Technical Note
Highly Sensitive Telomerase Assay Insusceptible to Telomerase and PCR Inhibitors for Cervical Cancer Screening Using Scraped Cells Hidenobu Yaku, Yoshio Yoshida, Hidehiko Okazawa, Yasushi Kiyono, Yuko Fujita, and Daisuke Miyoshi Anal. Chem., Just Accepted Manuscript • Publication Date (Web): 30 May 2017 Downloaded from http://pubs.acs.org on May 30, 2017
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Highly Sensitive Telomerase Assay Insusceptible to Telomerase and PCR Inhibitors for Cervical Cancer Screening Using Scraped Cells Hidenobu Yaku,*,† Yoshio Yoshida,‡ Hidehiko Okazawa,§ Yasushi Kiyono,§ Yuko Fujita,‡ and Daisuke Miyoshi‖ †
Advanced Research Division, Panasonic Corporation, 1006 Kadoma, Kadoma City, Osaka 571-8501, Japan. Department of Obstetrics and Gynecology, Faculty of Medical Sciences, University of Fukui, 23-3 Matsuokashimoaizuki, Eiheiji-cho, Yoshida-gun, Fukui 910-1193, Japan. § Biomedical Imaging Research Center, University of Fukui, 23-3 Matsuokashimoaizuki, Eiheiji-cho, Yoshida-gun, Fukui, 910-1193, Japan. ‖ FIRST (Faculty of Frontiers of Innovative Research in Science and Technology), Konan University, 7-1-20 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan. ‡
ABSTRACT: A sensitive telomerase assay based on asymmetric polymerase chain reaction (A-PCR) on magnetic beads and subsequent application of cycling probe technology, STAMC, which is insusceptible to DNase and PCR inhibitors, was for the first time applied to clinical specimens in addition to a conventional telomeric repetitive amplification protocol (TRAP). The electrophoresis results showed that an increase in scraped cervical cancer cells not only reduced TRAP products but also increased smaller products, suggesting the unreliability of TRAP for clinical samples. To achieve the required sensitivity of STAMC for clinical application, the sequence and concentration conditions were explored for the forward and reverse primers for A-PCR, which resulted in a detection limit of only two HeLa cells with 1 μM TS primer (5’-AATCCGTCGAGCAGAGTT-3’) and 0.04 μM ACX primer (5’-GCGCGGCTTACCCTTACCCTTACCCTAACC-3’). Under the same primer conditions, the fluorescence signal of STAMC increased as scraped cervical cancer cells increased despite showing a negligible intensity for benign tumors. Furthermore, STAMC showed no signal for a cervical cancer patient treated with irradiation therapy. These results indicate that STAMC is useful for not only cervical cancer screening but also investigating the effect of cancer treatments such as radiation therapy and drug administration.
The Papanicolaou (Pap) smear test is a gold standard for cervical cancer screening. However, many women worldwide cannot get the screening due to lack of cytotechnologists and pathologists.1-3 In addition, inadequately trained technicians cause the false-negative problems because the test sometimes provides ambiguous cell images.1-3 Thus, a technology giving unambiguous results which can be easily judged by anyone is required. Previous studies have shown that persistently infection of human papillomavirus (HPV) to humans causes cervical cancers by activating the gene expression of human telomerase transcriptase (hTERT), a catalytic subunit for telomerase.4,5 The over-expressed hTERT allows immortal cell proliferation by catalyzing an extension of telomere DNA comprising a repetitive guanine-rich (G-rich) sequence, 5’(TTAGGG)n-3’.6-9 Most normal somatic cells, on the other hand, lack a detectable telomerase activity.10-12 Therefore, a quantitative telomerase assay without false-negative results would be a great contribution to cervical cancer screening. The telomeric repeat amplification protocol (TRAP) is a commonly used assay for telomerase activity.6 In the assay, after a telomerase reaction using a telomerase substrate (TS) primer and biological samples such as cell lysates including telomerase, the reaction products are amplified by polymerase
chain reaction (PCR). Although the PCR amplification allows a relatively high sensitive detection of telomerase activity, TRAP has a severe problem in that some polymerase inhibitors in clinical samples inhibit PCR, which leads to a false negative result.13,14 To solve this problem, some research groups have proposed various assays without any enzymatic signal amplification processes, but many of those assays are less sensitive than TRAP assay or take a long time to detect telomerase activity.15-25 Other groups have developed telomerase assays using enzymatic signal amplification processes other than PCR.26-32 Although some of the assays allowed a higher sensitivity than TRAP, those assays also have a