Human Telomeric G-quadruplex Selective Fluoro-isoquinolines

Subscriber access provided by Weizmann Inst. of Science Library

Article

Human Telomeric G-quadruplex Selective Fluoroisoquinolines Induce Apoptosis in Cancer Cells Subhadip Maiti, Puja Saha, Tania Das, Irene Bessi, Harald Schwalbe, and Jyotirmayee Dash Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00781 • Publication Date (Web): 13 Feb 2018 Downloaded from http://pubs.acs.org on February 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Human Telomeric G-quadruplex Selective Fluoro-isoquinolines Induce Apoptosis in Cancer Cells Subhadip Maiti,†‡ Puja Saha,†‡ Tania Das,† Irene Bessi,§ Harald Schwalbe,§ and Jyotirmayee Dash*† Corresponding Author’s E-mail: [email protected] †

Department of Organic Chemistry, Indian Association for the Cultivation of Science, Jadavpur,

Kolkata 700032, India §

Institute of Organic Chemistry and Chemical Biology, Center for Biomolecular Magnetic

Resonance (BMRZ), Goethe University, Frankfurt, Max-von-Laue Strasse 7, 60438 Frankfurt am Main, Germany.

ABSTRACT: Small molecules that stabilize G-quadruplex structures in telomeres can prevent telomere lengthening by telomerase and subsequently lead to cell death. We herein report two fluoroisoquinoline derivatives IQ1 and IQ2 as selective ligands for human telomeric G-quadruplex DNA. IQ1 and IQ2 containing different triazolyl side chains have been synthesized by Cu (I) catalyzed azide-alkyne cycloaddition. Fluorescence Resonance Energy Transfer (FRET) melting assay and fluorescence binding titrations indicate that both these ligands exhibit binding preference for telomeric G-quadruplex DNA (h-TELO) over other promoter DNA quadruplexes 1 ACS Paragon Plus Environment

Bioconjugate Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and duplex DNA. However, ligand IQ1, containing pyrrolidine side chains, is capable of discriminating among quadruplexes by showing higher affinity towards h-TELO quadruplex DNA. On contrary, IQ2, containing benzamide side chains, interacts with all the investigated quadruplexes. NMR analysis also suggests that IQ1 interacts strongly with the external Gquartets of h-TELO. Biological studies reveal that IQ1 is more potent than IQ2 in inhibiting telomerase activity by selectively interacting with telomeric DNA G-quadruplex. Moreover, a dual luciferase reporter assay indicates that IQ1 is unable to reduce the cellular expression of cMYC and BCL2 at transcriptional level. Significantly, IQ1 mostly stains the nucleus, induces cell cycle arrest in G0/G1 phase, triggers apoptotic response in cancer cells and activates caspases 3/7.

INTRODUCTION G-quadruplex DNA structures have been hypothesized to play key role in cellular processes such as gene regulation and maintenance of genomic stability.1-11 These structures are prevalent in regions of biological significance such as telomeres and promoter regions of oncogenes.12-16 Human telomeres that contain tandem TTAGGG repeats protect chromosome ends from degradation and end-to-end fusion.17-20 The reverse transcriptase enzyme telomerase and the sixmembered protein complex shelterin maintains the telomere length by extending the telomeric 3’ G-overhang. 21,22 It has been reported that the telomerase enzyme is transcriptionally repressed in proliferative somatic cells resulting in progressive shortening of telomeres that eventually leads to cellular senescence and apoptosis.23,24 In cancer cells, the upregulation of telomerase activity and subsequent lengthening of telomeres prevent cellular aging and confer cellular immortality.25 The G-rich human telomeric DNA sequences have the propensity to fold into quadruplex 2 ACS Paragon Plus Environment

Page 2 of 47

Page 3 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


structures26-29 that inhibit telomerase functioning and induce cell apoptosis.30,31 Stabilization of telomeric G-quadruplexes by small molecules thus presents an appealing strategy for cancer chemotherapy. Therefore, several small molecules capable of binding and stabilizing the telomeric G-quadruplexes have been developed as potential anti-cancer agents.32-41Among them; telomestatin, the macrocyclic natural product, efficiently stabilizes human telomeric Gquadruplex structure and potentially inhibits telomerase activity at nano-molar concentration.36,37 However, telomestatin suffers from several disadvantages like insufficient drug like properties, chemical instability and burdensome multi-step synthetic preparation.42 Other synthetic molecules, e.g., BRACO-19,32 RHPS434 are also reported as promising candidates for stabilizing telomeric G-quadruplex DNA. Unfortunately, none of these molecules have been proven suitable for advanced clinical trials, mainly because of lack of membrane permeability and small therapeutic window.43 In this context, we herein describe 6-fluoroisoquinoline derivatives ( IQ1 and IQ2) as a new class of sequence-selective G-quadruplex DNA binding ligands that exhibit high selectivity and affinity for telomeric quadruplex DNA. We have hypothesized that these compounds could be easily synthesizable from commercially available starting materials and could exhibit high chemical stability and bioavailability and enhanced biological activity. RESULTS AND DISCUSSION Design and synthesis. Isoquinoline ring system is present in numerous naturally occurring heterocyclic alkaloids that show a broad spectrum of biological activities.44-46 For instance, natural isoquinoline alkaloids like berberine, palmatine, coralyne and sanguinarine derivatives exhibit potent DNA binding properties.47-50 It has been reported that isoquinoline alkaloids and some of its semi-synthetic derivatives can interact with DNA G-quadruplexes.51-56 Recently, natural isoquinoline alkaloids isolated from Chelidonium majus have been demonstrated as 3 ACS Paragon Plus Environment


Page 4 of 47

potent stabilizers of telomeric G-quadruplex DNA and inhibitors of telomerase enzyme.57 In the present study, 6-fluoroisoquinoline core was chosen as a suitable starting scaffold for generating G-quadruplex DNA-selective ligands, because of its chemical accessibility and poly-aromatic planar surface that is favourable for stacking interactions with the external G-tetrads. Furthermore, the presence of electronegative fluorine atom can play a remarkable role in enhancing pharmacokinetic properties like improved membrane permeation, bioavailability and enhanced binding affinity for the biomolecular target via non-covalent interactions. The electronwithdrawing fluorine atom may reduce the electron density of the isoquinoline heteroaromatic system which in turn facilitates its interaction with π-electrons of the external G-tetrads. Additionally, fluorine containing compounds are endowed with remarkable anticancer properties.58,59 The presence of fluorine atom can also enable us to use

