Article pubs.acs.org/JAFC
Cite This: J. Agric. Food Chem. 2018, 66, 1620−1628
Hordenine: A Novel Quorum Sensing Inhibitor and Antibiofilm Agent against Pseudomonas aeruginosa Jin-Wei Zhou,†,‡,§ Huai-Zhi Luo,†,‡,§ Huan Jiang,†,‡,§ Ting-Kun Jian,†,‡ Zi-Qian Chen,†,‡ and Ai-Qun Jia*,† †
State Key Laboratory of Marine Resource Utilization in South China Sea, Key Laboratory of Tropical Biological Resources of Ministry Education, Hainan University, Haikou 570228, China ‡ School of Environmental and Biological Engineering, Nanjing University of Science and Technology, Nanjing 210094, China ABSTRACT: The quorum sensing (QS) inhibitory activity of hordenine from sprouting barley against foodborne pathogen Pseudomonas aeruginosa was evaluated for the first time here. At concentrations ranging from 0.5 to 1.0 mg mL−1, hordenine inhibited the levels of acyl-homoserine lactones. The enhanced susceptibility of hordenine with netilmicin on P. aeruginosa PAO1 biofilm formation as well as their efficiency in disrupting preformed biofilms was also evaluated using scanning electron microscopy and confocal laser scanning microscopy (CLSM). Hordenine treatment inhibited the production of QS-related extracellular virulence factors of P. aeruginosa PAO1. Additionally, quantitative real-time polymerase chain reaction analysis demonstrated that the expressions of QS-related genes, lasI, lasR, rhlI, and rhlR, were significantly suppressed. Our results indicated that hordenine can serve as a competitive inhibitor for signaling molecules and act as a novel QS-based agent to defend against foodborne pathogens. KEYWORDS: hordenine, foodborne pathogen, Pseudomonas aeruginosa, quorum sensing, biofilm
■
INTRODUCTION Illness resulting from eating food contaminated with pathogens or the secreted toxins is a critical public health concern. In industrialized and developing countries, up to 10% of the population may experience foodborne disease annually.1 One of the most important factors contributing to such illness is antimicrobial resistance to antibiotics. In addition to health consequences, food spoilage due to foodborne pathogens can lead to considerable economic loss to both consumers and producers.2 Microbial spoilage leads to excessive food loss, even with modern food preservation techniques. A wide range of foodborne pathogens such as Salmonella spp., Pseudomonas spp., Bacillus spp., Yersinia enterocolitica, and Campylobacter jejuni can form biofilms.3 Biofilms have several advantages over free-living cells including resistance to antibiotics. Biofilms formed on food surfaces can result in contamination of products and shortened shelf life, leading to possible foodborne diseases.4 Food spoilage and infections due to foodborne pathogens are orchestrated processes regulated by quorum sensing (QS).5 The QS system is mediated by autoinducers (AIs), which are activated once their concentration of AIs reaches a certain threshold. The expressions of many genes are regulated by AIs receptors, which modulate a variety of physiological activities such as bioluminescence, biofilm formation, and virulence.6 AIs were identified as oligopeptides and acylated homoserine lactones (AHLs) in Gram-positive and Gram-negative bacteria, respectively. Pseudomonas aeruginosa, a well-documented Gram-negative and notoriously resistant bacterium, can cause a wide range of illnesses and food spoilage.7 This bacterium has two QS systems, that is, las and rhl, which modulate the synthesis of AIs N-(3oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL) and N-butanoyl-L-homoserine lactone (C4-HSL), respectively. The chemical signaling networks are hierarchically arranged, with rhl © 2018 American Chemical Society
modulated by las. Additionally, P. aeruginosa also possesses a novel molecule quinolone signal (PQS), which provides links between las and rhl. QS signals can be adopted by P. aeruginosa directly for modulating the formation of biofilms and the secretion of virulence factors such as exotoxins, pyocyanin, and alginate.8 As QS is vital in food spoilage and bacterial pathogenesis, interfering with the QS networks could be a useful strategy for preventing food spoilage and human infections.9 Many synthetic and natural compounds are capable of blocking QS systems in P. aeruginosa.10−12 However, the limited implication of these compounds in food sectors and mammalian cells has led to the search for novel natural QS inhibitors with broad applications.9 Hordenine, a dietary phenolic phytochemical from sprouting barley, has traditionally been used as vasoconstrictive and indirectly acting adrenergic agents;13 however, no studies on its anti-QS activity have yet been reported. Here, hordenine was investigated as a novel QS inhibitor, antibiofilm agent, and aminoglycoside antibiotic-accelerant against P. aeruginosa.
