Horizontal Transfer of PAH Catabolism Genes in - American Chemical

ARTICLE pubs.acs.org/est

Horizontal Transfer of PAH Catabolism Genes in Mycobacterium: Evidence from Comparative Genomics and Isolated Pyrene-Degrading Bacteria Jennifer M. DeBruyn,†,‡ Thomas J. Mead,‡ and Gary S. Sayler*,‡ † ‡

Department of Biosystems Engineering and Soil Science, The University of Tennessee, Knoxville, Tennessee, United States Center for Environmental Biotechnology, The University of Tennessee, Knoxville, Tennessee, United States

bS Supporting Information ABSTRACT: Biodegradation of high molecular weight polycyclic aromatic hydrocarbons (PAHs), such as pyrene and benzo[a]pyrene, has only been observed in a few genera, namely fast-growing Mycobacterium and Rhodococcus. In M. vanbaalenii PYR-1, multiple aromatic ring hydroxylating dioxygenase (ARHDOs) genes including pyrene dioxygenases nidAB and nidA3B3 are localized in one genomic region. Here we examine the homologous genomic regions in four other PAH-degrading Mycobacterium (strains JLS, KMS, and MCS, and M. gilvum PYR-GCK), presenting evidence for past horizontal gene transfer events. Seven distinct types of ARHDO genes are present in all five genomes, and display conserved syntenic architecture with respect to gene order, orientation, and association with other genes. Duplications and putative integrase and transposase genes suggest past gene shuffling. To corroborate these observations, pyrene-degrading strains were isolated from two PAH-contaminated sediments: Chattanooga Creek (Tennessee) and Lake Erie (western basin). Some were related to fast-growing Mycobacterium spp. and carried both nidA and nidA3 genes. Other isolates belonged to Microbacteriaceae and Intrasporangiaceae presenting the first evidence of pyrene degradation in these families. These isolates had nidA (and some, nidA3) genes that were homologous to Mycobacterial ARHDO genes, suggesting that horizontal gene transfer events have occurred.

’ INTRODUCTION High molecular weight polycyclic aromatic hydrocarbons (HMW PAHs), comprised of at least three fused aromatic rings, tend to be resistant to microbial biodegradation and recalcitrant in soils and sediments.1 This is of concern because of their documented toxicity, mutagenicity, carcinogenicity, and association with inflammatory vascular responses.2 Several microorganisms have, however, been identified that can use HMW PAHs as sole carbon sources. Many of these were fast-growing members of genus Mycobacterium,3 isolated from both contaminated and uncontaminated freshwater sediments at geographically disparate locations.4
7 M. vanbaalenii PYR-1 is currently the best characterized species in terms of genetics and biochemistry of HMW PAH degradation.8
11 The primary PAH catabolic degradation pathway in aerobic bacteria involves an initial dihydroxylation of the aromatic ring, followed by subsequent ring cleavage. Molecular methods probing biodegradative populations and organisms often target the α-subunits of the terminal aromatic ring hydroxylating dioxygenases (ARHDOs), as these Rieske center-containing enzymes are responsible for initial dihydroxylation and therefore convey specificity for particular PAH substrates. In Mycobacterium, nidA encodes the α-subunit of an ARHDO that adds hydroxyl groups at C-4 and C-5 positions of pyrene,10 and has been employed as a r 2011 American Chemical Society

biomarker to identify and track pyrene-degrading Mycobacterium populations.12
15 More recently, an alternate dioxygenase, NidA3B3, has been identified in Mycobacterium vanbaalenii PYR-1,11 which catalyzes the initial dihydroxylation step in an alternate detoxification pathway.8 The genome of M. vanbaalenii PYR-1 has been well characterized in terms of PAH-degradative genes:9,16 PAH metabolic pathways have been reconstructed and a number of paralogous ARHDOs involved in pyrene and phenanthrene degradation have been identified.16 Genome sequences of four other HMW PAH-degrading Mycobacterium spp. have also been completed (M. gilvum PYR-GCK, M. sp. JLS, MCS, and KMS), allowing us to test the hypothesis that the genomic architecture and homologous ARHDOs are conserved across these species revealing evidence regarding the evolutionary history of these catabolic regions. Horizontal gene transfer (HGT) is an important process in adaptation and evolution of microbial communities and has, in Special Issue: Ecogenomics: Environmental Received: May 11, 2011 Accepted: September 6, 2011 Revised: August 26, 2011 Published: September 07, 2011 99

dx.doi.org/10.1021/es201607y | Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

Table 1. Genomic Characteristics of Five Pyrene-Degrading Mycobacterium spp. Analyzed in This Studya NCBI organism

isolated from

chromosome/plasmid

no. of

accession

size (kb)