19

F NMR spectroscopy

for monitoring the binding interactions of isoquinolines with DNA quadruplexes. Compound IQ1 and IQ2 were synthesized via triazolyl-linking of two different positively charged substituents (pyrrolidine and dimethylamino propyl benzamide side chains, respectively) to the central isoquinoline core by Cu (I) catalyzed Huisgen cycloaddition.60-64 The triazolyl moieties may also provide extra stabilization by enhancing π-stacking interactions with the DNA bases. The positively charged side chains are inspired from previously reported ligands that demonstrated promising binding capability for quadruplex DNA over duplex DNA.32,61,65-69 Unlike the rigid fused ring systems of natural isoquinolines, the triazolyl derivatives IQ1 and IQ2 contain rotatable bonds that would enable possible twisted and coplanar conformations. These adaptive structural features might allow specific interaction of IQ1 and IQ2 with the Gquadruplex target. The different side chains such as pyrrolidine and dimethylamino propyl

4 ACS Paragon Plus Environment

Page 5 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


benzamide motif of IQ1 and IQ2, respectively, may play important roles in molecular recognition properties for quadruplexes. The two isoquinoline derivatives IQ1 and IQ2 were synthesized using Cu (I) catalyzed Huisgen cycloaddition of 6-fluoroisoquinoline dialkyne 3 with azides 4 and 5 in high yields (Scheme 1). The dialkyne 3 was prepared in two steps from the commercially available 3dichloro-6-fluoroisoquinoline 1. Sonogashira coupling of 1 with trimethylsilylacetylene followed by the removal of TMS group from the compound 2 afforded the dialkyne derivative 3. Scheme 1. Synthesis of bis-triazolyl fluoro-isoquinoline derivatives IQ1 and IQ2.

Stabilization potentials for G-quadruplexes. Fluorescence based DNA melting assay (Förster Resonance energy transfer (FRET) melting)70 was carried out to monitor the interaction of the ligands with the preformed quadruplex DNAs in 60 mM potassium cacodylate buffer solution (pH 7.4). A panel of seven dual labeled DNA sequences modified at their 5’ and 3’ end with FAM and TAMRA fluorophores, respectively were used in these experiments (Table 1). Table 2 shows the ∆Tm values of 200 nM dual labeled G-quadruplexes (h-TELO BCL2

73,74

, KRAS 75, c-KIT1

76

71

, c-MYC

72

,

and c-KIT2 77) and a self complementary hairpin duplex DNA in 5 ACS Paragon Plus Environment


the presence of 1 µM concentration of IQ1 and IQ2. The FRET melting data demonstrated that these two isoquinoline compounds showed a high level of stabilization potential for telomeric Gquadruplex DNA (h-TELO) over other G-quadruplex DNAs and duplex DNA. However, the starting materials dichloro isoquinoline derivative 1 and dialkyne 3 hardly altered the Tm values of the quadruplexes and duplexes (data not shown), suggesting that the side chains have a significant impact on the stabilization of quadruplexes. IQ1 with two pyrrolidine side chains exhibited a ∆Tm value of 11.8 °C for h-TELO quadruplex DNA at 1 µM concentration while it showed a ∆Tm value of 4.7 °C for c-MYC DNA at 1 µM concentration. For other quadruplexes, compound IQ1 displayed moderate stabilizing ability (∆Tm = 3.8 °C for c-KIT2, 3.3 °C for KRAS, 0.7 °C for BCL2 and 0.5 °C for c-KIT1) at 1 µM concentration (Figure 1a, Figure S1). Isoquinoline derivative IQ2 with benzamide side chains displayed high ∆Tm values for DNA quadruplexes (∆Tm = 31 °C for h-TELO, 18.3 °C for c-MYC, 16.2 °C for c-KIT2, 19.5 °C for KRAS, 13.4 °C for BCL2 and 6.4 °C for c-KIT1 at 1 µM concentration) due to its extended πconjugated aromatic structure (Figure 1b, Figure S1). More significantly, both of these compounds show rather weak stabilization effect on the thermal stability of the duplex DNA suggesting their selectivity for quadruplexes over duplex DNA.


Page 6 of 47

Page 7 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Sequences of oligonucleotides used in biophysical experiments. DNA

Sequences (Labeled: 5’-FAM, TAMRA-3’; Unlabeled: 5’….3’)

h-TELO

TTGGGTTAGGGTTAGGGTTAGGGA

c-MYC

TGGGGAGGGTGGGGAGGGTGGGGAAGG

c-KIT1

GGGAGGGCGCTGGGAGGAGGG

c-KIT2

GGGCGGGCGCGAGGGAGGGG

BCL2

AGGGGCGGGCGCGGGAGGAAGGGGGCGGGAGCGGGGCTG

KRAS

AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG

dsDNA

TATAGCTATAAAAAAAATATAGCTATA

To further investigate the binding selectivity of IQ1 and IQ2, concentration-dependent FRET melting experiments with telomeric and promoter quadruplexes and with duplex DNA were carried out in the presence of different concentrations of IQ1 and IQ2. The FRET-melting profiles indicated that isoquinoline derivatives displayed a dose-dependent increase in the ∆Tm values of the quadruplexes. However, both of them showed comparatively significant selectivity towards telomeric G-quadruplex DNA over c-MYC and other promoter quadruplex DNAs. For IQ1, the saturation of melting curve of h-TELO quadruplex DNA was achieved at only 1.5 µM concentrations while it requires 2 µM concentrations for c-MYC quadruplex DNA to display maximum melting temperature. For other quadruplexes, a higher concentration of IQ1 (> 5 µM) is required to exhibit maximum Tm value. IQ2 displayed maximum melting temperature for hTELO and c-MYC G-quadruplex DNA at 1 and 1.5 µM concentrations, respectively. IQ2 showed maximum Tm value for c-KIT1 at 3.3 µM (∆Tm = 30.4 °C), for c-KIT2 at 3 µM (∆Tm = 30 °C), for BCL2 at 2.2 µM (∆Tm = 17.4 °C) and for KRAS at 1.9 µM (∆Tm = 24.6 °C) (Figure 1b). It 7 ACS Paragon Plus Environment


indicates that 2-4 fold higher concentrations of IQ2 are required for promoter G-quadruplexes to achieve maximum stabilization potential compared to h-TELO quadruplex DNA. Thus, the concentration dependent FRET melting experiments revealed that IQ1 and IQ2 displayed comparatively significant selectivity towards telomeric G-quadruplex DNA over c-MYC and other promoter quadruplex DNAs. However, IQ1 is found to be quite specific for telomeric Gquadruplex DNA whereas IQ2 exhibited differential binding specificity towards all the tested quadruplex DNA.

