Highly stable conjugates of carbon nanoparticles with DNA aptamers

of Microorganisms of the Ural Branch of the Russian Academy of Sciences” – ... Stability of CNP-aptamer conjugates was significantly enhanced by p...
0 downloads 0 Views 1MB Size
Download PDF
Subscriber access provided by UNIV OF CAMBRIDGE

Interface Components: Nanoparticles, Colloids, Emulsions, Surfactants, Proteins, Polymers

Highly stable conjugates of carbon nanoparticles with DNA aptamers Pavel Khramtsov, Maria Kropaneva, Tatyana Kalashnikova, Maria Bochkova, Valeria Timganova, Svetlana Zamorina, and Mikhail Rayev Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b01255 • Publication Date (Web): 08 Aug 2018 Downloaded from http://pubs.acs.org on August 9, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Highly stable conjugates of carbon nanoparticles with DNA aptamers Pavel Khramtsov*1,2, Maria Kropaneva1,2, Tatyana Kalashnikova1, Maria Bochkova2, Valeria Timganova2, Svetlana Zamorina1,2, Mikhail Rayev1,2 1

Department of Microbiology and Immunology, Biology Faculty, Perm State

National Research University, 614000, 15 Bukireva str., Perm, Russia 2

Laboratory of Ecological Immunology, “Institute of Ecology and Genetics

of Microorganisms of the Ural Branch of the Russian Academy of Sciences” – branch of PSRC UB RAS, 614081, 13 Goleva str., Perm, Russia *Corresponding author, e-mail [email protected], phone: + 7 342 280 77 94

Abstract: Conjugates of carbon nanoparticles and aptamers have great potential in many areas of biomedicine. In order to be implemented in practice such conjugates should keep their properties throughout long storage period in commonly available conditions. In this work, we prepared conjugates of carbon nanoparticles (CNP) with DNA aptamers using streptavidin-biotin reaction. Obtained conjugates possess superior stability and kept their physical-chemical and functional properties during 30 days at +4°C and –20°C. Proposed approach to conjugation allows loading of about 100-120 pM of biotinylated aptamer per 1 mg of streptavidin-coated CNP (CNP-Str). Aptamer-functionalized CNP-Str have zeta potential of –34 mV at pH 7, mean diameter of 168–177 nm and polydispersity index of 0.080–0.140. High reproducibility of functionalization was confirmed by preparation of several batches of CNP-aptamer with the same size distribution and aptamer loading using independently synthesized parent CNP-Str nanoparticles. Stability of CNP-aptamer conjugates was significantly enhanced by post-synthesis addition of EDTA that prevents nuclease degradation of immobilized aptamers. Obtained nanoparticles were stable at pH ranged from 6 to 10. Optical properties of CNP-aptamer nanoparticles were also studied and their ability to quench 1 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

fluorescence via Förster resonance energy transfer was shown. Taking into account properties of CNP-aptamer conjugates, we suppose they may be used in both homo- and heterogeneous colorimetric, fluorescent and aggregation-based assays.

Introduction Aptamers are short DNA and RNA molecules with the ability to specifically recognize various targets: molecules, cells and even ions1,2. Their sequencedependent secondary structure includes loops, double stranded regions, Gquadruplexes, etc. determining the 3D conformation of aptamer. Binding to the target is carried out through hydrogen, ionic, hydrophobic interactions, base stacking: quite similar to that of antibody and antigen3. Owing to their capability of specific recognition, aptamers have found a bunch of applications in the biomedicine. Development of aptamer-based therapeutics is a desirable goal that remains unattained for an only exception: Macugen, anti-VEGF aptamer for the treatment of the retina age-related macular degeneration3. To date several therapeutic aptamers for cancer, vascular disease, thrombosis and eye disorders treatment are at the different stages of clinical trials4. Enthusiasm of researchers towards aptamers relies on their outstanding properties: high affinity, low immunogenicity, diversity of chemical modification, chemical and thermal stability and so on3. Development of analytical devices using aptamers is another fruitful area. To the present day, diagnostic systems for the detection of toxins5, metal ions2, animal pathogens6, circulating tumor cells7, antibiotics8 and many others have been developed. Significant amount of aptamer-based therapeutics, sensors, sorbents take advantage of properties of nanomaterials to enhance their performance and capability. In this paper we will pay our attention to the optimization of synthesis and stability of conjugates of aptamers with amorphous carbon nanoparticles. Amorphous carbon nanoparticles (CNP) are widely used in different areas of biotechnology and medicine. They serve as color label in solid-phase immunoassays9 and among recent examples are test-systems for the detection of 2 ACS Paragon Plus Environment

