Homogeneous Assay for Detection of Active Epstein-Barr Nuclear

Letter pubs.acs.org/ac

Homogeneous Assay for Detection of Active Epstein-Barr Nuclear Antigen 1 by Thrombin Activity Modulation Gaizka Garai-Ibabe,† Ruta Grinyte,† Allon Canaan,‡ and Valeri Pavlov*,† †

Biofunctional Nanomaterials Department, CICbiomaGUNE, Parque tecnológico de San Sebastian, Paseo Miramon 182, Donostia-San Sebastian 20009, Spain ‡ Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06520, United States ABSTRACT: Epstein-Barr virus (EBV) has been associated with several malignancies as Burkitt’s lymphoma, nasopharyngeal carcinoma, and Hodgkin’s disease. In those diseases, Epstein-Barr nuclear antigen 1 (EBNA-1) is constitutively expressed. Here, we reported an innovative system to detect active EBNA-1 protein in a homogeneous assay. The system is based on the modulation of thrombin activity by a selfcomplementary single stranded DNA (scssDNA), which was designed and synthesized to mimic the palindromic target sites of EBNA-1 in the EBV genome. This model system showed a limit of detection of 3.75 ng mL−1 of active EBNA-1 protein with a dynamic detection range from 3.75 to 250 ng mL−1 with a correlation coefficient of 0.997. This new homogeneous assay for active EBNA-1 protein detection and quantification provides a very useful tool for rapid screening of EBNA-1 blockers in biomedical research.

E

pstein-Barr virus (EBV), or human herpevirus 4, infects the majority of the World’s population (>90%). After primary infection, EBV immortalizes a portion of host Blymphocytes and establishes a latent infection that persists through the whole host’s lifetime. EBV is the causative agent of infectious mononucleosis and has been associated with several lymphoid and epithelial cell malignancies, including Burkitt’s lymphoma (BL), nasopharyngeal carcinoma (NFC), lymphoproliferative disease in immunosuppression, and Hodgkin’s disease.1 The viral gene expression pattern is distinct in each type of EBV related malignancies while Epstein-Barr nuclear antigen 1 (EBNA-1) is the only protein expressed in all tumor cells.2 EBNA-1 is a multifunctional protein necessary for the transcription, replication, and maintenance of the episomal viral genome in latently infected cells. For the viral genome replication, EBNA-1 binds to specific sequences of the EBV DNA, located in the latent origin of replication (oriP).3 EBNA1 is not a helicase;4 therefore, it recruits cellular host initiation factors for the viral chromosome replication.5 To ensure the segregation of viral genome copies in progeny nuclei, EBNA-1 interacts with the hEBP2 protein on the cellular mitotic chromosome.6 Interestingly, the EBNA-1 role in replication was shown to exceed beyond the limited scope of regulating the viral gene expression. EBNA-1 also binds to cellular gene promoters and imposes changes in host gene expression in order to generate a cellular environment to support EBV’s life cycle.7 In addition, EBNA-1 has the potential to act as an oncogene. This was shown by the development of lymphomas in a B-cells specific EBNA-1 transgenic mouse which demonstrated up-regulation of the apoptosis suppressor protein survivin in B-cells lymphoma.8,9 © 2012 American Chemical Society

Because EBNA-1 plays a fundamental role in EBV’s life cycle and it is expressed in the tumor cells of all EBV-associated malignancies, it is an attractive therapeutic target to develop treatments against Epstein-Barr viral infection and prevent malignancies associated with it. In this sense, the inhibition of protein−DNA binding activity has been successfully used previously as a method for other clinical applications.10−13 Related to EBV infections, 90 000 low molecular mass compounds were virtually screened in order to identify novel EBNA-1 inhibitors for use as therapeutic agents against latent EBV infection.14 As shown above, the pivotal strategy to develop anti-EBV infection therapy will be based on blocking this DNA-binding viral protein. Thus, the screening of potential molecules blocking EBNA-1 will require a rapid assay for the detection of active EBNA-1. The previously described methods for evaluation of interaction between EBNA-1 with its target DNA rely mainly on gel electrophoresis3 and immunoprecipitation of DNA-EBNA-1 complexes,7 which are time-consuming and expensive and require experienced human resources. In this work, an innovative concept for the direct, simple, and rapid detection and quantification of active EBNA-1 protein is reported. The detection system is based on the modulation of thrombin activity by a self-complementary single stranded DNA (scssDNA) that recognizes specifically EBNA-1 protein. This model system was successfully applied to quantify active EBNA-1 and discriminate between active and inactive protein. This assay is aimed to be a useful tool for rapid screening of EBNA-1 blockers, the protein that could become one of the Received: May 8, 2012 Accepted: June 19, 2012 Published: June 19, 2012 5834

