidic continuous flow digital loop-mediated isothermal amplification (LAMP). Lab Chip 2015, 15, 776782.
Corresponding Author *E-mail:
[email protected]. Tel: +86-21-55664504. ACKNOWLEDGMENT
(14) Guo, Z.; Yu, T.; He, J.; Liu, F.; Hao, H.; Zhao, Y.; Wen, J.; Wang, Q. An integrated microfluidic chip for the detection of bacteria - A proof of concept. Mol Cell Probe 2015, 29, 223-227.
This work was funded by NFSC under Grant 81501833, the Fundamental Research Funds for Shanghai Key Laboratory of Atmospheric Particle Pollution Prevention (FDLAP15003) and the Natural Science Foundation of Liaoning Province (2015020574).
(15) Jung, J. H.; Park, B. H.; Oh, S. J.; Choi, G.; Seo, T.S. Integration of reverse transcriptase loop-mediated isothermal amplification with an immunochromatographic strip on a centrifugal microdevice for influenza A virus identification. Lab Chip 2015, 15, 718-725.
REFERENCES (1) Jing, W. W.; Zhao, W.; Liu, S. X.; Li, L.; Tsai, C. T.; Fan, X. Y.; Wu, W. J.; Li, J. X.; Yang, X.; Sui, G. D. Microfluidic Device for Efficient Airborne Bacteria Capture and Enrichment. Anal. Chem. 2013, 85, 5255-5262.
(16) Fang, X. E.; Chen, H.; Yu, S. N.; Jiang, X. Y.; Kong, J. L. Predicting Viruses Accurately by a Multiplex Microfluidic Loop-Mediated Isothermal Amplification Chip. Anal. Chem. 2011, 83, 690-695.
(2) Sui, G. D.; Cheng, X. J. Microfluidics for detection of airborne pathogens: what challenges remain? Bioanalysis 2014, 6(1), 5-7.
(17) Fang, X. E.; Chen, H.; Xu, L. J.; Jiang, X. Y.; Wu, W. J.; Kong, J. L. A portable and integrated nucleic acid amplification microfluidic chip for identifying bacteria. Lab chip 2012, 12, 1495-1499.
(3) Thorsen, T.; Maerkl, S. J.; Quake, S. R. Microfluidic large-scale integration. Science 2002, 298(5933), 580-584. (4) Wu, F.; Dekker, C. Nanofabricated structures and microfluidic devices for bacteria: from techniques to biology. Chem. Soc. Rev. 2016, 45(2), 268-280.
(18) Chen, C. S.; Breslauer, D. N.; Luna, J. I.; Grimes, A.; Chin, W. H.; Lee, L. P.; Khine, M. Shrinky-Dink microfluidics: 3D polystyrene chips. Lab chip 2008, 8, 622-624.
(5) Yuan, H.; Liu, Y. C.; Jiang, X. R.; Xu, S. C.; Sui, G. D. Microfluidic chip for rapid analysis of cerebrospinal fluid infected with Staphylococcus aureus. Anal. Methods 2014, 6, 2015-2019.
(19) Whitesides, G. M.; Ostuni, E.; Takayama, S.; Jianq, X.; Inqber, D. E. Soft lithography in biology and biochemistry. Annu. Rev. Biomed. Eng. 2001, 3, 335-373.
(6) Jing, W. W.; Jiang, X. R.; Zhao, W.; Liu, S. X.; Cheng X. J.; Sui, G. D. Microfluidic Platform for Direct Capture and Analysis of Airborne Mycobacterium tuberculosis. Anal. Chem. 2014, 86, 5815-5821 .
(20) Zhang, S. H.; Xu, X. K.; Wu, Q, P.; Zhang, J. M. Rapid and sensitive detection of Pseudomonas aeruginosa in bottle water by loop-mediated isothermal amplification. Eur. Food. Res. Technol. 2013, 236, 209-215.
(7) Chen, Y. C.; Li, P.; Huang, P. H.; Xie, Y. L.; Mai, J. D.; Wang, L.; Nguyen, N. T.; Huang, T. J. Rare cell isolation and analysis in microfluidics. Lab Chip 2014, 14, 626-645.
(21) Jiang, X. R.; Shao, N.; Jing, W. W.; Tao, S. C.; Liu, S. X.; Sui, G. D. Microfluidic chip integrating high throughput continuous-flow PCR and DNA hybridization for bacteria analysis. Talanta 2014, 122, 246-250.
(8) Mao, X.; Huang, T. J. Microfluidic diagnostics for the developing world. Lab Chip 2012, 12(8), 1412-1416.
(22) Jiang, X. R.; Jing, W. W.; Zheng, L. L.; Liu, S. X.; Wu, W. J.; Sui, G. D. A Continuous-flow high-throughput microfluidic device for airborne bacteria PCR detection. Lab Chip 2014, 14, 671-676.
(9) Chen, Y.; S, L.; Gu, Y.; Li, P.; Ding, X.; Wang, L.; McCoy, J. P.; Levine, S, J.; Huang, T. J. Continuous enrichment of low-abundance cell samples using standing surface acoustic waves (SSAW). Lab Chip 2014, 14(5), 924930. (10) Dai, J.; Yoon, S. H.; Sim, H. Y.; Yang, Y. S.; Oh, T. K.; Kim, J. F.; Hong, J. W. Charting microbial phenotypes in multiplex nanoliter batch bioreactors. Anal. Chem. 2013, 85(12), 5892-5899. (11) Mairhofer, J.; Roppert K.; Ertl, P. Microfluidic Systems for Pathogen Sensing: A Review. Sensors 2009, 9(6), 4804-4823. (12) Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loopmediated isothermal amplification of DNA. Nucleic Acids Res 2000, 28, E63. 6
ACS Paragon Plus Environment
Page 7 of 7
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
TOC graphic (for TOC only)
7
ACS Paragon Plus Environment