GC

genes

nidA

nidA3

Mycobacterium vanbaalenii PYR-1

sediment below oil field, Texas

chromosome

NC_008726

6,491

67%

5979

+

+

Mycobacterium gilvum PYR-GCK

Grand Calmut River sediment, Indiana

chromosome

NC_009338

5,619

67%

5241

++

++

plasmid pMFLV03

NC_009339

16

65%

16

plasmid pMFLV02

NC_009340

25

64%

24

plasmid pMFLV01

NC_009341

321

65%

298

Mycobacterium sp. JLS

PAH-contaminated soil, Montana

chromosome

NC_009077

6,048

68%

5739

++

+

Mycobacterium sp. MCS

PAH-contaminated soil, Montana

chromosome plasmid 1

NC_008146 NC_008147

5,705 215

68% 66%

5391 224

+

+ +

Mycobacterium sp. KMS

PAH-contaminated soil, Montana

chromosome

NC_008705

5,737

68%

5460

+

+

plasmid pMKMS01

NC_008703

302

65%

283

+

+

plasmid pMKMS02

NC_008704

216

66%

232

+

a

Number of genes predicted by Integr8 (http://www.ebi.ac.uk/integr8). For two aromatic ring hydroxylating dioxygenases (nidA and nidA3) + = one copy of gene, ++ = 2 copies of gene.

particular, contributed to development of xenobiotic catabolism pathways.17,18 Therefore an understanding of the evolutionary processes shaping bacterial biodegradation phenotypes has important implications for understanding their adaptation to novel compounds as well as natural attenuation processes in contaminated environments. Here we present evidence that HGT has contributed to evolution of HMW PAH degradation gene cassettes in fast-growing Mycobacterium spp, conveying a HMW PAH biodegradative phenotype important in PAHcontaminated environments. This study combines comparative genomics of five PAHdegrading Mycobacterium spp. with cultivation of environmental strains to test the hypothesis that homologues of ARHDOs identified in Mycobacterium vanbaalenii PYR-19 are present in other species of HMW-PAH degrading organisms isolated from geographically disparate locations: Chattanooga Creek Superfund Site (Tennessee), heavily contaminated with coal tar (approximately 50
250 mg/kg total PAHs);13 and the western basin of Lake Erie (1.5
5.3 mg/kg total PAHs).19 Previous work using culture-independent molecular approaches has established the prevalence of fast growing Mycobacteria and nidA genotypes at both locations.12,13,15

model and neighbor-joining clustering method with bootstrap analysis in MEGA4.21 Enrichment and Isolation of Pyrene-Degrading Organisms from Contaminated Sediments. Sediments (top 5 cm) were collected from Chattanooga Creek in the summer of 2005 from site CF (100
200 mg/kg total PAHs).13 Sediments from monitoring station 357 in the western basin of Lake Erie were collected in August 2006 using a box core and subcored to collect the top 5 cm of sediments (2.59 mg/kg total PAHs).19 Five g of sediment was slurried with 10 mL of sterile H2O and 500 mg/L pyrene, and shaken at 30 °C. Aliquots from both enrichments were taken after 20, 30, and 60 days, diluted, and plated onto Basal Salts minimal media (BSM) plates that had been spray-coated with pyrene. After approximately 7
10 days of incubation at 30 °C, colonies which produced a zone of clearing in the pyrene layer were transferred to LB agar plates for further analysis. Single colonies were picked off of the LB plate and transferred back to another pyrene-coated BSM plate to confirm degradation. Isolates capable of pyrene degradation were grown in liquid LB at 30 °C for staining, imaging, and DNA extraction. Acid fast staining of isolates was done using the Ziehl
Neelsen (hot) method. Isolates were imaged using scanning electron microscopy (SEM). Cells were fixed in phosphatebuffered 3% gluteraldehyde for 60 min, rinsed, then postfixed in phosphate-buffered 2% osmium tetroxide for 60 min. Cells were washed in water, allowed to settle onto a silicon chip (Ted Pella), then dehydrated in a graded ethanol series and a LADD critical point dryer. Prior to examination cells were sputter coated with gold in an SPI sputter coater. Cells were examined in a Zeiss 1525 scanning electron microscope operating at 3 KV. Images were recorded digitally. Genomic DNA was extracted using a Wizard Genomic DNA kit (Promega) using the manufacturer’s protocol for gram positive bacteria. Isolates were screened for nidA genes (ARHDO type B) using primers targeting a conserved 141 bp region of nidA (nidAfw and nidArv13) and the following PCR conditions: 95 °C for 5 min, then 40 cycles of 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min, followed by a 10-min final extension at 72 °C. M. flavescens (ATCC 700033) genomic DNA was used as a positive control. Full nidA, nidA3, and 16S rRNA genes were PCR amplified using the same conditions as above

’ EXPERIMENTAL PROCEDURES Genomic Comparisons. Sequences for five species (Mycobacterium vanbaalenii PYR-1, M. gilvum PYR-GCK, and strains JLS, MCS, KMS) were produced by the U.S. Department of Energy Joint Genome Institute in collaboration with the user community; annotations were retrieved from the integrated microbial genomes (IMG) site (http://img.jgi.doe.gov). Physiological characteristics and in-depth phylogenetic comparisons of these species has been previously reported.7 Genomes were aligned using Mauve 2.3.0.20 The five genomes were searched for predicted aromatic ring hydroxylating dioxygenase (ARHDO) α subunits genes. Homologues of these features were identified using BLASTClust (http://toolkit.tuebingen.mpg.de/blastclust) set at 50% identity. Clusters of homologous proteins were arbitrarily designated a Type letter (Type A
G) to allow us to distinguish orthologs between species. Phylogenetic trees were built based on amino acid sequence alignments using a Kimura 2-parameter distance 100