Figure 1. FRET-melting profiles of G-quadruplex DNA [h-TELO (blue), c-MYC (red), BCL2 (cyan), KRAS (green), c-KIT1 (black) and c-KIT2 (pink)] and duplex DNA (orange) with increasing amounts of (a) IQ1 and (b) IQ2 (R2 value of the fitted curves are 0.9873 and 0.9881, respectively) in 60 mM potassium cacodylate buffer (pH 7.4). (c) Competitive FRET melting analysis carried out with dual labelled h-TELO (F-h-TELO) G-quadruplex-DNA (0.2 µM) with 1 µM IQ1 and IQ2 and increasing amounts (0-100 eq) of unlabeled duplex DNA (dsDNA) competitor [F-h-TELO: dual labeled telomeric sequence].

To characterize the selectivity of these ligands for h-TELO G-quadruplex DNA over duplex DNA, competitive FRET melting experiment was performed with a non-fluorescent hairpin duplex DNA competitor. The competitive FRET melting assay plotted in Figure 1c clearly 8 ACS Paragon Plus Environment

Page 8 of 47

Page 9 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


indicated a high level of stabilization by these small molecules for telomeric G-quadruplex DNA. Even at 100 equiv. of duplex DNA, the Tm values of h-TELO G-quadruplex DNA were little affected in the presence of 1 µM IQ1 and IQ2. In the FRET competitive experiments with an unlabelled promoter quadruplex i.e. c-MYC quadruplex DNA, it was found that both the isoquinoline compounds exhibited excellent selectivity for the h-TELO G-quadruplex DNA over c-MYC quadruplex DNA. The melting temperature for h-TELO G-quadruplex DNA in the presence of 1 µM ligand along with 100 eq. unlabelled c-MYC DNA was not remarkably changed (Figure S2). Accordingly, the combined results of these assays demonstrated that bistriazolyl 6-fluoro isoquinoline derivatives may be a new class of potent and highly selective hTELO G-quadruplex binding ligands.

Figure 2. Fluorimetric titration of (a) IQ1 and (b) IQ2 with h-TELO G-quadruplex DNA. Fluorescence responses of (c) IQ1 and (d) IQ2 (0.5 µM) with different concentrations of 9 ACS Paragon Plus Environment


biologically relevant G-quadruplex DNA sequences [e.g. h-TELO (blue), c-MYC (red), BCL2 (cyan), KRAS (green), c-KIT1 (black) and c-KIT2 (pink)] and duplex DNA (orange) in 100 mM Tris.KCl buffer (pH 7.4) (ߣ௘௫ ூொଵ = 307 nm and

ߣ௘௫ ூொଶ

= 325 nm).

Discrimination of different DNA G-quadruplexes. The binding affinity and specificity of IQ1 and IQ2 for a number of biologically relevant DNA quadruplexes were evaluated by fluorescence titrations. IQ1 showed an emission band at 394 nm (λex = 307 nm) and IQ2 showed the emission peak at 422 nm (λex = 325 nm) in 100 mM Tris.KCl buffer (pH 7.4) (Figure S3). It was observed that both IQ1 and IQ2 were able to differentiate among different quadruplexes and duplex DNA by producing differential fluorescence responses. The fluorescence intensities of both fluoro-isoquinolines were comparatively high for h-TELO G-quadruplex DNA (Figure 2a-b) than other promoter quadruplexes (c-MYC, BCL2, KRAS, cKIT1 and c-KIT2) (Figure S4). IQ1 exhibited a dose-dependent fluorescence enhancement for hTELO (2-fold) and c-MYC (1.4-fold) G-quadruplexes while it exhibited negligible fluorescence changes for BCL2, KRAS, c-KIT1, and c-KIT2 quadruplexes (Figure 2c).


Page 10 of 47

Page 11 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. Stabilization potential (∆Tm) values and dissociation constants (Kd) of isoquinoline derivatives for different DNAs. ∆Tm [°C] at 1 µM ligand conc.

Kd [µM]

DNA IQ1

IQ2

IQ1

IQ2

h-TELO

11.8

31.0

0.33 ± 0.01

0.5 ± 0.03

c-MYC

4.7

19.5

1.13 ± 0.03

1.04 ± 0.04

c-KIT1

0.5

6.4

##

##

c-KIT2

3.8

16.2

##

1.36 ± 0.06

BCL2

0.7

13.4

##

1.25 ± 0.11

KRAS

3.3

19.5

##

1.12 ± 0.35

dsDNA

0.4

0.9

##

##

##: could not be determined; no significant changes in fluorescence intensity up to addition of 6 eq DNA. Melting temperatures of the sequences used are as follows; h-TELO - 58.3 °C, c-MYC – 73.2 °C, c-KIT1 - 58.7 °C, c-KIT2 – 69.4 °C, BCL2 – 68.7 °C, KRAS - 50.1 °C, dsDNA - 61.2 °C.

Under similar experimental conditions, the fluorescence intensity of IQ2 increased up to ̴ 1.9fold upon interaction with h-TELO, ̴ 1.5-fold for c-MYC, ̴ 1.3-fold with BCL2, ̴ 1.2-fold with each c-KIT2 and KRAS and ̴ 1.1-fold with c-KIT1 quadruplex DNA (Figure 2d). Moreover, no significant changes in fluorescence signals of both the compounds were observed upon incremental addition of duplex DNA. The equilibrium dissociation constant (Kd) for the ligand/DNA complexes were determined by using Hill-1 equation (Table 2). Ligand IQ1 showed 11 ACS Paragon Plus Environment


a ̴ 3.5-fold higher affinity for h-TELO with a submicromolar Kd value (0.33 ± 0.01 µM) over cMYC quadruplex DNA (Kd = 1.13 ± 0.03 µM). In contrast, IQ2 interacted with all the investigated promoter quadruplexes with Kd values of 1.04 ± 0.04 µM, 1.36 ± 0.06 µM, 1.25 ± 0.11 µM for c-MYC, c-KIT2, BCL2 and KRAS quadruplexes respectively and showed a submicromolar dissociation constant (0.5 ± 0.03 µM) for h-TELO G-quadruplex DNA (Table 2). These results indicated that both IQ1 and IQ2 showed binding preference for h-TELO and IQ1 is better at discriminating between different quadruplexes as compared to IQ2. 1D 1H and