Page 2 of 39

Page 3 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

histamine10, influenza A virus11, plant pathogen Xanthomonas arboricola pv. Pruni12, and extracellular vesicles13. The main advantages of CNP are high color intensity that provides high sensitivity of the assay, availability, chemical and physical stability9. Comparative studies showed that the application of CNP as a color label allowed to reach higher analytical sensitivity than that of gold14–16 or latex15 nanoparticles. It should be noted, though, that equal or less sensitivity of CNP vs. gold nanoparticles was demonstrated in some other papers10,13,17. Physisorption is the main route to obtain conjugates of CNP with affine compounds, mainly antibodies9, however covalent attachment to carboxyl groups induced by acid treatment or inert protein adsorbed on the surface of CNP is also possible. The latter approach was employed in the work18 to functionalize CNP with DNA oligonucleotide for hybridization-based assay. We did not find examples of colorimetric tests with CNP-aptamer conjugates. Another field of analytical application of amorphous carbon nanoparticles is the development of electrochemical sensors19. The main advantages of CNPs are low cost, high conductivity and large surface area20. According to21 there are two main ways to employ CNPs bioconjugates: modification of electrode surfaces and amplification of assay signal. Signal enhancement relies on the functionalization of CNPs with horseradish peroxidase or other redox proteins and their complexes with recognition-mediated molecules. Recently, carbon nanoparticle-based electrochemical aptasensors for cancer biomarkers were reviewed22. In these sensors, aptamers play a role of both recognition elements and signal enhancers. Aptamer-mediated signal increasing is achieved by DNAzyme activity (peroxidase-mimicking G-quadruplex/hemin complexes) or through involving aptamers in DNA isothermal amplification, i.e. hybridization chain reaction22,23. Various optical properties of carbon nanoparticles are employed in biomedicine. The ability of carbon blacks to quench fluorescence via Förster resonance energy transfer (FRET) is widely used in aptamer-based assay development24–27. Usually aptamer with fluorescent label (fluorochrome, quantum dot, etc.) is immobilized on the surface of nanoparticle through π–π staking with 3 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

following addition of target that induces binding and desorption of aptamer. Increasing of the distance between aptamer and CNP turns-off FRET-based quenching and fluorescent signal rises. Sometimes nuclease is added for signal amplification through the cleavage of target bonded aptamers that in turn initiates the interaction of released target with another aptamers adsorbed on the CNPs and so on28. Small-size CNP (carbon dots or C-dots) possesses photoluminescent properties29 with variety of possible applications that include biosensing, bioimaging, drug and gene delivery, photothermal therapy30. Conjugates of C-dots with aptamers are generally used in development of fluorescent assays. Some of them rely on FRET between C-dot and acceptor31, another are based on the separation C-dot–aptamer+target complexes from free C-dot–aptamer and the quantification of the latter32, 33. In most cases N-hydroxysuccinimide (NHS) and 1ethyl-3-(3-dimethyl-aminopropyl) carbodiimide hydro-chloride (EDC) chemistry is utilized to attach aptamers to C-dots surface. Despite a myriad of papers devoted to the applications of aptamer functionalized CNPs were published, there is still a lack of data on long-term stability, storage conditions and shelf life of these conjugates. Many researches demonstrate excellent performance and superior characteristics of their developments, however for practical application long-term stability to nucleases, aggregation, loss of function are essential. The goals of this study are: 1) optimization of synthesis of CNP-DNA aptamer conjugates, 2) investigation and improvement of their storage stability, 3) examination of their resistance to serum nucleases and pH alterations.

4 ACS Paragon Plus Environment

Page 4 of 39

Page 5 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Experimental Chemicals and materials Chromatography column (diameter=16 mm, h=300 mm) was from Amicon (USA), Sepharose CL-6B was from GE Healthcare (USA); white polystyrene plates were from Linbro (USA); human IgG, bovine serum albumin (BSA), casein, thimerosal, sucrose were from Sigma-Aldrich (USA); monoclonal human IgE lot. ab 65866 was from Abcam (UK), streptavidin was from ProspecBio (Israel), DNAse I was from Thermo Fisher Scientific (USA), sodium azide, glutaraldehyde were from AppliChem (Germany); sodium hydroxide, glycerol, sodium chloride, sodium hydrogen phosphate, sodium dihydrogen phosphate, magnesium chloride, potassium chloride, calcium chloride, Tween-20 were from Panreac (Spain), EDTA was from Bio-Rad (USA). The following single strand DNA were used (Table 1)

Table 1. DNA-oligonucleotides used in in this work Target IgE

IgE DNAzyme DNAzyme /thrombin DNAzyme /thrombin

Sequence and modifications 5’-BiotinGGGGCACGTTTATCCGTCCCTCCTAGTGGC GTGCCCC-FAM-3′ 5’GGGGCACGTTTATCCGTCCCTCCTAGTGGC GTGCCCC-FAM-3′ 5′-GGGTGGGAAAAGGGTGGGAAAAAAAABiotin-3′

Abbreviation

Manufacturer

Bi-D17.4-FAM

Syntol (Russia)

D17.4-FAM

Syntol (Russia)

Bi-A8L2A4

5′-GGTTGGTGTGGTTGG-FAM-3′

TBA15-FAM

5′- Biotin -GGTTGGTGTGGTTGG-FAM-3′

Bi-TBA15FAM

Syntol (Russia) Evrogen (Russia) Evrogen (Russia)

Ref. 34

34

35, 36 37 37

Oligonucleotide aliquots of 100 µM in PBS were prepared and stored at – 20°C. Before usage, oligonucleotides were thawed, heated at +90°C for 5 min and cooled to room temperature. Potassium chloride was added to solutions of both modified with biotin and unmodified TBA15 to the final concentration of 0.1 M prior heating. Further treatment for TBA15 was performed as for other aptamers. We used spectrophotometry and OligoCalc online application38 for DNA quantification. 5 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The following buffer solutions were used: phosphate buffer solution (PBS, 0.15 М NaCl, 0.015 М Na2HPO4, 0.015 M NaH2PO4, 0.1% NaN3, рН 7.25), PBST (PBS+0.1% Tween-20), PBST-MK (PBST+1mM MgCl2+3mM KCl). All solutions were prepared using deionized water. Concentrations of free and bound divalent ions in the presence of EDTA were estimated using Maxchelator (web.stanford.edu/~cpatton/webmaxcS.htm). Human blood serum samples were obtained from three healthy individuals. All procedures were performed in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Research was approved by the Institutional Review Board (IRB00010009). Written informed consent was obtained from all participants.