risk of a false negative diagnosis due to inhibition of the enzymatic signal amplifications by components in clinical samples. In fact, an exponential isothermal amplification of the telomere repeat assay (EXPIATR), which is a telomerase assay based on an isothermal amplification of telomerase reaction products by a strand-displacement polymerase and a nuclease, allowed the detection of a single HeLa cell if there were no impurities in the clinical samples.29 However, lysates from 1000 and 4000 normal cells reduced the amplification efficiency, resulting in the signals of telomerase activity to be 20% and less than 5%, respectively.33 As shown in these cases, there have been only a few reports to demonstrate that such novel te-
ACS Paragon Plus Environment
Analytical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
lomerase assays are practical and superior to TRAP for cancer diagnosis using crude clinical samples.34 For the clinical application of telomerase as a cancer marker, we attempted to develop another sensitive telomerase assay, which is based on asymmetric PCR (A-PCR) on magnetic beads (MBs) and subsequent fluorescent detection by cycling probe technology (CPT), STAMC.14,35,36 In STAMC, the telomerase reaction products were immobilized on MBs and washed to remove all contaminants before A-PCR. Importantly, we further demonstrated that decoy DNA strands competitively prevented the DNase in cell lysates from degrading the telomerase reaction products. Those strategies allowed STAMC to be insusceptible to PCR inhibitors or abundant normal cell lysates. Herein, we report an application of STAMC for telomerase activity in cervical cancer cells scraped with a cotton swab. The fluorescence signal of STAMC increased as a function of the amount of cervical cancer cell lysates corresponding to 0 to 10 μg of total protein. On the contrary, the electrophoresis results showed that the cell lysates including a large amount of total protein drastically diminished the signals of TRAP. Furthermore, STAMC showed no signal for patients with fibroids or a cervical cancer patient treated with irradiation therapy. These results demonstrated that the STAMC is useful for not only the distinction between malignant and benign tumors but also the follow-up after cancer treatment using crude clinical samples. EXPERIMENTAL SECTION Materials and Reagents. All oligonucleotides were highperformance liquid chromatography (HPLC) purificationgrade and were purchased from Tsukuba Oligo Service Co., Ltd., (Tsukuba, Japan) or were provided in a TRAPEZE telomerase detection kit from EMD Millipore Corporation (Billerica, MA, USA). λ DNA was purchased from Takara Bio Inc. (Kusatsu, Japan). HeLa cells were provided in a TRAPEZE telomerase detection kit. RNase H and TaKaRa LA Taq HS (polymerase) was purchased from Takara Bio Inc. Streptavidin-coated MBs were Dynabeads M-280 purchased from Life Technologies Corporation (Carlsbad, CA, USA). Detection Principle of STAMC. The principle of STAMC was described in detail in our previous report. 14 As shown in Fig. S1, telomerase elongates the telomere DNA sequence from a 5’-biotinylated TS primer (Table 1) in the presence of decoy DNA such as λ DNA. Decoy DNA prevents DNase in samples from degrading the elongation products by serving as a competitive substrate for DNase. Then, the elongation products are immobilized on MBs via a biotin-streptavidin reaction and washed to remove PCR inhibitors. After the wash, the single-stranded G-rich sequences of the elongation products are preferentially amplified by A-PCR using the higher concentration forward primer (TS primer) and the lower concentration reverse primer. Finally, the amplified G-rich sequences are detected by CPT using a complementary probe RNA modified with a fluorophore (FITC) and a quencher (Dabcyl) at the 5' and 3' ends, respectively (Table 1), and RNase H. In CPT, a fluorescence is catalytically enhanced depending on a specific hydrolysis of the probe RNA hybridized with the G-rich sequence by RNase H. Telomerase Reaction for STAMC. Each telomerase reaction solution (10 μL) contained 1×TRAP buffer (TRAPEZE telomerase detection kit), 1×dNTPs (TRAPEZE telomerase detection kit), 1 μM biotinylated TS primer, cell lysates, and
Page 2 of 6
Table 1. DNA and RNA oligonucleotides used in this study or our previous study.14 Name
Sequence
Modification
TS primer
5’-AATCCGTCGAGCAGA 5’-biotinylation for GTT-3’ telomerase reaction
CX-ext
5’-GTGCCCTTACCCTTA CCCTTACCCTAA-3’
none
ACX
5’-GCGCGGCTTACCCTT ACCCTTACCCTAACC-3’
none
Probe RNA 5’-CCCUAACCC-3’
5’-FITC/3’-Dabcyl
Underlined nucleotides in CX-ext and ACX are unpaired with telomeric G-rich sequence.