■
MATERIALS AND METHODS
Strains and Growth Conditions. Wild type P. aeruginosa PAO1 was obtained from Q. Gong (Ocean University of China). All experiments were performed in Luria−Bertani medium (LB) at 37 °C unless otherwise specified. Determination of Minimum Inhibitory Concentration (MIC) of Hordenine. Hordenine (purity >97%) purified from sprouting barley extract was purchased from Nanjing Jingzhu Biotech (Nanjing, China). Stock solutions were prepared by dissolving hordenine in dimethyl sulfoxide (DMSO). The Clinical and Laboratory Standards Received: Revised: Accepted: Published: 1620
October 31, 2017 December 17, 2017 January 13, 2018 January 21, 2018 DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry Institute (CLSI, 2015) was adopted for the determination of MIC of hordenine with an inoculum of 1−5 × 105 CFU mL−1. Hordenine (0.16−10 mg mL−1) was serially diluted two-fold in Müller-Hinton broth. The MIC was the lowest concentration of hordenine that inhibited visible growth of P. aeruginosa. For growth measurement, 0.1% overnight cultures of P. aeruginosa PAO1 (OD620 = 0.5) were added to LB and then with hordenine (0.5, 0.75, and 1.0 mg mL−1). The same amount of DMSO served as the negative control. After cultivation at 37 °C for 24 h, growth was determined using a microplate reader at 620 nm (Biotek Elx800, USA). Determination of AHLs Levels. The putative anti-QS capacity of hordenine was assessed by quantitating C4-HSL and 3-oxo-C12-HSL levels secreted by this strain. Briefly, 0.1% overnight cultures of P. aeruginosa PAO1 were inoculated into 50 mL of LB in the presence or absence of hordenine and cultured at 37 °C for 48 h. The same amount of DMSO was added as the negative control. After cultivation, cells were removed by 15 min centrifugation (4 °C). The supernatant was extracted three times using acidified ethyl acetate (1:1, v/v). The solvent was evaporated under reduced pressure and residues were dissolved in methanol. Liquid chromatography−tandem mass spectrometry (LC−MS/MS) was adopted for AHLs quantification.14 Briefly, peaks corresponding to C4-HSL and 3-oxo-C12-HSL were detected based on their MS/MS fragment ions and the retention time of AHLs standards. We selected the ion m/z 102 for quantification on account of its specificity and better signal-to-noise ratio. Peak area calculation was performed by the extracted ion chromatograms. Results were normalized to the DMSO control for relative quantification. Biofilm Inhibition Assay. The static biofilm inhibition assay was performed in 96-well flat-bottom polystyrene plates (Costar 3599, Corning, USA) as described previously with some modifications.15 Briefly, overnight cultures of P. aeruginosa PAO1 (OD620 = 0.5) were diluted 1:100 into 200 μL of trypticase soytone broth (TSB, 1.7% tryptone, 0.3% soy protone, 0.25% glucose, 0.5% NaCl, 0.25% KH2PO4) and then cultivated with hordenine at 37 °C for 24 h without agitation. After cultivation, planktonic cells were removed, and biofilms were stained with crystal violet (0.05%) for 15 min. Excess crystal violet was rinsed off by distilled water and bound crystal violet was solubilized in 200 μL of 95% ethanol. Biofilms were quantified by reading the microplates at 570 nm (Biotek Elx800, USA). For determination of the enhanced effect of hordenine on biofilm formation with the addition of netilmicin (Sangon Biotech, China), 0.1% overnight cultures of P. aeruginosa PAO1 (OD620 = 0.5) were added to 200 μL of TSB in 96-well flat-bottom polystyrene plates containing netilmicin (0.4 μg mL−1) and hordenine. After cultivation at 37 °C for 24 h, biofilms were quantified using the method above. To assess planktonic cell survival, the suspension cultures (100 μL) were centrifuged at 5000 rpm at 4 °C with the pellets then resuspended in 1 mL of 0.9% NaCl and 10-fold serially diluted. The number of surviving cells was determined by plating the dilutions (100 μL) at 37 °C overnight. Inhibition of Preformed Biofilms. P. aeruginosa PAO1 biofilms were incubated as described above. Once biofilm formed, the suspension cultures were removed and wells were washed with sterile phosphate buffer saline (PBS, pH 7.2) three times to remove the planktonic cells. Fresh TSB medium, supplemented with hordenine, netilmicin (0.8 μg mL−1), or their combination, was added to the wells, with DMSO serving as the control. The cultures were cultivated at 37 °C for 72 h. Biofilms were fixed with methanol for 15 min, stained with 100 μL of 0.05% crystal violet for 15 min, washed three times to remove excess dye, and quantitated after solubilization of the dye with ethanol by reading the microplates at 570 nm (Biotek Elx800, USA). To quantify cell viability, the treated biofilms were washed with PBS three times, and the exopolysaccharides were digested with Dextranase (5 U, D8144-Sigma-Aldrich, USA) for 30 min at 37 °C; the biofilms were then sonicated for 30 s (37 Hz, KQ-250, Kunshan Ultrasonic Instruments Co., Ltd., China). The number of CFU/biofilm was investigated by plating the resulting dilutions on LB agar at 37 °C overnight.16 For viable colony counts of planktonic cells, the suspension cultures (100 μL) were centrifuged at 5000 rpm at 4 °C with the pellet then resuspended in 1 mL of 0.9% NaCl. P. aeruginosa PAO1 cells were