Functionalization of carbon nanoparticles with streptavidin Carbon black nanoparticles (CNP) were obtained from soot and conjugated to streptavidin according to the procedure described previously39. Briefly, CNP were coated with BSA then cross-linked with streptavidin via glutaraldehyde. Sizeexclusion chromatography was used to remove unbound proteins and glutaraldehyde. Glycerol and BSA were added to final concentrations of 20% and 1%, correspondingly.

Quantification of aptamers loading Amount of aptamer loaded on nanoparticles via biotin-streptavidin interaction was determined by fluorescence measurement. Carbon nanoparticles conjugated with streptavidin (CNP-Str) were added to the final concentration of 0.01% into the solutions of four-fold diluted aptamers Bi-D17.4-FAM and D17.4FAM. Final concentrations of aptamer were 400, 100, 25, 6.25 and 1.62 nM and final volume of mixtures was 500 µl. Samples were vortexed, incubated at +37°C for 60 min on a shaker and centrifuged at 20000g for 100 min. One hundred microliter samples from supernatant were added into the wells of black polystyrene plate. Aptamer solutions with known concentrations were also dispensed in the 6 ACS Paragon Plus Environment

Page 6 of 39

Page 7 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

plate to obtain calibration curves. Fluorescence (excitation wavelength 485 nm, emission wavelength 528 nm) was measured using BioTek Synergy H1 Microplate Reader (USA). Each experiment included three technical replicates. Mean fluorescence intensity value of calibration solutions and supernatant samples were used for quantification. Calibration curve equations were obtained by fitting to polynomial function of the lowest degree that gave coefficient of determination (R2) value more than 0.95. Three independent experiments were performed for each batch of synthesized CNP-Str conjugates. Binding of TBA15-FAM/BiTBA15-FAM to CNP-Str was assessed in the same way using single batch of CNP-Str conjugate (batch #3). Biotinylated and non-biotinylated aptamer adsorption rates characterized biospecific and non-specific interaction between nanoparticles and oligonucleotide correspondingly.

Preparation of conjugates of biotinylated aptamers with CNP-Str Aptamer solutions were mixed with CNP-Str in the ratio 250 pM of DNA per 1 mg of CNP. This ratio was selected in the course of optimization experiments (see Results section). When Bi-D17.4-FAM was immobilized on CNP-Str Tween20 was added in the mixture to the final concentration of 0.1%. In the case of BiTBA15-FAM conjugation KCl was also added to 0.1 M because according to Ref.40 K+ ions effectively stabilize unimolecular G-quadruplex structure of TBA15 so we used the same concentration of K+ as in the mentioned paper. Final volumes of CNP+aptamer mixture varied between experiments and exact volumes are given for each experiment in the Results section. Mixtures of CNP-Str and aptamers were incubated at +37°C for 60 min on an orbital shaker. Then, CNP-Str conjugated with aptamer were separated from unbound aptamer by size-exclusion chromatography. Suspension CNP+aptamer were applied on a column packed with Sepharose CL-6B. Volume of applied CNP+aptamer suspensions was 5% from the volume of Sepharose medium (e.g. 20 ml of Sepharose was used for separation of 1 ml sample of CNP+aptamer). Column was packed at maximum recommended 7 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

flow rate (30 ml/cm2×h) using PBS. Elution was performed at 15 ml/cm2×h flow rate. Column was equilibrated with an appropriate buffer prior to separation. For CNP-Str+Bi-D17.4-FAM conjugates we used PBST unless otherwise stated. For Bi-TBA15-FAM experiments column was equilibrated with azide-free PBS containing 0.1% Tween-20 and 0.1M KCl. Fractions of 0.6 ml each were collected and amount of aptamer functionalized CNP was evaluated measuring absorbance at 450 nm according to39. Fractions with highest concentration of CNP were pooled. During the first chromatography experiment, the separation of unbound aptamer was confirmed by measuring the fluorescence in subsequent fractions. For this purpose, these fractions were centrifuged at 20000g for 100 min and 100 µl supernatant samples from each fraction were taken. In the following experiments the fluorescence only in a couple of fractions was measured to control the separation and detailed elution profiles were not obtained. Pooled fractions volume was measured, and then glycerol and BSA were added to the final concentrations of 20% and 1%, correspondingly. Various storage buffer composition and treatment conditions of conjugates were used when we assessed their stability. Detailed storage conditions are disclosed in Results section. Mass fraction of CNP in conjugate suspensions was measured by absorbance at 450 nm: earlier we found that optical density of 0.03% (w/w) suspension of functionalized CNP is 14 units39.

Aptamer desorption during storage Aptamer desorption from CNP-Str was evaluated by measuring the fluorescence intensity in the supernatants of centrifuged conjugate aliquots stored in different conditions. Aliquots were diluted tenfold (50 µl of conjugate and 450 µl of PBST) then centrifuged 20000g for 100 min. One hundred microliter samples from supernatant were taken to measure fluorescence intensity. Amount of desorbed aptamer in pM per mg of CNP-Str was calculated from fluorescent 8 ACS Paragon Plus Environment

Page 8 of 39

Page 9 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

intensity values using calibration curves obtained from serial dilutions of FAMlabeled aptamers.