dx.doi.org/10.1021/ac301250f | Anal. Chem. 2012, 84, 5834−5837

Analytical Chemistry

Letter

Table 1. Sequences and Length of Self Complementary Single Stranded DNAs (scssDNA) Used in This Study EBNA-1 binding scssDNA scssDNA1 scssDNA2 scssDNA3 scssDNA4 G-quadrupex

sequence (5′-3′)

length (bp)

TGATCCAGATTAGGATAGCATATGCTACCCAGATCT TTGATCTGGGTAGCATATGCTATCCTAATCTGGATCA ACCCAGATCTTTGATCTGGGTAGC CCCAGATCTTTCTACTGGG CAGATCTTTGATCTG GATCTTTGATC GGTTGGTGTGGTTGG

73 24 19 15 11 15

Scheme 1. Schematic Diagram of EBNA-1 Detection by scssDNA Mediated Catalytic Activation of Thrombin

fluorescence (λexc= 498 nm and λemi = 521 nm) was recorded during 25 min. In the absence of EBNA-1 protein, the scssDNA interacts with thrombin and partially blocks its active center hydrolyzing the rhodamine 110 derivative. On the other side, when EBNA-1 is present in the assay, the specific binding between EBNA-1 and the scssDNA prevents the interaction between scssDNA and thrombin. In other words, EBNA-1 prevents the inhibition of thrombin, which catalyzes the hydrolysis of the rhodamine derivative, providing the principle for analysis of EBNA-1 by thrombin activity modulation.

most attractive drug targets in the course of discovery of antiEBV compounds.

■

EXPERIMENTAL SECTION Materials. All chemicals, except of the fluorogenic substrate for thrombin, rhodamine 110, bis-(p-tosyl-L-glycyl-L-prolyl-Larginine amide) (Invitrogen, USA), and thrombin from human plasma were purchased from Sigma-Aldrich-Fluka (Spain). For the sequence specific binding of EBNA-1, the scssDNA was designed by combining two 30-mer consensus oligonucleotides 5′-gatccagattaggatagcatatgctaccca-3′ and 5′-gatctgggtagcatatgctatcctaatctg-3′.15 scssDNA of varying lengths (Table 1) were synthesized by IDT (USA). All oligonucleotides were HPLCpurified and freeze-dried by the supplier. Functional EBNA1461−607 (lacking most Gly-Ala region) was produced according to the previously published procedure.16 Detection of EBNA-1 Protein. Thrombin catalyzes the hydrolysis of the rhodamine 110 derivative to the fluorophore rhodamine 110.17 In order to optimize the system, thrombin activity was measured, in the presence of varying concentrations of EBNA-1 binding scssDNA and other scssDNA of different lengths (Table 1). A buffer containing 100 mM NaCl, 20 mM Tris, 2 mM MgCl2, 5 mM KCl, and 1 mM CaCl2 (pH 8) was used as a model medium for EBNA-1 detection. All measurements were carried out in triplicates using a Varioskan Flash fluorimeter (Thermo Scientific), and the error bars represent the standard deviation of three independent measurements. The principle for the detection of EBNA-1 protein is shown in Scheme 1. Briefly, scssDNA was incubated for 20 min in the presence of different concentrations of EBNA-1 (from 3.75 to 250 ng mL−1). Subsequently, thrombin is added to the system, and after a 20 min incubation time, evolution of rhodamine 110