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

Figure 1. Catabolic regions of Mycobacterium genomes, encoded on chromosomes (top five) and plasmid (bottom three, denoted by *). (A) Seven homologous ARHDO types (A
G) are in blue. Other types of functional gene categories include dehydrogenases (yellow), ferredoxin/oxidoreductase (black), mobile elements (integrases and transposases) (pink), mammalian cell entry (mce) elements (light green), transporters (dark green), transcriptional regulators (purple), other genes/unknown functions (white), and hypothetical proteins (gray). Boxes indicate locally collinear blocks (LCB; i.e., regions without significant rearrangement among species). (B) Simplified schematic comparing patterns of LCBs, mobile genetic elements elements (pink) and mce elements (light green). A
G refer to dioxygenase types found in each LCB. Upside-down letters indicate genes encoded on the opposite strand. Chromosomes: Mycobacterium vanbaalenii (Mvan), M. spp. JLS, KMS, MCS (MJLS, MKMS, MMCS) and M. gilvum PYR-GCK. Plasmids: Two plasmids of M. sp. KMS (MKMSp01 and MKMSp02) and one of M. sp. MCS (MMCSp01).

with the following primers: nidAfullfw (50 -ATGACCACCGAAACAACCG) and nidAfullrv (50 - TCAAGCACGCCCGCCGA) primers amplified most of the nidA genes (approximately 1365 bp); nidA3fw (50 - CCTGATGCGACGACAATG) and nidA3rv (50 - TCATACGTTCTCATCCCTTCTC) amplified most of the nidA3 genes (ARHDO type D, approximately 1392 bp); and universal bacterial 16S rRNA gene primers 8F and 1392R.22 PCR products were cloned into PCR4 sequencing vector using a TOPO TA kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol and sequenced on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) at the Molecular Biology Resource Facility, University of Tennessee (Knoxville, TN). Alignments and phylogenetic trees were done using MEGA4.21 Pulsed field gel electrophoresis was done on undigested genomic DNA to determine if the isolates carried large plasmids using a previously described method.23 Briefly, cells grown in liquid culture were washed in 1% Triton X-100, embedded in 2% SeaKem Gold low melting temperature agarose, and lysed in a solution of 0.5 M EDTA (pH 8.0), 0.5% Sarkosyl, 2 mg/mL of deoxycholic acid, and 3.33 mg/mL lysozyme for 18 h at 37 °C. Plugs were washed, and incubated in 0.5 M EDTA (pH 8.0), 0.5% Sarkosyl, and 1 mg/mL of proteinase K for 7 days at 50 °C. After washing in TE, plugs were inserted into a 1% agarose gel and run on a CHEF DRII system (BioRad).

dioxygenases (ARHDOs), however they differ in copy numbers and localization (chromosome and plasmid). Previous analysis of chromosome restriction patterns and sequencing have revealed evolutionary relationships among these five strains.7 Here, we focused on genomic regions enriched in genes encoding enzymes in the high molecular weight polycyclic aromatic hydrocarbons (PAHs) degradation upper pathway. This region has been examined in M. vanbaalenii,9 but not in the other four. These regions enriched in PAH-catabolism genes are shown in Figure 1A and B. For JLS, KMS, and MCS, regions range from 75 to 78 kb in length; in PYR-GCK, it consists of two duplicated 80 kb regions. In M. vanbaalenii it is approximately 133 kb due to inserted genes not present in the other four, including DNA mobility, transport, and hypothetical genes. Catabolic regions on KMS plasmids are 47 and 32 kb; MCS is 29 kb. A Mauve alignment of the genomes reveals that these ARHDO geneenriched regions are homologous (Figure S1 in the Supporting Information). This is in concordance with the observation by Miller et al.7 that the nidB promoter and gene (encoding an ARHDO β subunit) display greater sequence similarity than phylogenetic markers (16S rRNA genes and murA-16S intergenic sequence) suggesting a common evolutionary origin of the ARHDO-enriched region. The catabolic regions in these five Mycobacterium spp. have a consistently lower average %G + C compared to the overall nucleotide composition, ranging from 62% to 63% G + C, compared to whole genome average of 67% to 68% G + C (chromosomes) and 65% to 66% G + C (plasmids). These deviations in GC content are apparent in plots of whole genome GC% (Figure S2) and may be indicative of acquisition of genes from other organisms. The support vector machine method for prediction of horizontal gene transfer has been applied to strain MCS24 and indicates a high probability of horizontal transfer of this region

’ RESULTS AND DISCUSSION Homology of Genomic Regions. Characteristics of five species of fast-growing, pyrene-degrading Mycobacterium (strains KMS, MCS, JLS, M. gilvum PYR-GCK, and M. vanbaalenii PYR-1) are shown in Table 1. All have nidA and nidA3 genes, encoding previously characterized aromatic ring hydroxylating 101