Size and zeta-potential measurement Malvern ZetaSizer Nano ZS (Malvern, UK) was used for size and zetapotential measurements. This instrument measures the intensity of dynamic light backscattering (detection angle = 173°) to characterize the particle size distribution. For size measurement CNPs were diluted 1:500 in 1.5 ml of PBS preliminary filtered through polyethersulfone syringe filter with the pore size of 200 nm. For stability study of CNPs at different pH they were diluted in corresponding buffers. Measurements were carried out in auto mode in plastic cuvettes. Polydispersity index value (PdI) and the intensity-weighted size mean distribution (z-average diameter) are reported if not otherwise stated. For zeta potential measurement CNPs were diluted 1:100 in 0.7 ml of deionized water. We confirmed that pH of obtained solution does not change significantly after dilution. Measurements were carried out in auto mode in plastic cuvettes using Dip Cell electrode (Malvern, UK).

Dot blot assay for evaluation of CNP conjugates functional activity The ability of immobilized D17.4 aptamer to bind IgE was assessed via the colorimetric dot blot assay. Immunoglobulin E in the concentration of 20 µg/ml in PBS was applied (3 µl per dot) to the wells of white non-transparent polystyrene plates, 4 dots per well. Plates were placed in a wet chamber in thermostat at +37°C for 30 min. For better reproducibility polystyrene plates were sensibilized with IgE and after washing wells were filled with 300 µl of PBS with 1% BSA and 3% sucrose, sealed and stored at +4°C according to Ref.41. In the day of the conjugate testing plates were taken from fridge, warmed to room temperature, rinsed with 400 µl PBST, then washing buffer was removed using waterjet pump and 200 µl of CNP-Str+Bi-D17.4-FAM conjugate were added. We used PBST-MK containing 1% casein for conjugate dilution, however when the conjugate contained 2 mM 9 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

EDTA we increased the concentration of magnesium ions in a dilution buffer from 1 to 3 mM to reach 1 mM concentration of free (not bound to EDTA) Mg2+. Addition of casein allowed preventing the non-specific interaction of conjugate with IgG that was attributed to proteins on nanoparticles’ surface but not to aptamer. CNP-Str+Bi-D17.4-FAM conjugates were diluted to reach the final concentration of carbon nanoparticles of 0.03%. For conjugates stored at –20°C and contained higher percentage of glycerol a dilution factor decreased correspondingly. After the conjugate addition plates were sealed with ELISA plate covers, placed on a shaker at +37°C for 60 min, then washed three times with 400 µl of PBST and dried. Gray spots appeared in the zones of IgE sorption. To measure signal intensity the approach proposed by George Whitesides Research Group42 was applied: we placed plates in a box made of thick white cardboard with a hole in a lid. White LED tape was attached to the inner side of the lid and used as a light source providing controllable and reproducible illumination of plate. Photographs of each well were obtained through the hole in a lid with the aid of smartphone Xiaomi Redmi 4X 32GB equipped with 13 MP S5K3L8 camera. Photographs were converted to grayscale using Paint.NET, saved as .jpeg files and processed in ImageJ software (https://imagej.nih.gov/ij/). Mean background intensity was calculated from five separate measurements in different zones of well bottom (detailed measurement scheme is presented in Fig. S1). Intensity measurement in ImageJ gives values from 255 (white) to 0 (black) and for convenience (to work with positive values) signal intensity for each dot was measured as follows: 255 minus (dot color intensity minus mean well background color intensity).

Nuclease stability study Several tests were carried out to assess nuclease resistance of immobilized aptamers. First, CNP-Str+Bi-TBA15-FAM and CNP-Str+Bi-D17.4-FAM were diluted to achieve 0.02% concentration of CNPs in PBS containing 0.17 U/ml of DNAse I 10 ACS Paragon Plus Environment

Page 10 of 39

Page 11 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(same amount as in the blood serum of healthy individuals43), 0.1% Tween-20, 2.5 mM Ca2+, 1 mM Mg2+, 5 mM K+ (normal ion concentration in blood serum according to FDA44) in 5 tubes. DNAse I-free PBS with the same amount of ions was used to prepare the control samples. Carbon nanoparticle concentration of 0.02% was chosen to obtain high enough fluorescent signal. Diluted nanoparticles were incubated on a mixer at +37°C, and 200 µl samples were taken from each tube in 1, 2, 4, 8, 12 and 24 hours and centrifuged at 20000g for 15 min; then the fluorescent in a supernatant was measured. Despite DNAse I is a commonly used model for the assessment of aptamers nuclease resistance, much more intensive degradation of DNA occurs in a whole blood serum45. We used pool of sera obtained from three healthy individuals. Pooled serum was stored at –20°C for 2 weeks prior to analysis. Influence of serum nucleases on the functional activity of CNP-Str+Bi-D17.4-FAM was evaluated by dot blot assay. Conjugate was diluted to 0.02% of CNP in whole human blood serum in the final volume of 1500 µl that gave 90% final serum concentration. As for previous experiment, 3 test and 3 control tubes were prepared. In the 3 control tubes EDTA were added to final concentration of 5 mM. It was shown that EDTA in this concentration prevents nuclease-dependent degradation of DNA in human serum46. Equal volume of PBS was added in test tubes instead of EDTA. Diluted nanoparticles were incubated on a mixer at +37°C and 100 µl samples were taken from each tube in 1, 2, 4, 8, 12 and 24, diluted twofold in PBST-MK with 2% casein (that gives its final concentration of 1%) and placed in the wells of polystyrene plates sensibilized with IgE as described above. Concentration of Mg2+ ions, that are essential for aptamer-IgE interaction47, was adjusted to 1 mM by the addition of corresponding amount of MgCl2 in PBSTMK. Plates were sealed with plastic covers, incubated at +37°C for 60 min, then washed and dried.