19

F NMR analysis. We next investigated the effect of ligands on h-TELO and

c-MYC G-quadruplex by 1D 1H and 1D

19

F NMR analysis. The interaction of ligands with

telomeric G-quadruplex DNA was studied using the sequence indicated in Figure 3a as h-TELO. This sequence adopts a hybrid (3+1) conformation as determined by NMR by Patel and coworkers.78 The effect of IQ1 on the imino region of h-TELO is shown in Figure 3b. The imino signals were observed to shift continuously upon addition of ligand, indicating the interaction of IQ1 with the telomeric G-quadruplex in fast exchange on the NMR timescale. Interestingly, an extreme line broadening was selectively detected for signals of imino protons located on the 5’end G-quartet (G3, G9 and G21) and to the 3’-end G-quartet (G11 and G5), suggesting that IQ1 interacted preferentially with the external tetrads, possibly stacking with the aromatic moiety (see Figure 3f for chemical shift perturbation map on h-TELO). Above a [ligand]:[DNA] ratio of 1.0, a broad signal was detected at around 8.6 ppm (aromatic region, Figure S5a highlighted in green) which could be tentatively attributed to the ligand in the bound form. Upon addition of IQ2 to h-TELO, the imino proton signals showed a general line broadening but no chemical shift perturbation (CSP) (Figure 3c). Furthermore, signals from the free ligand were observed in the


Page 12 of 47

Page 13 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


aromatic region at 6.8 ppm starting from a [ligand]:[DNA] ratio of 1.0 (Figure S5b highlighted in yellow). This data indicates that IQ1 interacts with h-TELO more specifically than IQ2.

Figure 3. (a) Sequence and numbering of the G-quadruplex DNAs used for NMR studies. Imino region of 1D 1H NMR spectrum of 100 µM G-quadruplex DNA in presence of increasing amounts of ligand. Panel (b) and panel (c) show the titrations of h-TELO DNA with IQ1 and 13 ACS Paragon Plus Environment


Page 14 of 47

IQ2, respectively. Panel (d) and panel (e) show the titration of c-MYC G-quadruplex DNA with IQ1 and IQ2, respectively. Titrations with IQ2 were performed in 90% H2O/10% D2O, while titrations with IQ1 were performed in 90% H2O/10% d6-DMSO. Experimental conditions: 298K, 600 MHz, 25 mM Tris.HCl buffer (pH 7.4), containing 100 mM KCl. (f) Imino CSPs from titration (b) highlighted in red on the model of h-TELO [PDB code: 2GKU].78.

The c-MYC sequence used for NMR studies (Figure 3a) forms an all parallel G-quadruplex structure with propeller loops and was previously characterized by Yang and co workers.79,80 Titration of c-MYC with IQ1 resulted in a general broadening of the imino proton signals already at a [ligand]:[DNA] molar ratio of 0.5 (Figure 3d). In particular, most of the imino signals stemming from guanine residues belonging to the 5’-end quartet (G13, G4, and G8) and the imino proton from residue G9 were broadened beyond detection. Furthermore, chemical shift perturbation (CSP) of residues defining the 5’- and 3’-end capping structures (T1, G2, A3, G4 at 5’-end and T20, A21, A22 at 3’-end) were observed in the aromatic region (Figure S5c). NMR analysis revealed that IQ1 was able to induce major rearrangements on the 3’ and 5’ flanking nucleotide structure and strongly interacted with the 5’-end external quartet. The effect of IQ2 on c-MYC was less pronounced and the line broadening of the imino signals was less severe than what observed for IQ1 (Figure 3e). Upon addition of ligand, the aromatic region did not show any significant CSPs (Figure S5d). Notably, the binding of IQ1 to h-TELO and c-MYC was also confirmed by

19

F NMR. The

binding interactions of IQ1 with DNA quadruplexes produced CSPs and line broadening of the 19

F NMR signal (Figure S6a). In case of IQ2, the

19

F NMR reporter signal was broadened

beyond detection already without DNA in buffer (Figure S6b). 14 ACS Paragon Plus Environment

Page 15 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Circular dichroism (CD) spectroscopy was carried out to explore the effect of ligand binding on h-TELO and c-MYC G-quadruplex structures (Figure S7). In the presence of K+, the CD spectrum of h-TELO showed a major positive band at 290 nm with a shoulder at around 270 nm and a negative peak at 240 nm, indicative of a typical hybrid-type stable G-quadruplex structure.81,82 With the incremental addition of IQ1 and IQ2 (0-10 eq) to h-TELO (10 µM), the mixed-hybrid conformation of the h-TELO DNA remained unaltered, indicating both these ligands do not disrupt the quadruplex structure. Similar CD titration experiments of c-MYC DNA with IQ1 and IQ2 (0-10 eq) revealed that the isoquinoline derivative preserve the parallel conformation of c-MYC showing a positive peak around 260 nm and negative peak at 240 nm.83 Anti-proliferative activity in cellular system. We then evaluated the anti-proliferative effect of these compounds in several human cancer cell lines like lung epithelial carcinoma cell line A549, cervical cancer cell line HeLa and human leukemic T cell line Jurkat E6.1. The cytotoxic effect of IQ1 and IQ2 was also assessed in C2C12 and NKE non-cancerous cell line to demonstrate their specificity for cancer cells. The cell viability was determined by using XTT assay after treatment with IQ1 and IQ2 over a period of 72 h. The IC50 values (72 h) of IQ1 and IQ2 for A549, HeLa, Jurkat E6.1, C2C12 and NKE cell lines are shown in Table 3. It was observed that treatment with IQ1 and IQ2 significantly inhibited the cancer cell growth but both of these compounds caused negligible cytotoxicity to C2C12 and NKE cells, even at a concentration of 50 µM. These results demonstrated that IQ1 and IQ2 are specific for cancer cells over the non-cancerous normal cell line. It was also observed that IQ1 was more efficient than IQ2 in inhibiting the cancer cell proliferation. After 72 h treatment, IQ1 exhibited IC50 values of 1.72 µM in A549 cells, 3.14 µM in HeLa cells and 2.21 µM in Jurkat E6.1 cells, while compound IQ2 displayed IC50 values of 13.02 µM, 12.45 µM and 13.76 µM in A549, HeLa and 15 ACS Paragon Plus Environment


Page 16 of 47

Jurkat E6.1 cells, respectively. These results also indicated that the growth inhibitory effect of IQ1 was stronger for A549 cells as compared to other cancer cell lines while IQ2 exhibit moderate cytotoxicity towards the tested cancer cell lines (Figure S8) We then performed timedependent cell viability assay in A549 cells (Table 4). IQ1 exhibited IC50 values of 11.2 µM and 4.9 µM at 24 h and 48 h of treatment respectively; whereas IQ2 exhibited a low cytotoxic effect towards A549 cell line showing IC50 values of 39.4 µM and 27.9 µM at 24 h and 48 h treatment (Figure S9). The high IC50 values of IQ2 may indicate its reduced cell membrane permeability as it contains a more extended structure than IQ1. Table 3. XTT cell viability assay showing IC50 values of IQ1 and IQ2 over 72 h in different cancer cell lines (A549, HeLa, Jurkat E6.1) and normal cell line C2C12 and NKE. IC50 values (µM) at 72 h Ligands

A549

HeLa

Jurkat

C2C12

NKE

E6.1 IQ1

1.72

3.14

2.21

> 50

> 50

IQ2

13.02

12.45

13.76

> 50

> 50

Table 4. XTT assay showing time dependent IC50 values of IQ1 and IQ2 over 24-72 h in A549 cells.