8.32 μg/mL λ DNA. Each mixture was incubated at 37°C for 60 min, heated at 95°C for 10 min, and cooled at 4°C. Immobilization of Telomerase Reaction Products on MBs for STAMC. A vortex was used to mix 10 μL of the biotinylated telomerase reaction products and the prewashed MBs with 10 μL of a buffer containing 10 mM Tris-HCl (pH 7.5) and 2 M KCl at 25°C for 30 min. The treated MBs were then subjected to three sequential washes, each with 20 μL of a buffer containing 10 mM Tris-HCl (pH 7.5) and 1 M NaCl, and the last wash was done with 20 μL of distilled water. A-PCR Amplification for STAMC. A-PCR amplification of telomerase reaction products was carried out in a solution containing the MBs with telomerase reaction products, 1×LA PCR Buffer II (Mg2+ plus), 1 × dNTPs, 1 μM of any TS primer, one of several concentrations of ACX primer, and 0.05 U/μL TaKaRa LA Taq HS for 30 cycles with each cycle comprising denaturation at 95°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 30 s. After the amplification, the reaction mixture was cooled and stored at 4°C. CPT for Detection for STAMC. A-PCR products were detected by CPT. Each CPT reaction mixture (100 μL) contained 10 μL A-PCR reaction mixture, 100 nM probe RNA, 50 mM Tris-HCl (pH 8), and 4 mM MgCl2. Each mixture was incubated with 0.1 U/μL RNase H at 37°C for 20 min. Na2EDTA (50 mM) was added to terminate the reaction. A fluorescence spectral scanning reader set, such as Infinite M1000 Pro from TECAN Japan Co., Ltd. (Kawasaki, Japan) or SpectraMax M5 from Molecular Devices, LLC. (Sunnyvale, CA, USA) with excitation at 482 nm, was used to measure the fluorescence intensity of each solution at 500–550 nm and 25°C. RESULTS AND DISCUSSION Sensitivity Improvement. Although the STAMC has an advantage in its insusceptibility to DNase and PCR inhibitors, the detection limit of HeLa cell, calculated to be 50 cells,14 is not sufficient for a clinical application. Thus, we attempted to improve the sensitivity of STAMC by focusing on the following two points. First, the effect of the reverse primer sequence of A-PCR on the sensitivity was examined because it was reported that the sequence and the concentration have an impact on the background signal of TRAP.13,37 In our previous report, TS primer and CX-ext primer (Table 1) were used as forward and reverse primers, respectively, for A-CR. This is because CX-ext primer contains mismatches and three additional noncomplementary nucleotides at its 5' end adjacent to the G-rich template in order to reduce the PCR-associated artifacts in
ACS Paragon Plus Environment
Page 3 of 6
Analytical Chemistry (A)
(B)
(C) 1400
HeLa cells 0 cells
800
2 cells
700
20 cells
600
200 cells
500
2000 cells
400 300 200 100
1.2
Normalized fluorescence intensity at 520 nm
900
Differential fluorescence intensity
1000
Fluorescence Intensity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACX primer
1200
0.1uM
1000
0.08uM 0.06uM
800
0.04uM 0.02uM
600 400 200 0
0
500
550
600
Wavelength (nm)
650
1.0
0.6
550
600
Wavelength (nm)
650
0.1
0.4 0.2
-0.1
0
10
20
0.0
-0.2 500
0.3
0.8
0
500
1000
1500
2000
2500
Number of cells
Figure 1. (A) Fluorescence spectra for 0 to 2000 HeLa cells using 1 μM TS primer and 0.1 μM ACX primer for A-PCR; (B) Differential fluorescence spectra for 2000 HeLa cells using 1 μM TS primer and 0.02 μM to 0.1 μM ACX primer for A-PCR; (C) Plots of normalized fluorescence intensity at 520 nm versus number of cell for HeLa cells (red diamond) or NHDF cells (blue diamond) using 1 μM TS primer and 0.04 μM ACX primer for A-PCR. Each data point is the average calculated from more than three replicate data sets and each error bar represents the standard deviation.