then serially diluted, and the number of CFU per mL of cultures was calculated by plating the resulting dilutions on LB agar at 37 °C overnight. Microscopic Analysis. For inhibition assay, biofilms were established in 24-well chambered cover slides (Costar 3524, Corning, USA) and treated with hordenine, netilmicin, or their combination, as described above. Biofilms on the slides were washed with PBS, dried at 60 °C, and then stained with 0.01% acridine orange and observed using a fluorescence microscope (Nikon 80i, Japan). For scanning electron microscopy (SEM), biofilms were fixed with 2.5% glutaraldehyde and dehydrated with graded ethanol. Biofilms were subsequently freeze-dried, gold-coated, and subjected to SEM (JSM6360, JEOL, Tokyo, Japan). For visual observation of the preformed biofilms, samples were captured using both SEM and confocal laser scanning microscopy (CLSM, Zeiss LSM 700, Carl Zeiss, Jena). Briefly, preformed biofilms were established in 24-well chambered cover slides and treated with hordenine, netilmicin, or their combination as in the preformed biofilm inhibition assay. Biofilms on the slides were rinsed three times with PBS. Samples for SEM observation were prepared according to the method mentioned above. For CLSM imaging, acridine orange staining was performed. Briefly, samples were stained with acridine orange for 15 min and then fixed with paraformaldehyde (4%) in the dark for 15 min. Excess dye was removed with PBS, and confocal images of the stained biofilm cells were captured using a ×63/1.4 numerical aperture (NA) oil objective. Three-dimensional reconstructions were obtained adopting the IMARIS software package (Bitplane AG, Zürich, Switzerland). Effect of Hordenine on P. aeruginosa Virulence Factors. The QS inhibitor resveratrol (1.0 mg mL−1) served as the positive control and DMSO served as the negative control. Protease activity was measured as described previously,17 with some modifications. Briefly, sterile supernatant (150 μL) was mixed with 0.3% azocasein (250 μL, Sangon Biotech, China) in 50 mM Tris-HCl. The mixture was incubated at 37 °C for 4 h. Trichloroacetic acid (10%) with the volume of 1.2 mL was added to precipitate the undigested substrate for 20 min, followed by a 10 min centrifugation. Subsequently, the same volume of NaOH (1M) was added to the supernatant. Protease activity was determined at OD440. Elastase activity was determined according to Ohman et al.18 In brief, sterile supernatant (100 μL) was mixed with elastin Congo red (ECR) buffer (900 μL, 1 mM CaCl2, 100 mM Tris, pH 7.5) containing 20 mg of ECR and incubated at 37 °C for 3 h. After 10 min centrifugation at 37 °C, the absorbance of the supernatant was determined at 495 nm. Pyocyanin was determined according to Kumar et al.19 The culture supernatant was extracted with chloroform (5/3, v/v). The organic phase was mixed with 1 mL of hydrochloric acid (0.2 M). After 10 min centrifugation at 4 °C, the organic phase was collected, and its absorption was measured at 520 nm. Rhamnolipids were assessed using the orcinol method.20 Briefly, 300 μL of culture supernatant was extracted twice with 600 μL of diethyl ether. The ether layer was evaporated at 35 °C under reduced pressure, and residuals were dissolved in 100 μL of deionized water. A total of 900 μL of orcinol solution (0.19% orcinol in 53% [v/v] H2SO4, Sigma-Aldrich, USA) was mixed with 100 μL of each sample.
Table 1. PCR Primers for qRT-PCR gene lasI lasR rhlI rhlR rpsL
1621
primer direction
sequence (5′−3′)
forward reverse forward reverse forward reverse forward reverse forward reverse
GGCTGGGACGTTAGTGTCAT AAAACCTGGGCTTCAGGAGT ACGCTCAAGTGGAAAATTGG TCGTAGTCCTGGCTGTCCTT AAGGACGTCTTCGCCTACCT GCAGGCTGGACCAGAATATC CATCCGATGCTGATGTCCAACC ATGATGGCGATTTCCCCGGAAC GCAACTATCAACCAGCTGGTG GCTGTGCTCTTGCAGGTTGTG
amplicon size (bp) 104 111 130 101 231
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry
For assaying alginate generation, 70 μL of sterile supernatant was mixed with 600 μL of boric acid/H2SO4 (4:1, v/v). After vortexing, 20 μL of 0.2% carbazole solution was added to the mixture, which was then incubated at 55 °C for 30 min. Alginate production was measured by reading OD530.21 For pyoverdine assay, sterile supernatant was 10-fold diluted in TrisHCl buffer (pH 7.4). Pyoverdine production was measured by reading OD405. Motility Inhibition Assays. Swimming and swarming motilities were performed as previously described,21 with minor modification. Briefly, 2 μL of overnight P. aeruginosa PAO1 cultures (OD620 = 0.5) were inoculated with hordenine at the center of the swimming agar (1% tryptone, 0.5% NaCl, 0.3% agar, pH 7.2) and swarming agar medium (1% tryptone, 0.5% NaCl, 0.5% glucose, 0.3% agar, pH 7.2), respectively. Resveratrol (1.0 mg mL−1) and DMSO served as the positive and negative control, respectively. Plates were cultivated at 37 °C overnight, and migration was then recorded. Quantitative Real-Time PCR. P. aeruginosa PAO1 was grown in LB medium supplemented with or without hordenine (1.0 mg mL−1) at 37 °C at 180 rpm for 24 h. After incubation, cells were washed with sterile PBS (pH 7.2) three times and collected after 10 min centrifugation at 4 °C. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the Applied Biosystems 7300 Realtime PCR System with primers listed in Table 1. Total RNA was extracted using an RNA extraction kit (Tiangen Biotech, Beijing, China). Genomic DNA was removed using the gDNA wiper mix and first-strand complementary DNA (cDNA) was synthesized using the HiScript II qRT Supermix (Vazyme Biotech, Nanjing, China) according to the manufacturer’s recommendations. The qRT-PCR was performed using a SYBR Green Master Mix kit (Vazyme Biotech, Nanjing, China). The ribosomal gene rpsL was used as an internal control, and the fold changes of the target genes were determined using the 2−△△Ct method, as previously described.22
Figure 1. (A) Chemical structure of hordenine and (B) effect of hordenine on P. aeruginosa PAO1 growth. Growth was determined at different concentrations of hordenine (0.5, 0.75, and 1 mg mL−1) for 24 h in a tube. DMSO served as the negative control. Error bars demonstrated the standard deviations of three measurements. After 30 min heating at 80 °C, the cooled samples were then determined at 421 nm.