IC50 values (µM) Ligands

24 h

48 h

72 h

IQ1

11.23

4.95

1.72

IQ2

39.36

27.92

13.02 16 ACS Paragon Plus Environment

Page 17 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To establish this hypothesis, we have employed confocal laser scanning microscopy to verify the nuclear localization of the fluoroisoquinolines in A549 cell line. NucRed-647 was used as nucleus staining agent. Merged confocal imaging of IQ1 treated cells showed green fluorescence response in the cell and it was observed that IQ1 is able to localize inside the cell nucleus. In comparison, IQ2 is mostly localized outside the nucleus indicating its inability to permeate the nuclear membrane (Figure 4).

Figure 4. Confocal microscopic images of A549 cells treated with 5 µM IQ1 and IQ2 for 24 h. The nucleus was counterstained with NucRed Live 647 ReadyProbe Reagent, incubation time 15 min. Bar indicates 10 µm. Inhibition of telomerase activity. A three-step modified in vitro TRAP assay (Telomeric Repeat Amplification Protocol)84 was next performed to determine the inhibitory ability of the fluoro-isoquinoline derivatives on the activity of human telomerase. The telomerase activity was evaluated in the presence of IQ1 and IQ2 (0-15 µM) using the telomerase extract from human lung carcinoma A549 cell line. TmPyP4, a well known quadruplex-interactive agent85 was used 17 ACS Paragon Plus Environment


as a positive control. The in-vitro TRAP assay was performed with 2 µM TmPyP4. The PAGE analysis illustrated remarkable dose dependent inhibition of telomere extension by IQ1 and IQ2 (Figure 5a). However, IQ1 with the pyrrolidine side chains exhibited improved inhibitory activity against telomerase compared to IQ2. The telomere elongation was inhibited at 5 µM concentrations of IQ1 and a significant inhibition was observed at a concentration of 10 and 15 µM of IQ1; whereas IQ2 could not completely inhibit telomere elongation even at a concentration of 15 µM (Figure 5b). Moreover, the telomerase inhibiting activity of IQ1 is comparable to TmPyP4. The in vitro TRAP-LIG assay thus suggested that IQ1 is more potent in inhibiting telomerase activity than IQ2.

Figure 5. (a) In-vitro TRAP-LIG assay with telomerase extract from A549 cell line. Lane 1-3: 15, 10 and 5 µM of IQ1, Lane 4-6: 15, 10 and 5 µM of IQ2, Lane 7: 2 µM TmPyP4, Lane 8: Lane 8: control cell lysate, Lane 9: Negative control (absence of enzyme and ligand), Lane M: ladder. (b) Bar diagram representing the band intensity of each PCR product ladder indicates the percentage of telomerase activity in presence or absence of ligands. Error bars represent S.D. of two biological replicates); * indicates a p value < 0.05. Effect on c-MYC and BCL2 gene expression. Next, isoquinoline derivatives were tested in cellulo for their abilities to alter the expression levels of c-MYC and BCL2 gene by stabilizing the 18 ACS Paragon Plus Environment

Page 18 of 47

Page 19 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


respective promoter G-quadruplexes. The c-MYC protein expression of A549 cells treated with 5 µM IQ1 and IQ2 for 24 h did not show any remarkable changes in Western blot analysis. When the treatment period was extended to 48 h, the c-MYC gene expression was reduced by ̴ 17 % with IQ1 and ̴ 11% with IQ2 (Figure 6a-b). For further confirmation, the dual luciferase assay was carried out with c-MYC Del 4 promoter construct where the c-MYC G-rich promoter sequence was cloned upstream of the firefly luciferase gene in a plasmid DNA construct (Figure 6c).86 Both IQ1 and IQ2 did not affect the c-MYC promoter activity; which is in agreement with the data obtained in Western blot analysis. BCL2 protein expression was found to be slightly reduced after treatment with 5 µM IQ1 and IQ2 for 24 h and 48 h respectively (Figure 6a-b). Even, dual luciferase reporter assay using a plasmid construct containing human promoter region (ATG to -3934) upstream of the firefly luciferase gene87 demonstrated that IQ1 and IQ2 showed negligible inhibitory effect on the BCL2 promoter activity (Figure 6c). Together, these results indicated that both the compounds are unable to stabilize the c-MYC and BCL2 promoter G-quadruplex in cellular systems. Subsequently, the expression of BAX was examined after treatment with IQ1 and IQ2 at 5 µM concentration. The Western Blot analysis showed that the cellular expression of BAX was moderately increased in ligand treated cells (nearly 50 % by IQ1 and 25 % by IQ2) (Figure 6ab). The alterations in c-MYC, BCL2 and BAX gene expressions suggest that these fluoroisoquinoline ligands may be able to induce promoter-G-quadruplex-independent apoptosis in cancer cells.



Figure 6. Effects of IQ1 and IQ2 (5 µM) on the protein expression level of c-MYC, BCL2, BAX and GAPDH genes in A549 cells. (d) Bar diagram representing the percentage of gene expression after IQ1 and IQ2 over 48 h. Error bars represent S.D. (three biological replicates); * indicates a p value > 0.05.(e) Effect of IQ1 and IQ2 (5 µM) on c-MYC and BCL2 promoter activity as measured by firefly luciferase expression (normalized to Renilla expression) following exposure of A549 cells lines to 5 µM concentrations of IQ1 and IQ2 at 24 h and 48 h. 20 ACS Paragon Plus Environment

Page 20 of 47

Page 21 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Effect on Cell cycle. To investigate the effect of ligands on different phases of cell cycle distribution of A549 cells, we have performed PI-mediated cell cycle analysis experiments. Untreated control cells maintained a high percentage (56.8 %) of the total population in G0/G1 phase with 15.8 % and 24.9 % in S and G2/M phases, respectively. On exposure to IQ1 (5 µM), cells displayed a prominent G1 phase arrest in flow cytometry (Figure 7). The G0/G1 cell population was increased to 67.6 % and 69.1 % upon incubation with IQ1 for 24 and 48 h. Treatment with 5 µM IQ2 also increased the percentage of cell population in the G0/G1 phase. The percentage of G1 phase cells at 24 and 48 h incubation with IQ2 were increased to 63.8 % and 65.6 % (Figure 7). The observed increase in G0/G1 population suggested that the compounds caused a significant block for S-phase progression; most probably by hindering the DNA unwinding due to ligand-mediated stabilization of telomeric G-quadruplexes.88 The FACS analysis thus suggests that upon treatment with IQ1 and IQ2, cells undergo G1 arrest with concomitant decrease of S- phase population thereby leading to cell death.