TRAP.14,37 Kim and Wu reported that ACX primer (Table 1), which contains mismatches and six additional noncomplementary nucleotides at its 5' end adjacent to the G-rich template, more effectively inhibited primer dimer artifacts with TS primer, compared with CX-ext primer.13 From these previous results, herein the ACX primer was used as the reverse primer, which may have increased the sensitivity by reducing the background signal. The telomerase activity of 0 to 2000 HeLa cells was analyzed using 1 μM TS primer and 0.1 μM ACX primer for A-PCR. A fluorescence spectrum with a larger peak around 520 nm was observed with 2000 HeLa cells than the background spectrum in the absence of HeLa cells (Fig. 1A). Although the peak intensity decreased as the number of HeLa cells decreased (Fig. 1A), 20 HeLa cells clearly gave a higher fluorescence intensity than background despite the detection limit of 50 HeLa cells in our previous report.14 Second, the effect of the concentration of ACX primer on the sensitivity was examined in the absence or presence of 2000 HeLa cells. A decrease in the concentration of ACX primer from 0.1 μM to 0.04 μM increased the differential fluorescence (Fig. 1B). This is at least partly because lower concentrations of ACX primer tended to reduce the background signal caused by the PCR artifacts and more preferentially amplified the G-rich sequences than did the highly concentrated ACX primer (Fig. S2). In addition, the intensity of the differential fluorescence with 0.02 μM ACX was lower than that with 0.04 μM ACX due to a low A-PCR amplification ratio (Figs. 1B and S2). Thus, the telomerase activities of 0 to 2000 HeLa cells were examined using 1 μM TS primer and 0.04 μM ACX primer. The fluorescence at 520 nm increased as a function of the number of HeLa cells, although normal human dermal fibroblast (NHDF) cells did not cause the fluorescence signal (Fig. 1C). Furthermore, the difference between the fluorescence intensities in the absence and presence of two HeLa cells achieved statistical significance by t-test. This result indicates that STAMC allows the highly sensitive detection of telomerase activity with a detection limit of two HeLa cells. In addition, as described above, STAMC could completely avoid false negative results by DNase and PCR inhibitors, which leads to its insusceptibility to coexisting normal cell lysates.14 These two properties, high sensitivity for cancer cells and insusceptibility to coexisting normal cells, are essential for the
clinical application because a few cancer cells in collected cell samples containing a lot of cells without telomerase activity should be occasionally detected. In particular, scraped cells for cytology usually contain many cells such as normal cells, neutrophils, lymphocytes, and necrotic cells because it is difficult to collect cancer lesions locally with a brush or cotton swab, and scraping is accompanied by bleeding. Thus, telomerase assays that are susceptible to DNase and PCR inhibitors cannot allow an accurate cancer diagnosis with scraped cells. From this point of view, STAMC should be promising for the application. Telomerase Detection of Scraped Cervical Cells. In order to assess the clinical application of STAMC as well as TRAP, cervical cells were scraped from cervical cancer patients with cotton swabs, and the lysate samples containing 210 μg of total protein were prepared in CHAPS lysis buffer (See experimental procedure in Supporting Information). TRAP with the cell lysates containing 2 μg of total protein electrophoretically showed a ladder of TRAP products, although no ladder bands were observed in the absence of the cell lysate (Fig. 2A, See experimental procedure in Supporting Information). These results indicate that the telomerase activity in cell lysates was detected by TRAP. It should be noted that the cell lysates with a large amount of total protein, however, reduced the TRAP products. This is inconsistent with the hypothesis that the cell lysate should contain a lot of telomerase compared to the lysates with a small amount of total protein. Notably, the internal control corresponding to a PCR product, which was not involved in the telomerase reaction, was also reduced as the amount of total protein increased. Thus, it is reasonable to consider that PCR inhibitors in the lysates of various cells inhibited the PCR amplification, as discussed in previous reports.13,14 These results demonstrated that TRAP for clinical samples including not only cancer cells but also normal cells has a risk of a false negative result due at least to PCR inhibitors unless the amount of total protein is strictly prepared to be small. In addition, it was found that DNA fragments (indicated by an asterisk in Fig. 2A), which were shorter than the TRAP products, increased as a function of the amount of total protein although the TRAP products and the internal control decreased. To the best of our knowledge, there have been no reports regarding such short DNA fragments. Thus, we analyzed the sequence of the main band, denoted by a double asterisk in Fig.