Figure 2. Relative quantification of C4-HSL and 3-oxo-C12-HSL using LC−MS/MS chromatograms. (A) MS/MS spectra of C4-HSL and 3-oxoC12-HSL. (B) HPLC chromatograms of C4-HSL and 3-oxo-C12-HSL produced by P. aeruginosa supplemented with (c) DMSO and (d−f) hordenine (0.5, 0.75, and 1.0 mg mL−1). (a, b) Standards of C4-HSL and 3-oxo-C12-HSL. (C) Quantitative analysis of C4-HSL treated with 0.5 to 1.0 mg mL−1 of hordenine. (D) Quantitative analysis of 3-oxo-C12-HSL treated with 0.5 to 1.0 mg mL−1 of hordenine. Error bars are the standard deviations of three measurements. Statistical differences were determined by ANOVA followed by Tukey-Kramer test. ∗∗, p < 0.01 versus DMSO control. ∗∗∗, p < 0.001 versus DMSO control. 1622
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry Statistical Analysis. All assays were performed at least three times, and data were expressed as means ± standard deviation (SD). Graphs were constructed using Origin 8.6 software (OriginLab, Northampton, MA, USA). One-way analysis of variance (ANOVA) was performed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA) for comparing differences between groups, followed by the Tukey-Kramer test. A P value ≤ 0.05 was considered statistically significant.
hordenine treatment and the control for 3-oxo-C12-HSL with the inhibitory rate varying from 24% to 66% (Figure 2D). These data demonstrated that hordenine possesses anti-QS capacity,which might be caused by interfering with the production of AHLs. Inhibition of Biofilm Formation. The inhibitory effect of hordenine on P. aeruginosa PAO1 biofilm formation was presented in Figure 3. Treatment with hordenine at concentrations of 0.75 and 1.0 mg mL−1 significantly reduced the formation of biofilms by 26% and 31%, respectively (Figure 3A). After hordenine treatment, planktonic cell survival was also determined. Results showed that hordenine treatment (0.5 to 1.0 mg mL−1) had no effect on the viability of planktonic cells compared with that of the control (Figure 3B). To evaluate whether hordenine increased the susceptibility of antibiotics against biofilms, biofilms were treated with hordenine and netilmicin for 24 h. Results indicated that hordenine significantly enhanced the effect of netilmicin on P. aeruginosa PAO1 biofilms in a concentration-dependent manner (Figure 3A). At concentrations of 0.5, 0.75, and 1.0 mg mL−1, hordenine reduced biofilms by approximately 35%, 52%, and 88%, respectively, with the addition of 0.4 μg mL−1 of netilmicin (MIC, 1.0 μg mL−1). When used alone, netilmicin resulted in a minor reduction in the biofilms (P > 0.05). Cell survival determination indicated that hordenine (0.5 and 0.75 mg mL−1) coupled with netilmicin had no effect on the viability of planktonic cells, though at 1.0 mg mL−1, planktonic cells were reduced by 10% (Figure 3B). In view of the promising antibiofilm capacities of hordenine with netilmicin, biofilms were stained with acridine orange and observed under a fluorescence microscope. Hordenine treatment showed significant biofilm reduction, as indicated by the green
■
RESULTS Determination of MIC of Hordenine. The chemical structure of hordenine is presented in Figure 1A. The MIC of hordenine was evaluated by doubling dilution assay with concentrations ranging from 0.625 to 10 mg mL−1. The MIC of hordenine was 2.5 mg mL−1. The growth profile was determined using hordenine at sub-MIC concentrations for 24 h (Figure 1B). Treatment with hordenine at concentrations varying from 0.5 to 1.0 mg mL−1 showed no inhibitory effect on cell growth compared with the control. Effect of Hordenine on AHLs Levels. The levels of AHLs produced by P. aeruginosa PAO1 were quantified to evaluate the putative anti-QS activity of hordenine. LC−MS/MS analysis confirmed that two major AHLs, that is, C4-HSL and 3-oxo-C12-HSL, were detected in the culture supernatants (Figure 2A). Exposure to hordenine (0.5, 0.75, and 1.0 mg mL−1) for 24 h caused a significant decrease in both peaks and areas of C4-HSL and 3-oxo-C12-HSL (Figure 2B). Relative quantification analysis demonstrated that hordenine treatment at 0.5, 0.75, and 1.0 mg mL−1 reduced C4-HSL by approximately 69%, 74%, and 79%, respectively, compared with the control (Figure 2C). Additionally, a significant decrease was also observed between
Figure 3. Effect of hordenine coupled with netilmicin on biofilm formation. (A) Relative biofilm formation and (B) surviving planktonic cells in the culture supernatant treated with hordenine and netilmicin. (C) Fluorescence microscopy images and (D) SEM images of P. aeruginosa PAO1 biofilms treated with (a) DMSO, (b) netilmicin, (c−e) hordenine (0.5, 0.75, and 1.0 mg mL−1), (f) 0.5 mg mL−1 of hordenine with 0.4 μg mL−1 of netilmicin, (g) 0.75 mg mL−1 of hordenine with 0.4 μg mL−1 of netilmicin, and (h) 1.0 mg mL−1 of hordenine with 0.4 μg mL−1 of netilmicin. Statistical differences were determined by ANOVA followed by Tukey-Kramer test. ∗, p < 0.05 versus corresponding control. ∗∗, p < 0.01 versus corresponding control. ∗∗∗, p < 0.001 versus corresponding control. 1623
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry
Figure 4. Effect of hordenine and netilmicin on preformed biofilms. (A) Quantitative analysis of biofilm biomass. (B) Quantitative analysis of surviving cells in treated biofilms. (C) Quantitative analysis of surviving cells in culture supernatant. (D) SEM images and (E) CLSM images of P. aeruginosa PAO1 biofilms treated with (a) DMSO, (b) netilmicin, (c−e) hordenine (0.5, 0.75, and 1.0 mg mL−1), (f) 0.5 mg mL−1 of hordenine with 0.8 μg mL−1 of netilmicin, (g) 0.75 mg mL−1 of hordenine with 0.8 μg mL−1 of netilmicin, and (h) 1.0 mg mL−1 of hordenine with 0.8 μg mL−1 of netilmicin. Statistical differences were determined by ANOVA followed by Tukey-Kramer test. ∗, p < 0.05 versus corresponding control. ∗∗, p < 0.01 versus corresponding control. ∗∗∗, p < 0.001 versus corresponding control.