Figure 7. (a) Cell cycle analysis of A549 cells treated with IQ1 and IQ2 at 5 µM concentrations for 24 and 48 h. (b) Bar diagram of the percentages of cells in different phases of the cell cycle with respect to the total number of viable cells. Induction of apoptosis. Having demonstrated that fluoroisoquinoline derivatives effectively arrest the cell cycle at the G0/G1 phase in A549 cells, we then evaluated the ability of IQ1 and 21 ACS Paragon Plus Environment


IQ2 to induce cellular apoptosis. To investigate the apoptosis inducing abilities of IQ1 and IQ2, Annexin V-FITC/PI double staining assay was carried out in Flow cytometry. After incubation with 5 µM IQ1 for 24 h and 48 h, 12.3 % and 30 % cells were stained with Annexin V-FITC, suggesting IQ1 is able to induce apoptosis in A549 cells (Figure 8). In contrast, a comparatively low percentage of apoptotic cell population was observed upon treatment with 5 µM IQ2 (9.3 % at 24 h and 15 % at 48 h).

Figure 8. (a) FACS analysis of the mode of cancer cell death after treatment with 5 µM IQ1 and IQ2; Lower left (Q3), lower right (Q4), upper right (Q1) and upper left (Q2) quadrants indicate healthy cells (PI-/Annexin V-), early apoptotic (PI-/Annexin V+), late apoptotic (PI+/Annexin V+) and necrotic cells (PI+/Annexin V+), respectively. (b) Bar diagram representing apoptotic cell population induced by IQ1 and IQ2 at 24 and 48 h. Error bars represent S.D.; * indicates a p value > 0.05.

To investigate whether the observed cell death induced by IQ1 and IQ2 was due to apoptosis, a biochemical marker of apoptosis was monitored by JC-1 staining. The cationic dye JC-1 22 ACS Paragon Plus Environment

Page 22 of 47

Page 23 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolocarbo-cyanine iodide) was used to monitor the mitochondrial membrane potential (∆ψm) of cells treated with the compounds. The untreated viable cells showed a bright red fluorescence due to the aggregation of JC-1 (J-aggregates) within the mitochondria; indicative of normal ψm. Upon exposure with IQ1 and IQ2, the cells showed a time dependent increase in green fluorescence intensity (Figure 9a). IQ1 induced an increase in JC-1 green fluorescence in 64% and 97% of the cellular population at 5 µM concentration after 24 h and 48 h respectively. In comparison, IQ2 (5 µM) increased the green fluorescence in 49% and 60% cell population after 24 h and 48 h, respectively (Figure 9a). The observed increase in green fluorescence intensity indicates that IQ1 and IQ2 cause apoptosis by collapsing the mitochondrial membrane potential. In order to confirm that isoquinoline ligands could initiate the apoptotic cascade, the activation of executioner caspases 3/7 was quantitatively detected by flow cytometry using carboxyfluorescein (FAM) conjugated caspase-specific inhibitor FLICA reagent (Figure 9b). IQ1 (5 µM) activated caspases 3/7 in ∼ 78% and ∼ 90% of the cellular population at 24 h and 48 h, respectively. In comparison, ∼ 40% and ∼ 50% cells showed caspase 3/7 activation after incubation with IQ2 (5 µM) for 24 h and 48 h, respectively (Figure 9b). These results further confirm that the apoptotic cell death by IQ1 and IQ2 was mediated by caspase-3/7-dependent mechanisms.



Figure 9. (a) Mitochondrial depolarization scatter plots for IQ1 and IQ2 where polarized mitochondria are shown in red and the depolarized population are in green. Bars represent population percentages of depolarized cells on incubation with 5 µM IQ1 and IQ2 for 24 and 48 h. (b) Scatter plots and bar representation of caspase 3 and 7 activation after 24 h and 48 h incubation with IQ1 and IQ2. Error bars represent S.D.; * indicates a p value > 0.05. CONCLUSION We report the synthesis of two 6-fluoroisoquinoline derivatives IQ1 and IQ2 as a new class of telomerase inhibitors that exhibit high selectivity for human telomeric G-quadruplex. These isoquinoline derivatives exhibit relatively strong stabilization potential for telomeric quadruplex DNA over other promoter quadruplexes and duplex DNA. It is observed that IQ2 exhibits comparatively strong stabilization potential for all investigated DNA quadruplexes while IQ1 exhibits relatively high selectivity for telomeric quadruplex DNA over other DNA quadruplexes. 24 ACS Paragon Plus Environment

Page 24 of 47

Page 25 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Further biophysical studies reveal that IQ1 with pyrrolidine side chains shows relatively stronger binding affinity for telomeric quadruplex DNA as compared to IQ2. In this context, it is worth mentioning that there is no direct correlation between stabilization potential (∆Tm) and binding affinity (Kd).84 In addition, these two ligands significantly inhibit telomerase activity by possibly stabilizing telomeric quadruplex DNA. Moreover, these ligands do not reduce the c-MYC and BCL2 expression at the transcriptional level suggesting that they do not have any direct effect on c-MYC or BCL2 promoter quadruplexes thereby corroborating their selectivity for the inhibition of telomerase. Both IQ1 and IQ2 arrest the cancer cell growth at G0/G1 phase, trigger mitochondrial depolarization and activate caspases-3/7 to initiate cell apoptosis. These findings may shed new insights into design and development of potential anticancer drugs for selectively targeting DNA quadruplexes.



Page 26 of 47

EXPERIMENTAL SECTION Chemistry. All solvents and reagents were purified by standard techniques or used as supplied from commercial sources (Sigma-Aldrich Corporation® unless stated otherwise). All reactions were generally carried out under inert atmosphere unless otherwise noted. TLC was performed on Kieselgel 60 F254 plates, and spots were visualized under UV light. Products were purified by flash chromatography on silica gel (100-200 mesh). 1

H NMR spectra were recorded at 500 and 400 MHz instruments at 278 K.