■

RESULTS AND DISCUSSION Assay Optimization. Thrombin activity toward the rhodamine 110 derivative was partially inhibited by scssDNA. The effect of different concentrations of scssDNA on thrombin activity was studied in order to optimize the assay composition. Thrombin concentration of 0.5 nM was selected for subsequent analysis (data not shown). The highest inhibition rate for thrombin activity, close to 70%, was obtained by applying 1 nM of scssDNA to the system. Further thrombin activity inhibition could not be achieved by increasing scssDNA concentration (data no shown) and the 1:2 relation of thrombin to scssDNA (c/c) was fixed at an optimum for further experiments. The residual catalytic activity of the thrombin-scssDNA conjugate toward the hydrolysis of the rhodamine 110 derivative was due to the presence of unbound, noninhibited thrombin existing in equilibrium with the thrombin-scssDNA complex. The effect of the length of the scssDNA on the inhibition of thrombin activity was also studied. When applying scssDNA of different lengths to the system, it was observed that the inhibition rate of thrombin activity decreased when the length of the scssDNA was reduced. As shown in Figure 1, a linear 5835

dx.doi.org/10.1021/ac301250f | Anal. Chem. 2012, 84, 5834−5837

Analytical Chemistry

Letter

thrombin, allowing the latter to catalyze the hydrolysis of the rhodamine 110 derivative. As one can observe, when concentration of EBNA-1 increases, the resulting fluorescence is enhanced due to the buildup of catalytically active free thrombin. The calibration plot (Figure 2B) showed a linear relationship between fluorescence intensity enhancement during time, in the linear region of the curve (between 500 and 1500 s), which is directly related to thrombin activation, and EBNA-1 concentration in the range of 3.75 to 250 ng mL−1 with a correlation coefficient of 0.997. In the absence of known inhibitors of EBNA-1, it was decided to deactivate this protein by heat treatment in order to test if the assay can distinguish between active and deactivated protein forms. This rapid test demonstrated that EBNA-1, preincubated at 95 °C during 30 min before the test, lost about 75% of its affinity to DNA (Figure 2B). Thus, the reported assay can discriminate between active and inactive forms of EBNA-1 in 65 min, while previously reported assays based on electrophoresis3 and immunoprecipitation7 required much more time.

relationship between the length of the scssDNA and the inhibition of thrombin activity was observed (R = 0.98).

Figure 1. ■, Calibration curve corresponding to the thrombin activity inhibition produced by scssDNA of different lengths. Δ, Thrombin activity inhibition produced by the 15 bp G-quadruplex, a specific aptamer for thrombin.

■

CONCLUSIONS The present work describes for the first time a homogeneous assay for the simple and rapid detection and quantification of active EBNA-1. The assay is based on the thrombin activity modulation by the EBNA-1 binding scssDNA, and the assay was successfully used to quantify up to 3.75 ng mL−1 of EBNA1 protein in model medium. As shown above, EBNA-1 could become one of the most attractive drug targets in the course of the discovery of antiEBV compounds. We believe that the described system can be used in the routine laboratory practice for rapid quantification of the active recombinant EBNA-1 protein utilized in research activities aimed to screen EBNA-1 blockers with therapeutic properties. On the other hand, our assay can also serve as a model for development of future assays for Epstein-Barr virus.

Those results suggest that thrombin activity inhibition by EBNA-1 binding scssDNA happens in a nonspecific way. Furthermore, to confirm those results, the effect of thrombin specific aptamer (Table 1, 15 bp Gquadruplex) on the activity of thrombin against rhodamine 110 derivative was also determined. As shown in Figure 1, no specific inhibition of thrombin activity was detected in the presence of the thrombin aptamer. The inhibition effect of the G-quadruplex DNA was similar to that demonstrated by the 15 bp scssDNA. Determination of EBNA-1 Concentration. The principle for the detection of EBNA-1 is shown in Scheme 1. The optimized homogeneous assay was applied to quantify EBNA-1 protein in the model medium. As shown in Figure 2A, an increase in the fluorescence intensity was observed during the experiment. The recorded intensity was directly related to the EBNA-1 concentration in the medium, and the higher intensity is related to the increase in the EBNA-1 concentration. This behavior suggests that, when EBNA-1 protein is present in the assay system, the specific interaction between scssDNA and EBNA-1 prevents the interaction between scssDNA and

■

AUTHOR INFORMATION

Corresponding Author

*Tel: (+34) 943005308. Fax: (+34) 943005314. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