ACS Paragon Plus Environment
Analytical Chemistry (A)
(B)
(C)
Total protein (μg) 4
6
8
10
1.2
＊＊
＊ Internal control
1.2
1 0.8 0.6 0.4 0.2 0 -0.2 -0.4
0
5
10
Total protein (μg)
Normalized fluorescence intensity at 520 nm
2
Normalized fluorescence intensity at 520 nm
NC
TRAP assay products
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 6
1 0.8
0.6 0.4 0.2
0 -0.2
CC-1
CC-2
CC-3
UF-1
UF-2
-0.4
Figure 2. (A) Electrophoresis results of TRAP for a cervical cancer patient; (B) Plots of normalized fluorescence intensity at 520 nm versus amount of total protein in cervical cell lysates scraped from a cervical cancer patient (CC-1; red diamond), a cervical cancer patient without RNase H in CPT (gray diamond), a patient with fibroids (UF-1; blue diamond), and a cervical cancer patient treated with irradiation therapy (green diamond); (C) Comparison of normalized fluorescence intensity for cervical cell lysates containing 2 μg of total protein. Each data point is the average calculated from more than three replicate data sets and each error bar represents the standard deviation.
2A, by a fluorescence-based capillary electrophoresis method. The sequence was 5’AATCCGTCGAGCAGAGTTAGGGTAAGGGTAAGGGTA AGCCGCGC-3’, in which the sequences underlined by single and double lines are the sequence of the TS primer and the complementary sequence of 26 bases from the 5’ end of the ACX primer, respectively. Because the short fragment was not observed without cell lysates, the fragment is not artifacts such as a primer dimer. Previous study demonstrated that DNase in a large amount of HeLa cell lysates degraded the telomerase reaction products, which resulted in a reduction of the TRAP products.14 Thus, it is reasonable to assume that the short fragments are PCR products of telomerase reaction products that are degraded by DNase in the cervical cell lysates. In this hypothesis, the telomerase reaction products are shortened by DNase in the presence of a large amount of total protein, which results in the generation of a variety of products composed of TS primer with a 5’-AG-3’ and less than four telomeric repeats of 5’-GGTTAGG-3’ (Figs. S3A and S3B). The shortened product can hybridize with ACX primer to form a dsDNA region of 5’-AGTTAGGGTTAGGGTTAGGGTTAG3’/5’-CTTACCCTTACCCTTACCCTAACC-3’ with the underlined single-base mismatches in the first annealing process of PCR (Fig. S3C). The polymerase extension reaction can proceed with the ACX primer (Fig. S3D). The extended product of the ACX primer binds to the TS primer with one singlebase mismatch, and the polymerase extension reaction occurs from the TS primer to generate 44-bp dsDNA (Figs. S3E and S3F). The generated dsDNA should correspond to the sequenced fragment. In order to confirm the hypothesis, TRAP was performed to detect the telomerase activity in HeLa cells in reaction solutions with DNase I added. Although a normal ladder of TRAP products was observed without DNase I, an approximately 44-bp product increased as a function of DNase I (See the band denoted by an asterisk in Fig. S4). This result supports the hypothesis as shown in Fig. S3. Therefore, it is important to mention that TRAP with crude clinical samples may have the risk of a false negative result by not only PCR inhibitors but also DNase in the samples. Next, we examined STAMC for the cervical cells scraped from a cervical cancer patient (CC-1). STAMC showed a significantly larger fluorescence signal at 520 nm with the cervi-