13

C NMR spectra

were recorded on either 100 or 125 MHz with complete proton decoupling. Chemical shifts are reported in parts per million (ppm) and are referred to the residual solvent peak. The following notations are used: singlet (s); doublet (d); triplet (t); quartet (q); multiplet (m); broad (br). Coupling constants are quoted in Hertz and are denoted as J. Mass spectra were recorded on a Micromass® Q-Tof (ESI) spectrometer. Preparation of bis-trimethylsilyl derivative 2. A mixture of dichloro derivative 1 (1.0 g, 4.65 mmol, 1.0 equiv), PPh3 (120 mg, 0.46 mmol, 0.1 equiv) and copper iodide (35 mg, 0.186 mmol, 0.04 equiv) was taken in toluene and triethylamine (1:1, 10 mL) in a sealed tube under an argon atmosphere.89 The resulting mixture was evacuated and back filled with argon for 2-3 times. Subsequently Pd(PPh3)4 (215 mg, 0.186 mmol, 0.04 equiv) and trimethylsilylacetylene (3.9 mL, 27.9 mmol, 6 equiv.) were added. The reaction mixture was stirred at 70 °C for 2 days. After completion of the reaction, the solvent mixture was evaporated and the residue was chromatographed on silica gel (eluent: 0.5% EtOAc in hexane) to give 945 mg of 2 (60%) as a light yellow viscous liquid. 1H NMR (CDCl3, 400 MHz): 8.41-8.38 (1H, m), 7.78 (1H, s), 7.437.35 (2H, m), 0.33 (9H, s), 0.27 (9H, s);

13

C NMR (CDCl3, 125 MHz): 164.6, 162.6, 144.2,


Page 27 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


137.3, 137.2, 130.6, 130.5, 125.6, 124.2, 119.1, 118.9, 110.1, 109.9, 103.4, 101.2, 100.6, 95.3, 0.26, 0.30; HRMS (ESI): calcd for C19H23FNSi2+ [M+H]+ 340.1347, found 340.1350. Synthesis of 6-fluoroisoquinoline dialkyne 3. Compound 2 (500 mg, 1.47 mmol, 1.0 equiv) was dissolved in a mixture of MeOH and dicholoromethane (1:1, 10 mL) and to the rapidly stirred solution, K2CO3 (2.0 g, 14.7 mmol, 10 equiv) was added. The reaction mixture was stirred at rt for 4 h. Removal of the solvent in vacuo and purification of the resulting residue using flash column chromatography on silica gel (5–10 % EtOAc in hexane) afforded 3 (91 %) as a brown solid.89 1H NMR (CDCl3, 500 MHz): 8.46-8.43 (1H, m), 7.84 (1H, s), 7.46-7.40 (2H, m), 3.54 (1H, s), 3.20 (1H, s); 13C NMR (CDCl3, 125 MHz ): 164.7, 162.7, 143.6, 137.3, 137.2, 136.4, 130.4, 130.3, 125.9, 124.8, 124.7, 119.6, 119.4, 110.3, 110.1, 82.5, 82.3, 79.9, 77.7; HRMS (ESI): calcd for C13H7FN+ [M+H]+ 196.0557, found 196.0560. Synthesis of IQ190. A mixture of dialkyne 3 (200 mg, 1.02 mmol, 1.0 equiv), aliphatic azide 491 (714.5 mg, 5.1 mmol, 5.0 equiv), sodium ascorbate (40 mg, 0.2 mmol, 0.2 equiv) and CuSO4.5H2O (25 mg , 0.1 mmol, 0.1 equiv.) in 1 mL H2O-tBuOH (1:1) was taken in a microwave vial. Then the vial was sealed with a crimp cap and placed in a Biotage initiator microwave cavity. After irradiation at 70 °C for 4 h the solvent was removed in vacuum. The crude was purified by silica gel column chromatography using 5-10 % MeOH in ammoniacal DCM as eluent to afford the bis-triazole IQ1 in 81% isolated yield. 1H NMR (DMSO-d6, 500 MHz): 9.53 (1H, dd, J = 5.8, 9.4 Hz), 8.91 (1H, s), 8.72 (1H, s), 8.45 (1H, s), 7.96 (1H, dd, J = 2.5, 9.8 Hz), 7.63 (1H, dt, J = 2.5, 9.0 Hz), 4.64 (2H, t, J = 6.4 Hz), 4.59 (2H, t, J = 6.3 Hz), 3.01 (2H, t, J = 6.3 Hz), 2.97 (2H, t, J = 6.3 Hz), 2.52 (8H, merged with DMSO), 1.68 (8H, d, J = 4.5 Hz); 13C NMR (DMSO-d6, 100 MHz): 163.9, 161.4, 149.2, 147.8, 146.9, 143.9, 139.4, 139.3, 131.2, 131.1, 126.8, 123.8, 122.1, 117.9, 117.7, 114.5,



110.8, 110.6, 55.0, 54.9, 53.4, 48.9, 23.1; HRMS (ESI) calcd for C25H31FN9+ [M+H]+: 476.2681; Found: 476.2682, HPLC purity > 95.0 %. Synthesis of IQ2. A mixture of dialkyne 3 (200 mg, 1.02 mmol, 1.0 equiv), aryl azide 5 (1.26 g, 5.1 mmol, 5.0 equiv),68,69 sodium ascorbate (40 mg, 0.2 mmol, 0.2 equiv) and CuSO4.5H2O (25 mg , 0.1 mmol, 0.1 equiv.) in 1 ml H2O-tBuOH (1:1) was taken in a microwave vial. Then the vial was sealed with a crimp cap and placed in a Biotage initiator microwave cavity. After irradiation at 70 °C for 4 h the solvent was removed in vacuum. The crude was purified by silica gel column chromatography using 5-10 % MeOH in ammoniacal DCM as eluent to afford the bis-triazole IQ2 in 73% isolated yield. 1H NMR (DMSO-d6, 400MHz): 9.74 (1H, s), 9.61 (1H, dd, J = 5.7, 9.4 Hz), 9.58 (1H, s), 8.75-8.70 (2H, m,), 8.63 (1H, s), 8.23-8.06 (9H, m), 7.77-7.71 (1H, m), 3.27 (4H, merged with DMSO-H2O), 2.30 (4H, dt, J = 2.1, 7.2 Hz), 2.16 (12H, d, J = 1.5 Hz), 1.74-1.66 (4H, m); 13C NMR (DMSO-d6, 125 MHz ): 164.9, 161.8, 149.2, 148.7, 148.3, 143.1, 138.2, 138.1, 135.0, 134.7, 131.0, 128.9, 125.2, 122.4, 122.0, 120.3, 119.9, 118.6, 115.4, 111.2, 111.1, 56.9, 45.2, 37.9, 27.0 ; HRMS (ESI) calcd for C37H41FN11O2+ [M+H]+: 690.3423; Found: 690.3425, HPLC purity > 95.0 %. After column purification, IQ1 and IQ2 were further purified using HPLC with ODS-2 C18 column (250 × 4.6 mm, 5 µm) at 25 °C. The mobile phase was CH3CN/H2O (90:10) in 0.1% TFA in isocratic mode with a run time of minimum 10 min. The flow rate was maintained at 0.5 mL/min and ultraviolet (UV) detection was set at 254 nm. The injection volume was 2 µL. FRET melting analysis. FRET experiments were carried out with 200 nM oligonucleotide concentration in 60 mM potassium cacodylate buffer, pH 7.4. All HPLC purified 5’-FAM and 3’TAMRA-labeled DNA oligonucleotides were purchased from SIGMA-Aldrich and Xcelris Labs Ltd. The dual labeled DNA sequences were annealed at a concentration of 400 nM by heating at 28 ACS Paragon Plus Environment