(Figure 4Dd,e). When hordenine and netilmicin were used in combination, only small cell clusters remained attached (Figure 4Df−h). The CLSM images also indicated reduced thickness in the hordenine-treated biofilms (Figure 4E). After hordenine treatment (0.75 and 1.0 mg mL−1), the thickness of biofilms was reduced from 20 to 16 μm. There was no pronounced reduction when netilmicin was tested individually (thickness, ≥ 20 μm). However, combined treatment showed major disruption to the biofilm architecture as well as reduced thickness (Figure 4Ef−h). Effect of Hordenine on Virulence Factors. As shown in Figure 5A, protease activity was significantly suppressed by hordenine treatment (0.5 to 1.0 mg mL−1). At 1.0 mg mL−1, approximately 61% inhibition of protease activity was observed. Resveratrol (1.0 mg mL−1), the positive control of this study and a documented QS inhibitor, also showed inhibition of protease by approximately 40% (Figure 5A) without affecting cell growth (data not shown). The inhibitory effect of hordenine on elastase activity was shown in Figure 5B. The reduction in elastase was concentration-dependent, with hordenine treatment causing a reduction in elastase of approximately 28%, 46%, and 65%, respectively, compared with the DMSO control. Resveratrol (1.0 mg mL−1) treatment resulted in a 30% inhibition of elastase activity. Different concentrations of hordenine were assessed against pyocyanin production. As shown in Figure 5C, a significant reduction in pyocyanin was detected after treatment with hordenine. At 0.5 mg mL−1, approximately 40% reduction in pyocyanin was detected, and at 1.0 mg mL−1, almost 80% inhibition was observed. When treated with resveratrol (1.0 mg mL−1), a
stained cells (Figure 3). In contrast, thickened biofilms were detected in the control group (Figure 3Ca). Under the combined treatment of hordenine and netilmicin, the antibiofilm capacity was significantly enhanced, resulting in rare cell clusters (Figure 3Cf−h). A similar result was also obtained with the SEM images, in which biofilms showed a scattered appearance in the presence of hordenine (Figure 3Dd,e). After combined treatment with hordenine and netilmicin, the integrity of the biofilms was disrupted and cells were scattered (Figure 3Df−h). Effect of Hordenine on Preformed Biofilms. As shown in Figure 4A, approximately 23% (P < 0.05) of biofilms were eradicated after treatment with hordenine at 1.0 mg mL−1. When used individually, netilmicin resulted in a minor reduction in the preformed biofilms (P > 0.05) (Figure 4A). However, hordenine significantly enhanced the effect of netilmicin on preformed biofilms in a concentration-dependent manner. Hordenine showed potent effects at 0.5, 0.75, and 1.0 mg mL−1, reducing the preformed biofilms by approximately 29%, 43%, and 63%, respectively, with the addition of 0.8 μg mL−1 of netilmicin. Cell viability of the treated biofilms further confirmed the enhanced effect mentioned above (Figure 4B). Cell survival indicated that hordenine (0.5 and 0.75 mg mL−1) with netilmicin showed no effect on the viability of planktonic cells in the culture supernatant, though 1.0 mg mL−1 of hordenine resulted in a 10% reduction in planktonic cells (Figure 4C). In addition to quantitative analysis, treated biofilms were also visualized using SEM and CLSM. The SEM images showed thick biofilms in the control experiment (Figure 4Da), whereas hordenine treatment at 0.75 and 1.0 mg mL−1 significantly removed the microbes attached to the glass surface 1624
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry
Figure 5. Effect of hordenine on virulence factors secreted by P. aeruginosa PAO1. Levels of virulence factors at varying hordenine concentrations (0.5, 0.75, and 1.0 mg mL−1) were evaluated. DMSO and resveratrol (RES, 1.0 mg mL−1) were used as the negative and positive controls, respectively. (A) Protease levels. (B) Elastase levels. (C) Pyocyanin levels. (D) Rhamnolipid levels. (E) Alginate levels. (F) Pyoverdine levels. (G, H) Swimming and swarming motilities, respectively, treated with (a) DMSO, (b) resveratrol (1.0 mg mL−1), and (c−e) hordenine (0.5, 0.75, and 1.0 mg mL−1). Statistical differences were determined by ANOVA followed by Tukey-Kramer test. ∗, p < 0.05 versus DMSO control. ∗∗, p < 0.01 versus DMSO control. ∗∗∗, p < 0.001 versus DMSO control.
hordenine treatment significantly reduced tendril formation and colony diameter (Figure 5H). An inhibitory effect of resveratrol (1.0 mg mL−1) was also observed on swimming and swarming motilities (Figure 5Gb,Hb), which showed similar effects as treated with 0.5 mg mL−1 of hordenine. Effect of Hordenine on QS-Related Gene Expression. qRT-PCR assay was performed to investigate the efficiency of hordenine on changes in the expressions of four QS-related genes, that is, lasI, lasR, rhlI, and rhlR, in P. aeruginosa PAO1. The most significant change was found for lasR, which was down-regulated in P. aeruginosa PAO1 by approximately 60% after exposure to 1.0 mg mL−1 of hordenine (Figure 6). Similarly, exposure to hordenine also caused a significant reduction in the expressions of lasI, rhlI, and rhlR (Figure 6).