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

Figure 2. Neighbor joining unrooted tree showing the phylogenetic relationships between α subunits of aromatic ring hydroxylating dioxygenases (ARHDOs) found in the catabolic regions of five genomes of Mycobacterium vanbaalenii PYR-1, M. spp. JLS, KMS, MCS, and PYR-GCK (Mvan, Mjls, Mkms, Mmcs, and Mflv, respectively) (black font), as well as those PCR-amplified from pyrene-degrading organisms isolated from Chattanooga Creek (2) and Lake Erie (b). Also included for reference (gray font) are other Mycobacterium spp. 6PY1, 65, CH2, M. gilvum, and M. fredricksbergense, Terrabacter spp. (Terr), Arthrobacter keyseri (Arth), Nocardioides KP7 (Nocar), and Rhodococcus spp. (Rhodo). Translated amino acid sequences (480 amino acids long) were used for the alignment. Homologous ARHDO types A
G are indicated and correspond to the genes labeled in Figure 1.

Mycobacterium spp. (Figure 1A) provides additional evidence for HGT in the evolution of HMW PAH degradation genes and pathways. Genes encoding the seven ARHDO types (A
G) are syntenic in all five genomes (i.e., same order and orientation) (Figure 1A, blue), with the exception of plasmid-localized type F genes (Figure 1A and B). The arrangement of α and ß ARHDO subunit genes is consistent between orthologs (e.g., nidB is always immediately upstream of nidA). Homology of both the types and order of these dioxygenases across species indicates that gene duplication within a genome (i.e., evolution of paralogs) occurred prior to horizontal transfer between species (i.e., evolution of orthologs). Gene duplication in Mycobacterium is not uncommon: in silico analysis of M. tuberculosis genome revealed that 52% of the proteins were derived from gene duplication events.27 In addition to ARHDO genes, other genes associated with PAH-degradation in these regions are also syntenic. In all five species, the requisite dehydrogenase (Figure 1A, yellow) and ferredoxin genes (Figure 1A, black) encoding electron transport chain components of ARHDOs are organized in a similar pattern, resulting in locally collinear blocks (LCBs), sometimes separated by DNA mobility genes (Figure 1B). The conserved gene order can also be observed in genome dot plots (Figure S3). In addition to upper pathway PAH catabolic genes, all five genomes have six mammalian cell entry (mce) genes

(analysis was not done for the other strains). The genomic island prediction software IslandPath25 also identifies this region as a likely genomic island acquired through horizontal gene transfer. These regions enriched in upper pathway HMW PAH degradation genes encode several ARHDO genes (Table S1), some of which have been shown to be involved in both pyrene and phenanthrene degradation in M. vanbaalenii.10,11,16 Others are identified on the basis of conserved Rieske iron
sulfur domains in predicted protein products. The phylogenetic relationship between ARHDO α subunits from these five genomes is shown in Figure 2, clearly indicating seven types of ARHDOs based on homology, hereforth referred to as types A
G. All five species have at least one gene copy of each type. Type B includes homologues of previously characterized NidA, PdoA1, and PdoA.6,10,26 Type D include NidA3 homologues.11 Type A are homologous to phthalate dioxygenase PhtAa in M. vanbaalenii PYR-1 which initiates phenanthrene degradation.16 Type G is most similar to PdoA2, a pyrene-induced ARHDO from Mycobacterium 6PY1 which preferentially uses phenanthrene as a substrate.26 Types A, B, D, and G are identified as paralogs, falling into the same NCBI protein cluster (ID 703843), and are more closely related than the other three types (Figure 2). Conserved Genomic Architecture. A closer examination of the arrangement of gene clusters in five pyrene-degrading 102