Influence of pH on stability of nanoparticles 11 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Suspensions of CNP-Str+Bi-TBA15-FAM and CNP-Str+Bi-D17.4-FAM were diluted in buffers with pH in the range of 4–10 to obtain 0.01% solutions. The following buffers were used: 0.015M PBS (pH 6-8), 0.2M carbonate buffer (pH 9 and 10), 0.1M acetic buffer (pH 4 and 5). Sodium chloride was added in PBS and acetic buffer to equalize their ionic strength with that of carbonate buffer, namely 0.2M. After 2 h agitation, size and zeta potential were measured.

Quenching properties of carbon nanoparticles The ability of CNPs to quench fluorescence of FAM-labeled aptamers upon binding was determined as follows: CNP-Str and CNP-BSA (CNPs non-covalently coated with BSA without further modifications) were added to 100 µl of 25 and 50 nM solutions of Bi-D17.4-FAM. Resulted mass fractions of CNP-Str and CNPBSA were the same: 0.01%. Mixtures were incubated in black 96-well plates at +37°C for 60 min on a plate shaker, and then the fluorescence was measured. Twoway paired ANOVA with Sidak post hoc tests was performed for group comparison.

Data analysis Graphpad Prism 6.0 (GraphPad Software, USA) was used for statistical analysis.

Results and discussion Optimal conditions of conjugates preparation and determination of aptamer loading Three batches of CNP-Str were synthesized to assess the repeatability of aptamer functionalization. Conjugates from each batch were incubated with different concentrations of aptamers, the amount of adsorbed aptamer was measured. It was shown that optimal aptamer/CNP ratio is 250 pM DNA per 1 mg CNP. This ratio provides high amount of immobilized aptamer (about 100-120 pM/mg) together with low percentage of aptamer loss (Fig. 1). There was no 12 ACS Paragon Plus Environment

Page 12 of 39

Page 13 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

adsorption of non-biotinylated aptamer, except for one of the batches. For this batch significant non-specific sorption was observed, when DNA/CNP ratio was more than 1000 pM/mg. We attributed this fact to the deterioration of glutaraldehyde, because fresh glutaraldehyde solution of the same lot was used to prepare two other batches of conjugates and no non-specific sorption was observed. It should be noted, that 235/280 nm absorbance ratios (parameter commonly used to control the quality of glutaraldehyde) for both solutions were almost identical. The absence of non-specific sorption is important for the preservation of the functional properties of conjugates, because aptamers immobilized on the surface of nanoparticles via hydrogen bonds, hydrophobic, electrostatic interactions can easily (and uncontrollably) desorb under changing solution conditions. On the contrary, biotin-streptavidin bond is very strong and resistant to variations of pH, temperature and presence of detergents. The lack of non-specific DNA sorption may be explained by electrostatic repulsion of negatively charged DNA molecules and BSA immobilized on the nanoparticles’ surface48.

Fig. 1. Relation between aptamer/CNP ratio and amount of adsorbed aptamer for one of CNP-Str batches. Aptamer sorption in pM per mg of CNP (line 13 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

with circles), fraction of adsorbed aptamer as measured from its initial amount (line with diamonds). Dashed line depicts optimal aptamer/CNP ratio: 250 pM/mg.

We optimized the conjugation conditions using well-studied anti-IgE BiD17.4-FAM aptamer. However, in order to investigate whether the proposed method is applicable for aptamers with different secondary structure (G quadruplexes (G4)), we synthesized conjugate of CNP-Str with G4-containing aptamer Bi-A8-L2A4. Oligonucleotides bearing guanine tetrads are not only peroxidase mimics but also have higher resistance to nucleases degradation49 thus it was of interest to compare the stability of aptamers with different secondary structure. Aptamer Bi-A8-L2A4 was thought to have high peroxidase-like activity due to its structure elements: polyA-tail at 3’-end35 and four adenines in the second loop of G-quartet36. We prepared a 1 ml mixture of 0.55% CNP-Str and Bi-A8L2A4 in a ratio of 250 pM DNA/mg CNP and after hour-long agitation significant aggregation was observed (diameter 516 nm, PdI 0.645). There was no visible aggregation of CNP-Str+Bi-D17.4-FAM conjugates prepared in the same way (size 173 nm, PdI 0.091). We supposed that intermolecular G4s (dimers or tetramers) were formed, and each of them carried two or four biotins enabling simultaneous binding to several nanoparticles (Fig. 2).

14 ACS Paragon Plus Environment

Page 14 of 39

Page 15 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Fig. 2. Interaction between two CNP-Str nanoparticles via binding of dimeric G4 formed by two Bi-A8L2A4 molecules (hypothetic scheme)