40% reduction of pyocyanin was observed, showing similar activity as hordenine at 0.5 mg mL−1. Hordenine also showed a concentration-dependent reduction in the activities of rhamnolipid and alginate (Figure 5D,E). At 1.0 mg mL−1, hordenine inhibited the activities of rhamnolipid and alginate by 53% and 60%, respectively. Furthermore, pyoverdine production was significantly decreased after hordenine treatment compared with the control (Figure 5F) and was reduced by 65% at a concentration of 1.0 mg mL−1. Effect of Hordenine on Motilities. The swimming and swarming motilities grown with hordenine were evaluated (Figure 5G,H). The mean swimming diameter in the absence of hordenine was 28 mm (Figure 5Ga). Treatment with hordenine at concentrations varying from 0.5 to 1.0 mg mL−1, bacterial colony were formed with diameters not exceeding 13 mm (Figure 5Gb−d). Notably, the swimming diameter following 1.0 mg mL−1 hordenine treatment was just 5 mm, and the green color, which represents pyocyanin production, disappeared (Figure 5Gd). Additionally, in the swarming motility assay,
■
DISCUSSION Hordenine possesses diverse pharmaceutical effects including antibacterial properties,23 inhibition of monoamine oxidase B,24 1625
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry
antibiotics against P. aeruginosa. We therefore evaluated hordenine and antibiotic netilmicin against P. aeruginosa biofilms to determine whether hordenine could function as a potential antibiotic accelerant. Our results demonstrated that hordenine had the remarkable capacity to enhance the susceptibility of P. aeruginosa PAO1 biofilms to netilmicin. Netilmicin, an aminoglycoside antibiotic, is notable for its capacity to treat infections, particularly pulmonary infections in cystic fibrosis patients.31 Recently, P. aeruginosa has shown increased resistance to aminoglycoside antibiotics.32 Our results indicated that hordenine can enhance the effect of netilmicin against both biofilm formation and preformed biofilms. The prime mechanism of this combination might be the permeability of the bacteria to antibiotic entrance. Biofilms are multicellular threedimensional structures held together by an extracellular matrix. Alginate is a constituent of the matrix and displays a vital role in maintaining biofilm structure and preventing the entrance of antibiotics into bacterial cells. The suppressed production of alginate and loosed architecture and morphology of biofilms by hordenine, as observed through SEM and CLSM, ultimately resulted in the reduced antibiotic resistance of bacteria. The enhanced interaction between hordenine and netilmicin could enhance the efficacy and lifespan of antibiotics, reduce antibiotic dosages, and attenuate the emergence of resistant organisms. Extracellular virulence factors such as protease, pyocyanin, elastase, rhamnolipid, and pyoverdine are important indicators of QS operon in P. aeruginosa. Therefore, reduced levels of these factors are necessary to inhibit QS. Protease and elastase are essential for colonizing host tissues and are regulated by the las system.33 Pyocyanin and pyoverdine are important virulence factors for infection and biofilm formation and can chelate the bound iron from transferrin.17 Rhamnolipid, an important surfactant, is regulated by the rhl system and plays a vital role in surface motility and biofilm initiation.34 Motility (swimming and swarming) is associated with biofilm formation, virulence factor expression, and colonization, and plays a fundamental role in the pathogenesis of P. aeruginosa.35 Data from the present study showed that these factors were all reduced when treated with hordenine and hordenine was much more effective than the QS inhibitor resveratrol in inhibiting virulence factors of P. aeruginosa PAO1. These results correlated well with the QSrelated gene expressions, which confirmed the transcription level inhibition of virulence after hordenine treatment. There are two main mechanisms for QS inhibition, signal mimicry and signal degradation, which lead to the inhibition of downstream virulence and biofilm genes.36 The prominent reduction of AHLs after hordenine treatment indicated the possibility of QS suppression by the autoinducer degradation mechanism. These results are similar to those reported in previous research.37 Therefore, hordenine might act as an efficient and promising agent for combating foodborne pathogens.
Figure 6. Effect of hordenine at 1.0 mg mL−1 on the gene expressions of QS-related circuits in P. aeruginosa. ∗∗∗, p < 0.001 versus DMSO control.
and stimulation of gastrin release.25 However, hordenine as a QS inhibitor has not yet been reported. In this study, hordenine was evaluated for its potential to block QS-controlled phenotypes and biofilm formation in foodborne pathogen P. aeruginosa. The anti-QS potential of hordenine was initially screened by quantifying AHLs levels. Hordenine showed a concentration-dependent reduction in AHLs production, thus indicating potent anti-QS capacity. Hordenine also effectively reduced biofilm formation, virulence factors, and QS-related gene expression of P. aeruginosa PAO1. Biofilm formation by foodborne pathogens is one of the most notable aspects of their pathogenicity.9 As QS plays a vital role in biofilm formation by interfering with the QS system might be a preferable and convenient way to block biofilm formation. As AHLs can bind to receptor lasR or rhlR and subsequently activate the expressions of QS-related genes responsible for virulence production and biofilm formation, we first evaluated the effect of hordenine on AHLs production. Results showed that AHLs demonstrated a reduction of more than 65% when treated with 1.0 mg mL−1 of hordenine. We next employed qRT-PCR to evaluate the expressions of QS-related genes in P. aeruginosa PAO1. The expressions of lasI, lasR, rhlI, and rhlR were reduced by about 50% compared with that of the control. However, when treated with hordenine at 1.0 mg mL−1, biofilm formation and preformed biofilms were only reduced by ∼30% and ∼23%, respectively. The results from the biofilm assay did not well-correlated with the AHLs and QS-related gene expression results. The above data indicated that biofilm formation is a sophisticated process and is not regulated by QS alone. At present, the relationship between biofilm formation and QS has not been fully clarified.26 Studies have shown that P. aeruginosa cells lacking Las-QS can also form biofilms.27 Polysaccharides are essential for the formation of biofilms and are major components of biofilms in P. aeruginosa. The biofilm matrix polysaccharides are encoded by two loci, pel and psl. LasR- and RhlR-QS can affect the pel operon indirectly, with pel also regulated by another transcriptional regulator.28 The psl operon is mediated transcriptionally by RpoS and post-transcriptionally by RsmA.29 However, RsmA has been proven to negatively regulate lasI and rhlI translation.30 These results suggest that QS is a vital regulatory mechanism for biofilm formation, but not the only one. Given the vital role of QS in P. aeruginosa pathogenesis, the use of hordenine might restore or enhance the effectiveness of
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Phone: +86 25 84303216. Fax: +86 25 84303216. ORCID
Ai-Qun Jia: 0000-0002-8089-6200 Author Contributions §
J.W.Z., H.Z.L., and H.J. contributed equally to this work.