cal cancer cell lysates containing 1 μg of total protein compared to the negative control corresponding to no cell lysate (Fig. 2B). However, it is possible to consider that the large fluorescence signal was caused by direct hydrolysis of the probe RNA by RNases in the cell lysates. In order to eliminate this possibility, STAMC without RNase H in CPT was performed with the cell lysates containing 1 to 10 μg of total protein. The removal of RNase H completely diminished the fluorescence signals even with 10 μg of total protein (Fig. 2B). This result indicates that the fluorescence signal with the cervical cancer cell lysates in the presence of RNase H depends on telomerase activity, based on the principle (Fig. S1). Thus, the high sensitivity of STAMC leads to a significant signal change even with only 1 μg of total protein. More importantly, in contrast to TRAP, the fluorescence intensity increases as a function of the amount of total protein. This result demonstrates that STAMC allows specific detection of telomerase activity in cancer cells in the presence of various kinds of cells without telomerase activity, which is in agreement with the results for the detection of telomerase activity in HeLa cells (Fig. 1). In contrast, the cervical cell lysates scraped from a patient with uterine fibroids (UF-1) caused no signals with 1 to 10 μg of total protein. This result is in agreement with the previous reports showing that telomerase activity in benign tumors was not detected or was much lower than the activity in malignant tumors.38-40 To further study sensitivity and selectivity, STAMC was performed with cell lysates containing 2 μg of total protein from another patient with uterine fibroids (UF2) and two other cervical cancer patients (CC-2 and CC-3). Both of the cancer samples increased fluorescence but not the fibroid cell sample (Fig. 2C). Additionally, we confirmed that the results from STAMC agree with cytology results (Table S1). Therefore, STAMC is promising for cervical cancer screening using crude clinical samples although more extensive studies with many kinds of samples such as precancerous cell lysates should be required. We further explored the possibility of STAMC to follow-up after cancer treatment by detecting telomerase activity. The fluorescence intensity for a cervical cancer patient treated with irradiation therapy was identical to the intensity for uterine fibroids (Fig. 2B). These results indicate that STAMC is also useful for follow-up after cancer treatment.
ACS Paragon Plus Environment
Page 5 of 6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
CONCLUSIONS In TRAP, both the TRAP products and the internal control product were reduced and shorter DNA fragments increased as a function of the amount of total protein in cell lysates due to PCR inhibitors and DNase, respectively. To avoid the false negative results in TRAP, the number of collected cells should be small. This restriction makes the diagnosis for precancerous patients difficult because the telomerase activity in a precancerous lesion tends to be low.41 In contrast, STAMC was not inhibited even with a large amount of the total protein due to insusceptibility to PCR inhibitors and DNase. In addition, we achieved a high sensitivity of STAMC with a detection limit of two HeLa cells. These results imply that even if the telomerase activity in a single cell is low, the activity can be detected by collecting a large number of cells. Thus, STAMC should have a very low risk for false negative results. In addition, STAMC may quantitatively distinguish between cancer and precancerous cells due to higher telomerase activity in cancer cells than in precancerous cells41 although more clinical trials should be required for the proof. Furthermore, micro total analysis system (μ-TAS) technologies performing fast PCR42 and using MBs43 can allow STAMC to be performed automatically and rapidly. Consequently, STAMC can be carried out not only for cervical cancer screening targeting women that cannot get Pap test but also for verification of the results from Pap test. It is indisputable that, in addition to cervical cancer diagnosis, STAMC can be applied to various cancer diagnoses because the telomerase activity in most cancer cells is highly activated.6 Thus, STAMC may become a versatile cancer diagnosis technique in the future.
ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Experimental procedures for preparation of cell lysates, TRAP, and cytological and histopathological diagnosis; detection principle of STAMC; fluorescence spectra of STAMC for HeLa cells using various concentrations of ACX primer; hypothesis for generation of short DNA fragment in TRAP; electrophoresis results of TRAP with DNase I; Comparison of results from STAMC, cytological and histopathological diagnosis (PDF)
AUTHOR INFORMATION Corresponding Author * E-mail:
[email protected]. Tel.: +81-6-69009312.
Notes The authors declare no competing financial interest.
Author Contributions The manuscript was written through contributions of all authors.
ACKNOWLEDGMENT This work was supported in part by Grants-in-Aid for Scientific Research (KAKENHI 15H03840, 16K14042) from MEXT, Japan.
REFERENCES (1) Stoler, M. H., Mod. Pathol., 2000, 13, 275-284. (2) Sherris, J.; Herdman, C.; Elias, C. West. J. Med., 2001, 175, 231-233. (3) Hoppenot, C.; Stampler, K.; Dunton, C. Obstet. Gynecol. Surv., 2012,
67, 658-667. (4) Howie, H. L.; Katzenellenbogen, R. A.; Galloway, D. A. Virology 2009, 384, 324-334. (5) Liu, X.; Roberts, J.; Dakic, A.; Zhang, Y.; Schlegel, R. Virology 2008, 375, 611-623. (6) Kim, N. W.; Piatyszek, M. A.; Prowse, K. R.; Harley, C. B.; West, M. D.; Ho, P. L. C.; Coviello, G. M.; Wright, W. E.; Weinrich, S. L.; Shay, J. W. Science 1994, 266, 2011-2015. (7) Meyerson, M.; Counter, C. M.; Eaton, E. N.; Ellisen, L. W.; Steiner, P.; Caddle, S. D.; Ziaugra, L.; Beijersbergen, R. L.; Davidoff, M. J.; Liu, Q. Y.; Bacchetti, S.; Haber, D. A.; Weinberg, R. A. Cell 1997, 90, 785-795. (8) Shay, J. W.; Bacchetti, S. Eur. J. Cancer 1997, 33, 787-791. (9) Bryan, T. M.; Cech, T. R. Curr. Opin. Cell Biol. 1999, 11, 318-324. (10) Wright, W. E.; Piatyszek, M. A.; Rainey, W. E.; Byrd, W.; Shay, J. W. Dev. Genet. 1996, 18, 173-179. (11) Avilion, A. A.; Piatyszek, M. A.; Gupta, J.; Shay, J. W.; Bacchetti, S.; Greider, C. W. Cancer Res. 1996, 56, 645-650. (12) Masutomi, K.; Yu, E. Y.; Khurts, S.; Ben-Porath, I.; Currier, J. L.; Metz, G. B.; Brooks, M. W.; Kaneko, S.; Murakami, S.; DeCaprio, J. A.; Weinberg, R. A.; Stewart, S. A.; Hahn, W. C. Cell 2003, 114, 241-253. (13) Kim, N. W.; Wu, F. Nucleic Acids Res. 1997, 25, 2595-2597. (14) Yaku, H.; Murashima, T.; Miyoshi, D.; Sugimoto, N. Molecules 2013, 18, 11751-11767. (15) Sato, S.; Kondo, H.; Nojima, T.; Takenaka, S. Anal. Chem. 2005, 77, 7304-7309. (16) Sharon, E.; Freeman, R.; Riskin, M.; Gil, N.; Tzfati, Y.; Willner, I. Anal. Chem. 2010, 82, 8390-8397. (17) Zhang, Z.; Sharon, E.; Freeman, R.; Liu, X.; Willner, I. Anal. Chem. 2012, 84, 4789-4797. (18) Wu, L.; Wang, J.; Feng, L.; Ren, J.; Wei, W.; Qu, X. Adv. Mater. 