This phenomenon is well-known and used in development of G4-based nanoparticle aggregation assays50; ability of G4s to form intermolecular structures strongly depends on nucleotide sequence and buffer composition. In order to confirm our hypothesis we incubated CNP-Str in the same concentration with BiA8-L2A4 and Bi-D17.4-FAM (as a control) in the ratios of 250, 2500 and 12500 pM DNA per 1 mg of CNP-Str. We assumed that the excess of G4 di- and tetramers should decrease the aggregation of CNPs. DLS results confirmed this assumption: z-average diameter of CNP-Str+Bi-A8-L2A4 synthesized at the aptamer/CNP ratio of 12500 pM/mg was equal to that of CNP-Str+Bi-D17.4-FAM synthesized at the aptamer/CNP ratio of 250 pM/mg. the increase of the ratio leads to the reduction of nanoparticles’ diameter. Interestingly, the addition of Bi-D17.4FAM to CNP-Str at the ratio of 12500 pM/mg leads to the growth of the particle size (size 249 nm, PdI 0.262). Possible explanation could be the formation of BiD17.4-FAM self-dimers due to complementary interaction of stem parts of two oligonucleotides. These dimers carry two biotins (one from each oligonucleotide) and their concentrations are high enough to provoke the aggregation of CNP-Str. It is known51 that the concentration of metal ions may strongly affect the folding of G4 and its changing may induce the formation of intra- or intermolecular G4s. Such a knowledge may be used to promote folding of G4 towards its intramolecular form in order to prevent aggregation of nanoparticles. Unfortunately, since there is no information about the folding of A8-L2A4 in different ionic environments, we preferred to change the model aptamer and chose one with well-studied structure, namely thrombin-binding aptamer (TBA15)37, forming the intramolecular G4 in the presence of 0.1M KCl40. We mixed BiTBA15-FAM and CNP-Str in the ratio of 250 pM DNA/mg CNP and no aggregation was observed (size 177 nm, PdI 0.103). Then, using the approach described above we confirmed, that the relation between the sorption of aptamer on 15 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CNP-Str and initial aptamer/CNP-Str ratio was the same for both Bi-TBA15-FAM and Bi-D17.4-FAM.

Size and zeta potential of CNP-aptamer conjugates Mean diameter of CNP-aptamer nanoparticles varied from batch to batch from 168 to 177 nm. All samples had single-peak size distribution according to DLS data (Fig. 3) and their polydispersity index was 0.08–0.14. Generally, we observed slight increase (about 4-5 nm) of nanoparticles diameter after aptamer loading. This growth may be explained by aptamer attachment, since size of aptamers is approximately 2-3 nm. No zeta potential change was observed after aptamer loading.

Fig. 3. Typical size distribution plot of CNP-aptamer conjugate

Since carbon nanomaterials are used for sample preparation, analysis and other purposes in different media like body fluids, food, plant and animal tissue extracts, environmental samples that frequently have non-neutral pH, we assessed the stability of CNP-aptamer conjugates in acidic and alkaline conditions. We diluted them in buffers with pH from 4 to 10 and measured their size and zeta potential (Fig. 4). At pH 7 mean diameter of CNP-Str+Bi-D17.4-FAM was 168±1.48 nm, generally in the pH range 6–10 particles had the size ranged from 164 to 171 nm and polydispersity index near 0.1. Zeta potential of CNP-Str+Bi16 ACS Paragon Plus Environment

Page 16 of 39

Page 17 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

D17.4-FAM at pH 7 and higher was from -34 to -36 mV. We suppose that zeta potential of nanoparticles is mainly influenced by BSA with its isoelectric point of 4.7. Results of visual examination of 0.01% CNP-Str+bi-D17.4-FAM diluted in the same buffers after 2 h agitation corresponded with above data: sedimentation occurred at pH 4 and 5, but not in more alkaline media. Despite zeta potential of CNP-Str+Bi-D17.4-FAM is close to zero (-7.2±16.8 mV) at pH 6 the suspensions were stable. Obviously, both electrostatic repulsion and steric hindrance contribute to nanoparticles stability. The same results were obtained for CNP-Str+Bi-TBA15FAM (Table S6). Thus, the application of CNP-aptamer conjugates in neutral and alkaline media is possible. Aggregation of nanoparticles in acidic conditions may significantly impair their performance.

Fig. 4. Mean diameter, size and polydispersity index of CNP-Str+Bi-D17.4FAM in buffers with different pH (mean±SD, n=3) and appearance of 0.01% CNPStr+Bi-D17.4-FAM suspensions in corresponding buffers.

Storage stability of CNP-aptamer conjugates 17 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The assessment of storage stability of CNP+aptamer conjugates was performed in several stages. Firstly, we did the pilot study: three batches of CNPStr+Bi-D17.4-FAM with nanoparticles concentration of about 2 mg/ml were prepared. We separated conjugate particles from unbound aptamer via sizeexclusion chromatography on a column equilibrated with PBST-MK (elution profile is shown in Fig. S2). The same buffer was used for elution and storage of CNP-Str+Bi-D17.4-FAM. Aliquots from the each batch of CNP-Str+Bi-D17.4FAM were stored at +4°C and +37°C for one month. The functional activity changing was assessed by direct dot blot colorimetric assay with human IgE and IgG (negative control) in white polystyrene plates. Plates were photographed and signal intensity was measured using ImageJ software. There was no interaction of CNP-Str with BSA, however minor non-specific binding to IgG was observed for CNP-Str and CNP-Str+Bi-D17.4-FAM, and this problem was resolved by addition of casein in conjugate dilution buffer. In following experiments no non-specific binding was observed neither for freshly prepared nor for stored conjugates CNPStr+Bi-D17.4-FAM (Fig. 5).

Fig. 5. Evaluation of CNP-Str+ Bi-D17.4-FAM functional activity by dot blot assay. Left well – 3 µl of 20 µg/ml IgE solution spotted on the well bottom (4

18 ACS Paragon Plus Environment

Page 18 of 39

Page 19 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

spots), right well – 3 µl of 20 µg/ml of IgG and BSA spotted on the well bottom (2 spots of each). Spotting scheme is at the top of the figure.