Notes
The authors declare no competing financial interest. 1626
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry
■
secondary metabolites from Ziziphus jujuba leaves used for infusion preparation. Food Chem. 2017, 230, 24−29. (16) Brackman, G.; Cos, P.; Maes, L.; Nelis, H. J.; Coenye, T. Quorum sensing inhibitors increase the susceptibility of bacterial biofilms to antibiotics in vitro and in vivo. Antimicrob. Agents Chemother. 2011, 55, 2655−61. (17) Wu, S.; Liu, G.; Jin, W.; Xiu, P.; Sun, C. Antibiofilm and antiInfection of a marine bacterial exopolysaccharide against Pseudomonas aeruginosa. Front. Microbiol. 2016, 7, 102. (18) Ohman, D.; Cryz, S.; Iglewski, B. Isolation and characterization of Pseudomonas aeruginosa PAO mutant that produces altered elastase. J. Bacteriol. 1980, 142, 836−842. (19) Vijendra Kumar, N.; Murthy, P. S.; Manjunatha, J.; Bettadaiah, B. Synthesis and quorum sensing inhibitory activity of key phenolic compounds of ginger and their derivatives. Food Chem. 2014, 159, 451−457. (20) Kim, H. S.; Lee, S. H.; Byun, Y.; Park, H. D. 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Sci. Rep. 2015, 5, 8656. (21) Packiavathy, I. A. S. V.; Priya, S.; Pandian, S. K.; Ravi, A. V. Inhibition of biofilm development of uropathogens by curcumin−an anti-quorum sensing agent from Curcuma longa. Food Chem. 2014, 148, 453−460. (22) Sarabhai, S.; Harjai, K.; Sharma, P.; Capalash, N. Ellagic acid derivatives from Terminalia chebula Retz. increase the susceptibility of Pseudomonas aeruginosa to stress by inhibiting polyphosphate kinase. J. Appl. Microbiol. 2015, 118, 817−825. (23) Rao, G. S. Identity of peyocactin, an antibiotic from peyote (Lophophora williamsii), and hordenine. J. Pharm. Pharmacol. 1970, 22, 544−545. (24) Barwell, C. J.; Basma, A. N.; Lafi, M. A.; Leake, L. D. Deamination of hordenine by monoamine oxidase and its action on vasa deferentia of the rat. J. Pharm. Pharmacol. 1989, 41, 421−3. (25) Yokoo, Y.; Kohda, H.; Kusumoto, A.; Naoki, H.; Matsumoto, N.; Amachi, T.; Suwa, Y.; Fukazawa, H.; Ishida, H.; Tsuji, K.; Nukaya, H. Isolation from beer and structural determination of a potent stimulant of gastrin release. Alcohol Alcohol. (Oxford, U. K.) 1999, 34, 161−8. (26) Ueda, A.; Wood, T. K. Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathog. 2009, 5, e1000483. (27) Davies, D. G.; Parsek, M. R.; Pearson, J. P.; Iglewski, B. H.; Costerton, J. T.; Greenberg, E. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 1998, 280, 295−298. (28) Sakuragi, Y.; Kolter, R. Quorum-sensing regulation of the biofilm matrix genes (pel) of Pseudomonas aeruginosa. J. Bacteriol. 2007, 189, 5383. (29) Irie, Y.; Starkey, M.; Edwards, A. N.; Wozniak, D. J.; Romeo, T.; Parsek, M. R. Pseudomonas aeruginosa biofilm matrix polysaccharide Psl is regulated transcriptionally by RpoS and post-transcriptionally by RsmA. Mol. Microbiol. 2010, 78, 158−172. (30) Pessi, G.; Williams, F.; Hindle, Z.; Heurlier, K.; Holden, M. T. G.; Camara, M.; Haas, D.; Williams, P. The global posttranscriptional regulator RsmA modulates production of virulence determinants and N-acylhomoserine lactones in Pseudomonas aeruginosa. J. Bacteriol. 2002, 184, 335−335. (31) Smyth, A. R.; Campbell, E. L. Prescribing practices for intravenous aminoglycosides in UK Cystic Fibrosis clinics: a questionnaire survey. J. Cystic Fibrosis 2015, 14, 160−160. (32) Prickett, M. H.; Hauser, A. R.; McColley, S. A.; Cullina, J.; Potter, E.; Powers, C.; Jain, M. Aminoglycoside resistance of Pseudomonas aeruginosa in cystic fibrosis results from convergent evolution in the mexZ gene. Thorax 2017, 72, 40−47. (33) Stehling, E. G.; Silveira, W. D.; Leite, D. S. Study of biological characteristics of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis and from patients with extra-pulmonary infections. Braz. J. Infect. Dis. 2008, 12, 86−8.
ACKNOWLEDGMENTS This work was supported by grants from the National Key Research and Development Program of China (2017YFD0201401), Natural Science Foundation of Jiangsu Province, China (BK20170859), Science and Technology Development Program of Modern Agriculture, Nanjing (201608052), Six talent peaks project in Jiangsu Province, Fundamental Research Funds for the Central Universities (30916011307), and National Natural Science Foundation of China (41766006, 31170131).