Figure 2. (A) Evolution of fluorescence intensity after addition of different concentrations of EBNA-1 protein to thrombin-scssDNA conjugates: (a) 250 ng mL−1; (b) 125 ng mL−1; (c) 60 ng mL−1; (d) 30 ng mL−1; (e) 15 ng mL−1; (f) 3.75 ng L−1; (g) 0 ng mL−1. (B) (□) Linear relationship between thrombin activity and EBNA-1 concentration in the range of 250 to 3.75 ng mL−1; (●) DNA-binding activity of EBNA-1 after 30 min at 95 °C. 5836

dx.doi.org/10.1021/ac301250f | Anal. Chem. 2012, 84, 5834−5837

Analytical Chemistry

■

Letter

ACKNOWLEDGMENTS The present work was supported by the European Commission under the project Nanoantenna (FP7-HEALTH-F5-2009241818). V.P. acknowledges Ramon y Cajal contract from the Spanish Ministry of Science and Innovation.

■

REFERENCES

(1) Young, L. S.; Murray, P. G. Oncogene 2003, 22, 5108−5121. (2) Middeldorp, J. M.; Brink, A.A.T.P; van den Brule, A. J. C.; Meijer, C. J. L. M. Crit. Rev. Oncol. Hematol. 2003, 45, 1−36. (3) Ambinder, R. F.; Shah, W. A.; Rawlins, D. R.; Hayward, G. S.; Hayward, S. D. J. Virol. 1990, 64, 2369−2379. (4) Frappier, L.; O’Donnell, M. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 10875−10879. (5) Chaudhuri, B.; Xu, H.; Todorov, I.; Dutta, A.; Yates, J. L. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 10085−10089. (6) Wu, H.; Kapoor, P.; Frappier, L. J. Virol. 2002, 76, 2480−2490. (7) Canaan, A.; Haviv, I.; Urban, A. E.; Schulz, V. P.; Hartman, S.; Zhang, Z.; Palejev, D.; Deisseroth, A. B.; Lacy, J.; Snyder, M.; Gerstein, M.; Weissman, S. M. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 22421− 22426. (8) Wilson, J. B.; Bell, J. L.; Levine, A. J. EMBO J. 1996, 15, 3117− 3126. (9) Lu, J.; Murakami, M.; Verma, S. C.; Cai, Q.; Haldar, S.; Kaul, R.; Wasik, M. A.; Middeldorp, J.; Robertson, E. S. Virology 2011, 410, 64− 75. (10) Rishi, V.; Potter, T.; Laudeman, J. M.; Reinhart, R.; Silvers, T.; Selby, M.; Stevenson, T.; Krosky, P.; Stephen, A. G.; Acharya, A.; Moll, J.; Oh, W. J.; Scudiero, D.; Shoemaker, R. H.; Vinson, C. Anal. Biochem. 2005, 340, 259−271. (11) Kiessling, A.; Sperl, B.; Hollis, A.; Eick, D.; Berg, T. Chem. Biol. 2006, 13, 745−751. (12) Bowser, T. E.; Bartlett, V. J.; Grier, M. C.; Verma, A. K.; Warchol, T.; Levy, S. B.; Alekshun, M. N. Bioorg. Med. Chem. Lett. 2007, 17, 5652−5655. (13) Mao, C.; Patterson, N. M.; Cherian, M. T.; Aninye, I. O.; Zhang, C.; Montoya, J. B.; Cheng, J.; Putt, K. S.; Hergenrother, P. J.; Wilson, E. M.; Nardulli, A. M.; Nordeen, S. K.; Shapiro, D. J. J. Biol. Chem. 2008, 283, 12819−12830. (14) Li, N.; Thompson, S.; Schultz, D. C.; Zhu, W.; Jiang, H.; Luo, C.; Lieberman, P. M. PLoS One 2010, 5, e10126. (15) Rawlins, D. R.; Milman, G.; Hayward, S. D.; Hayward, G. S. Cell 1985, 42, 859−868. (16) Oddo, C.; Freire, E.; Frappier, L.; de Prat-Gay, G. J. Biol. Chem. 2006, 281, 26893−26903. (17) Zweig, S. E.; Meyer, B. G.; Sharma, S.; Min, C.; Krakower, J. M.; Shohet, S. B. Biomed. Instrum. Technol. 1996, 30, 245−256.

5837

dx.doi.org/10.1021/ac301250f | Anal. Chem. 2012, 84, 5834−5837