When stored at +4°C conjugates retained 66% of initial activity in 30 days. Substantially higher decline of the functional activity was observed during the storage at +37°C (Table 2). Aptamer desorption rate was also lower when conjugates were stored at +4°C (Table S3). The aggregation of nanoparticles took place during the storage at +37°C, conversely there were no change in size when CNP-Str+Bi-D17.4-FAM were kept at +4°C.

Table 2. IgE-binding activity (in percent of activity at day 0) of 3 batches of CNP-Str+Bi-D17.4-FAM change after 30 days of storage at +4°C and +37°C

Day 7 Day 30

Batch 1 54.9 73.8

Day 7 Day 30

Batch 1 23.4 25.5

4°С Batch 2 76.2 52.5 37°С Batch 2 26.5 7.2

Batch 3 88.3 72.9

Mean±SD 73.1±16.9 66.4±12.1

Batch 3 29.8 23.7

Mean±SD 26.6±3.2 18.8±10.1

We supposed that the loss of the functional activity and the alteration in the size of nanoparticles are associated with the nuclease activity in the storage medium. We performed the synthesis of conjugates in non-sterile conditions; addition of sodium azide does not completely prevent the growth of microorganisms, therefore there is no doubt that nucleases are present in the storage buffer. It’s unlikely that the detachment of aptamer is associated with the break of biotin-streptavidin bond. Moreover, earlier we demonstrated high stability of CNP-Str conjugates and their ability to retain both functional and structural properties for several years39, that’s why we considered the nuclease activity as main reason of alteration of conjugates’ properties. 19 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nuclease degradation may significantly affect shelf-life of nanoparticleaptamer conjugates. In 2009 Giljohann et al. showed the essential role of RNAse deactivation through autoclavation prior to conjugation with RNA. They found out that such a harsh treatment does not impair properties of bare gold nanoparticles52. Moreover, autoclavation in the presence of diethylpyrocarbonate (DEPC) did not deteriorate the analytical performance of GNP-cocaine DNA aptamer and prolonged their shelf-life to 2 months (non-treated conjugates retained activity at +4°C for about 1 month)53. The same research group demonstrated the possibility of application of freezing for aptamer conjugates storage on the same analytical model54. Detachment of 50% of oligoDNA covalently bound to magnetic nanoparticles during 8-week-long the storage in PBS at +4°C was demonstrated55. Although authors did not assume the reason of conjugate degradation, we supposed that nuclease destruction is possible explanation. On the other hand, there are many examples of high stable NP-aptamer conjugates stored in common condition with no decline of performance. There was no loss of activity of D17.4 conjugated with silver nanoparticles during the storage in PBS for 28 days56. Hemin/DNA Gquadruplex complex attached to the silver nanoparticles retained 95% of initial activity in chemiluminescent immunoassay for 20 days being stored in PBS57. Wu et al. demonstrated high stability of complexes of up-converting and magnetic nanoparticles assembled via hybridization of aptamer and complementary DNA strand on their surfaces during the storage in a dry state and in PBS58. We cannot explain the differences in results obtained in above studies, maybe the chemical nature of nanoparticles contributes to aptamers’ stability, i.e. silver nanoparticles inherently inhibit the growth of microorganisms that may decrease the amount of nuclease production by bacteria in the storage medium. In addition, the synthesis conditions also may somehow favor the reduction of bacterial contamination or nuclease activity. The enhancement of CNP+aptamer conjugates’ stability is one of the main goals of our research. It is possible to maintain nuclease-free environment during synthesis and storage of CNP-aptamer, however it would be of great interest to 20 ACS Paragon Plus Environment

Page 20 of 39

Page 21 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

find out some kind of post-synthesis treatment of conjugates that allows their storage in commonly available conditions. Autoclavation of conjugates is unacceptable because of denaturation of proteins coating CNPs, however milder heat treatment was considered feasible, since it is known that heating of solutions to +60-70°C for several minutes is a conventional way to get rid of DNAse activity. Another approach is based on the addition of chelators (usually EDTA) that bind divalent metal ions necessary for the nuclease activity. Using dot blot assay we detected that CNP-Str maintains the ability to bind biotin after heating at +70°C for 10 min. After that we have carried out another storage experiment: aliquots of CNP-Str+Bi-D17.4-FAM were stored at +4°C, +37°C and –20°C for one month, half of aliquots were heat treated as described above, EDTA was added to some aliquots to the final concentration of 2mM. Fifty percent glycerol served as cryoprotectant for the samples stored at –20°C.

Fig. 6. Changes of IgE binding activity of CNP-Str+Bi-D17.4-FAM nanoparticles during the storage at different temperatures in the buffer with or without 2 mM EDTA (mean±SD, n=3).

The addition of EDTA allowed preserving both functional and structural properties of CNP-aptamer conjugate. There was no decline of IgE binding after one-month-long storage at +4°C. (Fig. 6 and S5). When conjugates were stored in EDTA-free conditions at +4°C or +37°C, 26% and 82% loss of activity in dot blot 21 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 39

assay correspondingly were observed (Table 3). Storage in a freezer prevents deterioration of conjugates’ binding ability regardless of chelator presence in the buffer. Similarly, 4-fold increase of free aptamer occurred when CNP-Str+BiD17.4-FAM was stored in PBS +4°C, 2 mM EDTA addition lead to the absence of any aptamer desorption. No changes in free aptamer concentration were observed when conjugates were kept at –20°C (Fig. 7).