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

(Figure 1A and B, light green). mce homologues are widespread in the Mycobacterium genus, found in both pathogenic and nonpathogenic species. Their exact physiological roles are unknown, however they appear to be homologous to ABC transporter permeases: in M. tuberculosis, they are involved in importing host lipids and cholesterols;28 in Rhodococcus jostii RHA1, mce4 genes are part of a steroid transport system.29 The role of mce genes in these five pyrene-degrading strains, and their association (if any) with HMW PAH degradation genes is unclear. Mobility of Catabolic Regions. Other features of these catabolic regions suggest high mobility. First, these regions appear to have a concentration of mobile genetic elements (MGEs), including predicted transposase and phage integrase genes (Figure 1A and B, pink) associated with the HMW PAH degradation genes. This close association of catabolic genes with transposases and integrases has been observed for PAH and xenobiotic degradative genes in other species.16,30,31 There is evidence that some of these mobile catabolic elements can be transferred not only to closely related species, but also between genera: Pseudomonas catabolic plasmids were shown to have been conjugatively transferred to Stenotrophomonas sp.32 and other α, β, and γ proteobacteria.33 As additional evidence, both Alcaligenes and Pseudomonas strains have closely related 2,4-D biodegradative plasmids.34 In this study, it is of particular interest to note similarities between strain KMS plasmid pMKMS02 and plasmid1 of strain MCS: They have the same ARHDOs (D, E, F) in the same order, including the unique reverse orientation for F (Figure 1B), they are similar in size (216 kb and 215 kb, respectively), GC content (both 66%), and have a large number of homologous genes (Figure S4), implicating a shared evolutionary origin. Second, within these regions of the genome, there are groups of genes encoding ARHDOs and their associated enzymes (dehydrogenases, ferredoxin, etc.) that are syntenic (Figure 1A), These segments are LCBs (i.e., have no significant internal rearrangements) and their arrangement in each genome is displayed in Figure 1B. In some cases, these LCBs are separated by mobile genetic elements. B, C, D, and E type ARDHO genes all reside within the same segment on the chromosomes, however smaller portions of this segment appear duplicated in JLS and on the plasmids of KMS and MCS indicating that these small groups have moved independently of the others. The most varied arrangement is seen with the LCB containing type F ARDHO genes: it is upstream of the other blocks in KMS plasmid 1 and in reverse orientation in KMS plasmid 2 and the MCS plasmid. It should be noted that a few other ARHDO genes have been identified in the genomes outside of the regions examined here (Table S1); these all appear to be “orphan” dioxygenases, which exist in other parts of the genome and are not associated with other dioxygenases. Their dissimilarity and distance from the rest suggest that they likely have a unique evolutionary history from the A
G types examined here. The third piece of evidence for past mobility is that this region enriched in ARHDO genes has varied genomic positions. In two strains, portions of the ARHDO regions are located on plasmids (Figure 1A). In other strains, duplication has occurred: in strain JLS, only the B
C segment has been duplicated and is located further downstream. In M. gilvum, most of the cassette is duplicated (B
G), with both cassettes adjacent (Figure 1B). Duplication of the catabolic regions containing nidA (type B) has also been documented for M. strain S65.6 An examination of whole genome alignments (Figure S3) reveals that while gene

Figure 3. Neighbor joining tree of full length (ca. 1385 bp) 16S rRNA gene sequences showing the phylogenetic relationships between the pyrene-degrading isolates (py#). py114
py132 were isolated from Chattanooga Creek, and py136
py148 were isolated from Lake Erie. Isolates carrying nidA-like genes (ARHDO type B) are indicated by black circles; nidA3-like genes (ARHDO type D) are indicated by white diamonds. Brackets show families within order Actinomycetales. Characterized Actinomycete strains and accession numbers are included for reference with Bacillus subtilis as an outgroup. Bootstrap values (% of 1000 repetitions) over 50% are shown on branches.

order is conserved within these catabolic regions, their genomic position is not conserved between strains. The duplications and varied arrangements of plasmid genes suggests past intracellular rearrangement and/or multiple transfer and acquisition events. These have also been observed for biodegradative genes in other bacteria: naphthalene dioxygenase genes are chromosomally located in some strains and localized on plasmids in others.35 Integration of transmissible catabolic plasmids into genomes has been demonstrated in Alcaligenes paradoxus.34 Other Actinobacteria (Rhodococcus spp.) have also been observed to have numerous dioxygenase 103

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology genes, large plasmids, and a large genome prone to hyperrecombination, resulting in metabolic versatility.36 Isolated Pyrene-Degrading Organisms Belonging to Phylogenetically Disparate Families. To corroborate observations from comparative genomic analysis, pyrene-degrading organisms were isolated from two contaminated sediments: Chattanooga Creek (Tennessee) and Lake Erie (western basin). After at least a 20-day pyrene enrichment, colonies that could produce a clear zone in pyrene-coated minimal media plates were apparent, indicating localized metabolism of pyrene. Of the organisms that could degrade pyrene on minimal media plates, 17 (6 from Chattanooga Creek, 11 from Lake Erie) were selected for further characterization. Based on full-length 16S rRNA sequences, isolates were all classified as Phylum Actinobacteria, Order Actinomycetales (Table S2). Figure 3 shows phylogenetic relationships (based on full length 16S rRNA gene sequences) between the isolates and other characterized organisms. SEM images of three representative strains (one from each family) are given in the Supporting Information (Figure S5). Isolates from Lake Erie were all gram positive, acid-fast rods. Pulsed field gel electrophoresis (PFGE) analysis indicated they carried large (200
230 kb) plasmids (Figure S6). They were very closely related to other pyrene-degrading Mycobacterium spp. Their rod-shaped morphology was similar to other characterized pyrene-degrading Mycobacterium. Isolation of pyrenedegrading Mycobacteria from Lake Erie was not surprising in light of the previous detection of nidA and Mycobacterium 16S rRNA gene sequences from Lake Erie sediments.15 One isolate, py136, was most closely related to M. smegmatis (NCBI Accession CP000480) and M. moriokaense (NCBI Accession AB649000), which are also fast-growing species, but have not been previously associated with PAH degradation. The six Chattanooga Creek isolates were gram positive, nonacid-fast rods, which did not appear to carry any plasmids (none were visible on PFGE gel, Figure S6). They belonged to two different families in the order Actinomycetales: Isolates py114, py116, py120, and py122 were most closely related to Phycicoccus sp., family Intrasporangiaceae. py129 and py132 were most closely related to Leifsonia sp., family Microbacteriaceae (Figure 3). Xenobiotic degradation capabilities have been observed in other members of the family Intrasporangiaceae: Intrasporangium and Terrabacter spp. have been associated with PAH-degrading consortia,37,38 and Janibacter spp. have been demonstrated to use a variety of aromatic pollutants as carbon sources.39,40 Terrabacter spp. have dioxygenase genes similar to nidA3.4 However, this is the first report (to our knowledge) of Phycicoccus- and Leifsonia-like organisms degrading pyrene (i.e., using pyrene as a sole carbon source). PCR was used to determine whether these pyrene-degrading isolates carried nidA (ARHDO type B) or nidA3 (type D) genes, indicated in Figure 3. Sixteen of the 17 isolates had nidA genes, which had 98
99% nucleotide sequence identity to each other and to other type B ARHDOs (Figure 2). The Mycobacteriaceae isolates (py136
py148) all carried nidA3-like genes (ARHDO type D); only two of non-Mycobacterial isolates (py116 and py129) had nidA3. The nucleotide identity between nidA3 genes was 97
99% and they were highly similar to other type D ARHDOs (Figure 2). The disconnect between nidA and nidA3 (i.e., not all organisms with nidA also had nidA3) is consistent with the observation that genomic segments containing these ARHDOs are sometimes disconnected (i.e., duplicated region in JLS, and plasmids of KMS and MCS) and may have been