■
REFERENCES
(1) Sandri, I.; Zacaria, J.; Fracaro, F.; Delamare, A.; Echeverrigaray, S. Antimicrobial activity of the essential oils of Brazilian species of the genus Cunila against foodborne pathogens and spoiling bacteria. Food Chem. 2007, 103, 823−828. (2) Monente, C.; Bravo, J.; Vitas, A. I.; Arbillaga, L.; De Peña, M. P.; Cid, C. Coffee and spent coffee extracts protect against cell mutagens and inhibit growth of food-borne pathogen microorganisms. J. Funct. Foods 2015, 12, 365−374. (3) Bridier, A.; Sanchez-Vizuete, P.; Guilbaud, M.; Piard, J.-C.; Naïtali, M.; Briandet, R. Biofilm-associated persistence of food-borne pathogens. Food Microbiol. 2015, 45, 167−178. (4) Abdallah, M.; Khelissa, O.; Ibrahim, A.; Benoliel, C.; Heliot, L.; Dhulster, P.; Chihib, N.-E. Impact of growth temperature and surface type on the resistance of Pseudomonas aeruginosa and Staphylococcus aureus biofilms to disinfectants. Int. J. Food Microbiol. 2015, 214, 38− 47. (5) Rahman, M. R.; Lou, Z.; Yu, F.; Wang, P.; Wang, H. Anti-quorum sensing and anti-biofilm activity of Amomum tsaoko (Amommum tsaoko Crevost et Lemarie) on foodborne pathogens. Saudi J. Biol. Sci. 2017, 24, 324−330. (6) Wu, H.; Moser, C.; Wang, H.-Z.; Høiby, N.; Song, Z.-J. Strategies for combating bacterial biofilm infections. Int. J. Oral Sci. 2015, 7, 1. (7) Ivanovic, J.; Misic, D.; Zizovic, I.; Ristic, M. In vitro control of multiplication of some food-associated bacteria by thyme, rosemary and sage isolates. Food Control 2012, 25, 110−116. (8) Rutherford, S. T.; Bassler, B. L. Bacterial quorum sensing: its role in virulence and possibilities for its control. Cold Spring Harbor Perspect. Med. 2012, 2, a012427. (9) Gopu, V.; Meena, C. K.; Shetty, P. H. Quercetin influences quorum sensing in food borne bacteria: in-vitro and in-silico evidence. PLoS One 2015, 10, e0134684. (10) Figueroa, M.; Jarmusch, A. K.; Raja, H. A.; El-Elimat, T.; Kavanaugh, J. S.; Horswill, A. R.; Cooks, R. G.; Cech, N. B.; Oberlies, N. H. Polyhydroxyanthraquinones as quorum sensing inhibitors from the guttates of Penicillium restrictum and their analysis by desorption electrospray ionization mass spectrometry. J. Nat. Prod. 2014, 77, 1351−8. (11) Jakobsen, T. H.; van Gennip, M.; Phipps, R. K.; Shanmugham, M. S.; Christensen, L. D.; Alhede, M.; Skindersoe, M. E.; Rasmussen, T. B.; Friedrich, K.; Uthe, F.; et al. Ajoene, a sulfur-rich molecule from garlic, inhibits genes controlled by quorum sensing. Antimicrob. Agents Chemother. 2012, 56, 2314−2325. (12) O’Loughlin, C. T.; Miller, L. C.; Siryaporn, A.; Drescher, K.; Semmelhack, M. F.; Bassler, B. L. A quorum-sensing inhibitor blocks Pseudomonas aeruginosa virulence and biofilm formation. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 17981−6. (13) Hapke, H.; Strathmann, W. Pharmacological effects of hordenine. Deutsche tierarztliche Wochenschrift 1995, 102, 228−232. (14) Zhou, J.; Bi, S.; Chen, H.; Chen, T.; Yang, R.; Li, M.; Fu, Y.; Jia, A. Q. Anti-biofilm and antivirulence activities of metabolites from Plectosphaerella cucumerina against Pseudomonas aeruginosa. Front. Microbiol. 2017, 8, 769. (15) Damiano, S.; Forino, M.; De, A.; Vitali, L. A.; Lupidi, G.; Taglialatela-Scafati, O. Antioxidant and antibiofilm activities of 1627
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
Article
Journal of Agricultural and Food Chemistry (34) O’May, C.; Tufenkji, N. The swarming motility of Pseudomonas aeruginosa is blocked by cranberry proanthocyanidins and other tannin-containing materials. Appl. Environ. Microbiol. 2011, 77, 3061− 7. (35) Luo, J.; Kong, J. L.; Dong, B. Y.; Huang, H.; Wang, K.; Wu, L. H.; Hou, C. C.; Liang, Y.; Li, B.; Chen, Y. Q. Baicalein attenuates the quorum sensing-controlled virulence factors of Pseudomonas aeruginosa and relieves the inflammatory response in P. aeruginosa-infected macrophages by downregulating the MAPK and NFkappaB signaltransduction pathways. Drug Des., Dev. Ther. 2016, 10, 183−203. (36) Ni, N. T.; Li, M. Y.; Wang, J. F.; Wang, B. H. Inhibitors and antagonists of bacterial quorum sensing. Med. Res. Rev. 2009, 29, 65− 124. (37) Rathinam, P.; Vijay Kumar, H.; Viswanathan, P. Eugenol exhibits anti-virulence properties by competitively binding to quorum sensing receptors. Biofouling 2017, 33, 1−16.
1628
DOI: 10.1021/acs.jafc.7b05035 J. Agric. Food Chem. 2018, 66, 1620−1628