Table 3. Percentage of IgE binding activity retained by CNP-Str+Bi-D17.4-FAM in different storage conditions Day 7 30

PBS+ 20% Glycerol+1% BSA+2mM EDTA +4°C +37°C -20°C 99.9 71.9 97.4 108.3

42.8

101.9

PBS+ 20% Glycerol+1% BSA +4°C +37°C -20°C 89.1 38.6 103.3 74.1

18.0

107.6

Fig. 7. Desorption of aptamer from CNP-Str+Bi-D17.4-FAM nanoparticles during the storage at different temperatures in the buffer with or without 2 mM EDTA (mean±SD, n=3)

No changes in particle size at +4°C were shown when 2 mM EDTA was added to the storage solution day 30 (Fig. 8). Slight increase in size (about 6 nm) 22 ACS Paragon Plus Environment

Page 23 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

was observed when conjugates were stored at –20°C regardless the presence of EDTA in the buffer. Almost the same size change pattern was observed for CNPStr+Bi-TBA15-FAM (Table S4), except there was no diameter increasing at +37°C. Zeta potential of CNP-Str+Bi-D17.4-FAM at +4°C and –20°C was stable (mean –34 mV) and did not depend on EDTA addition. At +37°C a minor increase of zeta potential to –38 mV at day 30 was occurred. Heat treatment is another possible way to prevent the nuclease degradation of immobilized DNA-aptamers. There was no reduction of the functional activity or aggregation of particles after month-long storage of CNP-Str+Bi-D17.4-FAM suspensions after heating to +70°C. However, heat treatment by itself led to immediate 40% loss of IgE binding activity and growth of nanoparticles’ diameter to about 188-189 nm. The addition of EDTA seems to be an effective method to prevent CNPStr+Bi-D17.4-FAM degradation. This approach is simple and does not require the synthesis in nuclease-free condition. The possible drawback is the interference of EDTA with applications for which the presence of divalent ions in the solution is necessary. It’s known that EDTA possesses peroxidase-like activity59 and may influence the activity of G-quadruplex-hemin complexes attached to nanoparticles. Many aptamers need divalent metal ions for proper folding so it’s always necessary to take into account the amount of EDTA in the storage buffer and use some excess of such ions. We suppose that the addition of EDTA may be used to prolong shelf-life of any kind of NP-aptamer suspensions. It should be noted that possibility of successful refolding upon depletion/addition of Mg2+ was earlier proved for D17.4 aptamer by Liss et al.60. Talking about other limitations of our study, we should mention that amount of EDTA necessary for immobilized aptamer preservation, was not optimized and may be significantly lower than 2 mM. In fact, the concentration of chelator depends on the amount of divalent ions in the storage buffer. Since storage buffer initially did not contain any of such ions, 23 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

then their concentrations are negligible as they are present in trace amounts in salts used to prepare buffers.

Fig. 8. Changes of mean diameter and polydispersity index of CNP-Str+BiD17.4-FAM conjugates during the storage at different temperatures in the buffer with or without 2 mM EDTA (mean±SD, n=3)

Stability of aptamer-functionalized CNP in human serum For some bioanalytical techniques, i.e. lateral flow assays, dilution of nanoparticles in whole plasma or serum is necessary. In order to assess the possibility to use synthesized nanoparticle for this kind of assays the conjugates CNP-Str+Bi-TBA15-FAM and CNP-Str+Bi-D17.4-FAM were diluted to 200 µg/ml in whole human serum and incubated at +37°C for 28 h. Their size and polydispersity were measured by DLS in 90% serum filtered through syringe filter with 0.2 µm pore size (Fig. 9). No significant changes were observed during the incubation period, mean diameter of CNP-Str+Bi-D17.4-FAM nanoparticles varied from 177–192 nm, polydispersity index was in the range of 0.17–0.31 (Fig.S7). These values hardly can be compared with ones obtained for the suspensions of 24 ACS Paragon Plus Environment

Page 24 of 39

Page 25 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

nanoparticles in PBS because of high overall variability of the results and the interference from serum proteins and their aggregates. Only small sediment was observed on the bottom of test tubes after 28 h of CNP-aptamer incubation in a whole serum by visual examination. It’s possible to conclude that slight aggregation takes place in a whole serum and this should be considered while developing the paper-based assays of whole serum/plasma samples when nanoparticles migrate along the membrane with certain pore size.

Fig. 9. Changes of mean diameter and polydispersity index of CNP-Str+BiD17.4-FAM during the incubation in 90% human serum (mean±SD, n=3).

Quenching properties of carbon nanoparticles Carbon nanomaterials like carbon nanotubes, graphene oxide and carbon nanoparticles are widely used as energy acceptors in FRET-based assays61. Förster resonant energy transfer occurs when the distance between donor and acceptor is in the range of 1–10 nm. During the conjugation, CNPs are subsequently coated with BSA and streptavidin. Given the size of these proteins is not exceed 5 nm we can assume that the distance between aptamer upon binding should not be more than 10 nm and FRET between FAM-labeled aptamer and CNP should occur. To examine quenching properties of CNP we mixed 25 and 50 nM biotin- and FAMlabeled aptamer solutions with CNP-Str and BSA-coated CNP (CNP-BSA) and measured fluorescence. Earlier we confirmed attachment of biotinylated aptamer to 25 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CNP-Str, conversely no binding of biotin-labeled aptamer to CNP-BSA was observed. In this experiment CNP-BSA served as negative control, since carbon nanoparticles can non-specifically quench fluorescence due to their ability to efficiently absorb light. It was shown that streptavidin-coated nanoparticles quenched the fluorescence more efficiently comparing with BSA-coated nanoparticles (Fig. 10, Two-way ANOVA, p