ARTICLE

transferred independently. This presence of Mycobacterial nidA and nidA3 genes in these bacteria belonging to Microbacteriaceae and Intrasporangiaceae (and the absence of these genes in other members of these families) is highly suggestive of a relatively recent horizontal gene transfer event. Here we have presented a combination of bioinformatic and biological evidence indicating that horizontal gene transfer likely played an important role in evolution of the genomic regions containing genes for degradation of high molecular weight PAHs (upper pathway). These regions contain genes encoding seven conserved ARHDO types. Homology, deviations in nucleotide composition, and conservation of genomic architecture suggest a common evolutionary origin for these regions. The concentration of mobile genetic elements and gene duplications indicates these were regions of past mobility. Although it is impossible to ascertain the exact moment of acquisition (i.e., lateral transfer among the five species examined versus acquisition by a common ancestor), the combined evidence strongly supports past horizontal gene transfer event(s). Isolation of phylogenetically disparate environmental strains that contain these conserved ARHDO genes is further evidence for HGT; this also presents the first report of pyrene degradation and pyrene dioxygenase genotypes (nidA and nidA3) in organisms similar to Phycicoccus and Leifsonia.

’ ASSOCIATED CONTENT

bS

Supporting Information. Mauve alignment of five Mycobacterium genomes (Figure S1). Plots showing %G + C content for each of the five genomes (Figure S2). Genome dot plot comparing Mycobacterium vanbaalenii and M. sp. MCS (Figure S3). Alignment of Mycobacterium sp. strain MCS plasmid1 and Mycobacterium sp. strain KMS plasmid pMKMS02 genes (Figure S4). SEM images of three pyrene-degrading bacterial isolates (Figure S5). PFGE gel images, showing the presence of ca. 200
230 bp plasmids in some of the isolates (Figure S6). List of predicted aromatic ring hydroxylating dioxygenases (ARHDOs) for each species, indicating the orthologous protein cluster and type to which each belongs (Table S1). Characteristics of pyrene-degrading isolates (Table S2). This material is available free of charge via the Internet at http://pubs. acs.org.

’ AUTHOR INFORMATION Corresponding Author

*Phone: 865-974-8080; fax: 865-974-8086; e-mail: sayler@utk. edu; mail: Center for Environmental Biotechnology, 676 Dabney Hall, 1414 Circle Drive, The University of Tennessee, Knoxville, Tennessee 37996.

’ ACKNOWLEDGMENT This work was supported by the Center for Environmental Biotechnology and Waste Management Research and Education Institute at the University of Tennessee. Special thanks to C. Chewning, J. Easter, D. Williams, and C. Lalande for assistance in sampling Chattanooga Creek. Lake Erie samples were graciously collected by S. W. Wilhelm, J. M. Rinta-Kanto, and the crew of the CCGS Limnos. DNA sequencing was done by J. May at the Molecular Biology Resource Facility at the University of 104

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

Tennessee. SEM images were taken by J. R. Dunlap at the Electron Microscopy Facility at the University of Tennessee.