2012, 24, 2447-2452. (19) Wang, J.; Wu, L.; Ren, J.; Qu, X. Small 2012, 8, 259-264. (20) Quach, Q. H.; Jung, J.; Kim, H.; Chung, B. H. Chem. Commun. 2013, 49, 6596-6598. (21) Zong, S.; Wang, Z.; Chen, H.; Cui, Y. Small 2013, 9, 4215-4220. (22) Kawamura, K.; Yaku, H.; Miyoshi, D.; Murashima, T. Org. Biomol. Chem. 2014, 12, 936-941. (23) Duan, R.; Wang, B.; Zhang, T.; Zhang, Z.; Xu, S.; Chen, Z.; Lou, X.; Xia, F. Anal. Chem. 2014, 86, 9781-9785. (24) Yi, Z.; Wang, H. B.; Chen, K.; Gao, Q.; Tang, H.; Yu, R. Q.; Chu, X. Biosens. Bioelectron. 2014, 53, 310-315. (25) Zong, S.; Wang, Z.; Chen, H.; Hu, G.; Liu, M.; Chen, P.; Cui, Y. Nanoscale 2014, 6, 1808-1816. (26) Wang, H. B.; Wu, S.; Chu, X.; Yu, R. Q. Chem. Commun. 2012, 48, 5916-5918. (27) Tian, T.; Peng, S.; Xiao, H.; Zhang, X. E.; Guo, S.; Wang, S. R.; Zhou, X.; Liu, S. M. Chem. Commun. 2013, 49, 2652-2654. (28) Wang, L. J.; Zhang, Y.; Zhang, C. Y. Anal. Chem. 2013, 85, 1150911517. (29) Tian, L.; Weizmann, Y. J. Am. Chem. Soc. 2013, 135, 1661-1664. (30) Zhang, Y.; Wang, L. J.; Zhang, C. Y. Chem. Commun. 2014, 50, 19091911. (31) Li, H.; Fu, H. W.; Zhao, T.; Kong, D. M. RSC Adv. 2015, 5, 64756480. (32) Liu, X.; Li, W.; Hou, T.; Dong, S.; Yu, G.; Li, F. Anal. Chem. 2015, 87, 4030-4036. (33) Tian, L.; Cronin, T. M.; Weizmann, Y. Chem. Sci. 2014, 5, 4153-4162. (34) Mori, K.; Sato, S.; Kodama, M.; Habu, M.; Takahashi, O.; Nishihara, T.; Tominaga, K.; Takenaka, S. Clin. Chem. 2013, 59, 289-295. (35) Williams, J. F. Biotechniques 1989, 7, 762-769. (36) Bekkaoui, F.; Poisson, I.; Crosby, W.; Cloney, L.; Duck, P. Biotechniques 1996, 20, 240-&. (37) Krupp, G.; Kuhne, K.; Tamm, S.; Klapper, W.; Heidorn, K.; Rott, A.; Parwaresch, R. Nucleic Acids Res. 1997, 25, 919-921. (38) Kyo, S.; Kanaya, T.; Ishikawa, H.; Ueno, H.; Inoue, M. Clin. Cancer Res. 1996, 2, 2023-2028. (39) Hiyama, E.; Kodama, T.; Shinbara, K.; Iwao, T.; Itoh, M.; Hiyama, K.; Shay, J. W.; Matsuura, Y.; Yokoyama, T. Cancer Res. 1997, 57, 326331. (40) Kyo, S.; Takamura, M.; Tanaka, M.; Kanaya, T.; Inoue, M. Int. J. Cancer 1998, 79, 66-70. (41) Kyo, S.; Takamura, M.; Ishikawa, H.; Sasagawa, T.; Satake, S.; Tateno, M.; Inoue, M. Cancer Res., 1997, 57, 1863-1867. (42) Afmad, F.; Hashsham, S. A. Anal. Chim. Acta, 2012, 733, 1-15. (43) Gijs, M. A. M. Microfluid. Nanofluid., 2004, 1, 22-40.
ACS Paragon Plus Environment
Analytical Chemistry
for TOC only DNase PCR inhibitors
Telomerase reaction Fluorescence intensity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 6
Asymmetric PCR Cervical cancer
Fibroid Total protein
Cycling probe technology
Insert Table of Contents artwork here
6 ACS Paragon Plus Environment