(18) Juhas, M.; van der Meer, J. R.; Gaillard, M.; Harding, R. M.; Hood, D. W.; Crook, D. W. Genomic islands: Tools of bacterial horizontal gene transfer and evolution. FEMS Microbiol. Rev. 2009, 33 (2), 376–393. (19) Smirnov, A.; Abrajano, T. A.; Smirnov, A.; Stark, A. Distribution and sources of polycyclic aromatic hydrocarbons in the sediments of Lake Erie, - Part 1. Spatial distribution, transport, and deposition. Org. Geochem. 1998, 29 (5
7), 1813–1828. (20) Darling, A. C. E.; Mau, B.; Blatter, F. R.; Perna, N. T. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004, 14 (7), 1394–1403. (21) Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologistcentric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 2008, 9 (4), 299–306. (22) Lane, D. J.; Pace, B.; Olsen, G. J.; Stahl, D. A.; Sogin, M. L.; Pace, N. R. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci., U.S.A. 1985, 82 (20), 6955–6959. (23) Stinear, T. P.; Hong, H.; Frigui, W.; Pryor, M. J.; Brosch, R.; Garnier, T.; Leadlay, P. F.; Cole, S. T. Common evolutionary origin for the unstable virulence plasmid pMUM found in geographically diverse strains of Mycobacterium ulcerans. J. Bacteriol. 2005, 187 (5), 1668–1676. (24) Tsirigos, A.; Rigoutsos, I. A sensitive, support-vector-machine method for the detection of horizontal gene transfers in viral, archaeal and bacterial genomes. Nucleic Acids Res. 2005, 33 (12), 3699–3707. (25) Hsiao, W.; Wan, I.; Jones, S. J.; Brinkman, F. S. L. IslandPath: Aiding detection of genomic islands in prokaryotes. Bioinformatics 2003, 19 (3), 418–420. (26) Krivobok, S.; Kuony, S.; Meyer, C.; Louwagie, M.; Willison, J. C.; Jouanneau, Y. Identification of pyrene-induced proteins in Mycobacterium sp strain 6PY1: Evidence for two ring-hydroxylating dioxygenases. J. Bacteriol. 2003, 185 (13), 3828–3841. (27) Tekaia, F.; Gordon, S. V.; Garnier, T.; Brosch, R.; Barrell, B. G.; Cole, S. T. Analysis of the proteome of Mycobacterium tuberculosis in silico. Tubercule Lung Dis. 1999, 79 (6), 329–342. (28) Pandey, A. K.; Sassetti, C. M. Mycobacterial persistance requires the utilization of host cholesterol. Proc. Natl. Acad. Sci., U.S.A. 2008, 105 (11), 4376–4380. (29) Mohn, W. W.; van der Geize, R.; Stewart, G. R.; Okamoto, S.; Liu, J.; Dijkhuizen, L.; Eltis, L. D. The Actinobacterial mce4 Locus Encodes a Steroid Transporter. J. Biol. Chem. 2008, 283 (51), 35368–35374. (30) Yagi, J. M.; Sims, D.; Brettin, T.; Bruce, D.; Madsen, E. L. The genome of Polaromonas naphthalenivorans strain CJ2, isolated from coal tar-contaminated sediment, reveals physiological and metabolic versatility and evolution through extensive horizontal gene transfer. Environ. Microbiol. 2009, 11 (9), 2253–2270. (31) Nojiri, H.; Shintani, M.; Omori, T. Divergence of mobile genetic elements involved in the distribution of xenobiotic-catabolic capacity. Appl. Microbiol. Biotechnol. 2004, 64 (2), 154–174. (32) Shintani, M.; Fukushima, N.; Tezuka, M.; Yamane, H.; Nojiri, H. Conjugative transfer of the IncP-7 carbazole degradative plasmid, pCAR1, in river water samples. Biotechnol. Lett. 2007, 30 (1), 117–122. (33) Bathe, S.; Lebuhn, M.; Ellwart, J. W.; Wuertz, S.; Hausner, M. High phylogenetic diversity of transconjugants carrying plasmid pJP4 in an activated sludge-derived microbial community. FEMS Microbiol. Lett. 2004, 235 (2), 215–219. (34) Ka, J. O.; Tiedje, J. M. Integration and excision of a 2,4dichlorophenoxyacetic acid degradative plasmid in Alcaligenes paradoxus and evidence of its natural intergenic transfer. J. Bacteriol. 1994, 176 (17), 5284–5289. (35) Izmalkova, T. Y.; Sazonova, O. I.; Sokolov, S. L.; Kosheleva, I. A.; Boronin, A. M. Diversity of genetic systems responsible for naphthalene biodegradation in Pseudomonas fluorescens strains. Microbiology 2005, 74 (1), 60–68. (36) Larkin, M. J.; Kulakov, L. A.; Allen, C. C. R. Biodegradation and Rhodococcus - masters of catabolic versatility. Curr. Opin. Biotechnol. 2005, 16 (3), 282–290.

’ REFERENCES (1) Cerniglia, C. E. Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation 1992, 3, 351–368. (2) Kim, J. H.; Yamaguchi, K.; Lee, S. H.; Tithof, P. K.; Sayler, G. S.; Yoon, J. H.; Baek, S. J. Evaluation of polycyclic aromatic hydrocarbons in the activation of early growth response-1 and peroxisome proliferator activated receptors. Toxicol. Sci. 2005, 85 (1), 585–593. (3) Stahl, D. A.; Urbance, J. W. The division between fast-growing and slow-growing species corresponds to natural relationships among the Mycobacteria. J. Bacteriol. 1990, 172, (1), 116
124. (4) Zhou, H. W.; Guo, C. L.; Wong, Y. S.; Tam, N. F. Y. Genetic diversity of dioxygenase genes in polycyclic aromatic hydrocarbondegrading bacteria isolated from mangrove sediments. FEMS Microbiol. Lett. 2006, 262 (2), 148–157. (5) Heitkamp, M. A.; Cerniglia, C. E. Mineralization of polycyclic aromatic hydrocarbons by a bacterium isolated from sediment below an oil-field. Appl. Environ. Microbiol. 1988, 54 (6), 1612–1614. (6) Sho, M.; Hamel, C.; Greer, C. W. Two distinct gene clusters encode pyrene degradation in Mycobacterium sp strain S65. FEMS Microbiol. Ecol. 2004, 48 (2), 209–220. (7) Miller, C. D.; Child, R.; Hughes, J. E.; Benscai, M.; Der, J. P.; Sims, R. C.; Anderson, A. J. Diversity of soil Mycobacterium isolates from three sites that degrade polycyclic aromatic hydrocarbons. J. Appl. Microbiol. 2007, 102, 1612–1624. (8) Kim, S. J.; Kweon, O.; Jones, R. C.; Freeman, J. P.; Edmondson, R. D.; Cerniglia, C. E. Complete and integrated pyrene degradation pathway in Mycobacterium vanbaalenii PYR-1 based on systems biology. J. Bacteriol. 2007, 189 (2), 464–472. (9) Kim, S. J.; Kweon, O.; Jones, R. C.; Edmondson, R. D.; Cerniglia, C. E. Genomic analysis of polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Biodegradation 2008, 19 (6), 859–881. (10) Khan, A. A.; Wang, R. F.; Cao, W. W.; Doerge, D. R.; Wennerstrom, D.; Cerniglia, C. E. Molecular cloning, nucleotide sequence, and expression of genes encoding a polcyclic aromatic ring dioxygenase from Mycobacterium sp strain PYR-1. Appl. Environ. Microbiol. 2001, 67 (8), 3577–3585. (11) Kim, S. J.; Kweon, O.; Freeman, J. P.; Jones, R. C.; Adjei, M. D.; Jhoo, J. W.; Edmondson, R. D.; Cerniglia, C. E. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and highmolecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Appl. Environ. Microbiol. 2006, 72 (2), 1045–1054. (12) DeBruyn, J. M.; Sayler, G. S. Microbial community structure and biodegradation activity of particle-associated bacteria in a coal tar contaminated creek. Environ. Sci. Technol. 2009, 43 (9), 3047–3053. (13) DeBruyn, J. M.; Chewning, C. S.; Sayler, G. S. Comparative quantitative prevalence of Mycobacteria and functionally abundant nidA, nahAc, and nagAc dioxygenase genes in coal tar contaminated sediments. Environ. Sci. Technol. 2007, 41 (15), 5426–5432. (14) Hall, K.; Miller, C. D.; Sorensen, D. L.; Anderson, A. J.; Sims, R. C. Development of a catabolically significant genetic probe for polycyclic aromatic hydrocarbon-degrading Mycobacteria in soil. Biodegradation 2005, 16 (5), 475–484. (15) DeBruyn, J. M.; Mead, T. J.; Wilhelm, S. W.; Sayler, G. S. PAH biodegradative genotypes in Lake Erie sediments: Evidence for broad geographical distribution of pyrene-degrading mycobacteria. Environ. Sci. Technol. 2009, 43 (10), 3467–3473. (16) Stingley, R. L.; Khan, A. A.; Cerniglia, C. E. Molecular characterization of a phenanthrene degradation pathway in Mycobacterium vanbaalenii PYR-1. Biochem. Biophys. Res. Commun. 2004, 322 (1), 133–146. (17) Top, E. M.; Springael, D. The role of mobile genetic elements in bacterial adaptation to xenobiotic organic compounds. Curr. Opin. Biotechnol. 2003, 14 (3), 262–269. 105

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106

Environmental Science & Technology

ARTICLE

(37) Yu, C. P.; Chu, K. H. A quantitative assay for linking microbial community function and structure of a naphthalene-degrading microbial consortium. Environ. Sci. Technol. 2005, 39 (24), 9611–9619. (38) Habe, H.; Chung, J. S.; Ishida, A.; Kasuga, K.; Ide, K.; Takemura, T.; Nojiri, H.; Yamane, H.; Omori, T. The fluorene catabolic linear plasmid in Terrabacter sp. strain DBF63 carries the beta-ketoadipate pathway genes, pcaRHGBDCFIJ, also found in proteobacteria. Microbiology 2005, 151, 3713–3722. (39) Iwai, S.; Yamazoe, A.; Takahashi, R.; Kurisu, F.; Yagi, O. Degradation of mono-chlorinated dibenzo-p-dioxins by Janibacter sp strain YA isolated from river sediment. Curr. Microbiol. 2005, 51 (5), 353–358. (40) Yamazoe, A.; Yagi, O.; Oyaizu, H. Degradation of polycyclic aromatic hydrocarbons by a newly isolated dibenzofuran-utilizing Janibacter sp strain YY-1. Appl. Microbiol. Biotechnol. 2004, 65 (2), 211–218.

106

dx.doi.org/10.1021/es201607y |Environ. Sci. Technol. 2012, 46, 99–106