Page 28 of 47

Page 29 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


95 °C for 5 min followed by gradual cooling to room temperature at a controlled rate of 0.1 °C/min. Fluorescence measurements were taken with an excitation wavelength of 483 nm and a detection wavelength of 533 nm at intervals of 1 °C over the range of 37-95 °C. Melting temperatures were calculated using Origin Pro 8 data analysis. The melting temperatures are determined from the mid-point of the bell shaped first derivative melting curve of the DNA sequences. The first derivative melting curve of telomeric DNA with IQ1 and IQ2 are shown in Figure S1. FRET based screening assay was performed in a 96-well plate using a real-time thermal cycler apparatus (LightCycler® 480-II System). The labeled oligonucleotides were diluted from the stock solution to the required concentration (200 nM) in 60 mM potassium cacodylate buffer (pH 7.4) and incubated with increasing concentrations of IQ1 and IQ2, separately. Competitive FRET-melting experiments were carried out in 60 mM potassium cacodylate buffer (pH 7.4) with h-TELO G-quadruplex-DNA in the presence of IQ1 or IQ2 (1.0 µM) and increasing amounts (0, 2, 10, 50 and 100 mol equiv) of unlabeled duplex DNA competitor. After an incubation step of one hour at 25 °C, measurements were made for each well. Fluorimetric titration. Spectra were recorded on a Horiba Jobin Yvon Fluoromax 3 spectrofluorometer in a 10 mm path-length quartz cuvette with filtered 100 mM Tris.KCl buffer (pH 7.4). All experiments were carried out in 0.5 mL final volume of Tris.KCl buffer containing 0.5 µM IQ1 or IQ2. Titrations were carried out with the successive addition of different preannealed G-quadruplex DNAs and dsDNA. All the binding constants of the fluorescence spectral data have been calculated using the following Hill 1 equation with the help of Origin Pro 8.0: ‫ܨ = ܨ‬଴ +

ሺ‫ܨ‬௠௔௫ − ‫ܨ‬଴ ሻ[‫]ܣܰܦ‬ ‫ܭ‬ௗ + [‫]ܣܰܦ‬



F is the fluorescence intensity, Fmax is the maximum fluorescence intensity, F0 is the fluorescence intensity in the absence of DNA and Kd is the dissociation constant. NMR titration experiment. NMR experiments were performed using c-MYC or h-TELO DNA purchased by Eurofins MWG Operon (Ebersberg, Germany) as HPSF® (High Purity Salt Free) purified oligos and further purified via HPLC. All NMR samples were referenced with 2,2dimethyl-2-silapentane-5-sulphonate (DSS) and prepared in buffer containing 25 mM Tris⋅HCl at pH 7.4 and 100 mM KCl, in either 90% H2O / 10% D2O (IQ2 titration) or 90% H2O / 10% d6DMSO (IQ1 titration). 1H-NMR spectra were recorded using either gradient-assisted excitation sculpting92 or jump-return-Echo93 for water suppression. Circular dichroism spectroscopic titration. CD spectra were recorded on a JASCO J-815 spectrophotometer by using a 1 mm path length quartz cuvette. Aliquots of compounds (IQ1 or IQ2) were added in increments to the pre-annealed G-quadruplex DNA in Tris.KCl (100 mM) buffer at pH 7.4. The DNA concentration used was 10 µM. The CD spectra represented an average of three scans and were smoothed and zero corrected. Final analysis and manipulation of the data was carried out by using Origin 8.0. Cell Culture Conditions: Human lung carcinoma cell line A549, human cervical cancer cell line HeLa, leukemic T cell line Jurkat E6.1 and normal cell line C2C12 were procured from the cell repository of NCCS, Pune, India. NKE cell line was provided by Dr. Prosenjit Sen, IACS. A549 cells were cultured in Ham’s F12K (Himedia) medium. NKE (human normal kidney epithelium cell line) and Jurkat cells were grown in RPMI 1640 (GIBCO) media. Other two cell lines HeLa and C2C12 were grown in DMEM. The media were supplemented with 10% FBS (GIBCO), 1% anti-anti (GIBCO) and maintained at 37 °C with 5% CO2.


Page 30 of 47

Page 31 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


XTT cell viability assay. It is a colorimetric assay used to assess cell viability as a function of cell number based on metabolic activity. XTT (2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5[(phenylamino)carbonyl]-2H-tetrazolium hydroxide) is a tetrazolium reagent which is metabolically reduced in viable cells to a water-soluble formazan product in presence of phenazine methosulfate (PMS). Viability experiments were performed in triplicate on 96-well plates at designated time and dose points. Cells were grown at a density of 104-105 cells/well in 100 µL of culture medium and treated with increasing concentrations of the compounds (IQ1 or IQ2) and incubated for 24, 48 and 72 h. The XTT/PMS reagent was prepared by mixing 4 mg of XTT in 4 mL of culture medium followed by the addition of 10 µL of 10 mM PMS solution (in PBS). 25 µL of this freshly prepared reagent mixture was then directly added to each well containing 100 µL of culture media and incubated for 2 h at 37 °C. The absorbance of XTT formazan was read at 450 nm on Multiskan FC microplate spectrophotometer (Thermo Scientific). Percentage cell viability was calculated by using the following equation: % of cell viability =

ை.஽. ௢௙ ௧௥௘௔௧௘ௗ ௖௘௟௟௦ ை.஽.௢௙ ௨௡௧௥௘௔௧௘ௗ ௖௢௡௧௥௢௟ ௖௘௟௟௦

× 100

In-vitro TRAP-LIG assay. Telomerase enzyme activity in presence of compounds was measured as per the protocol of the PCR-based TRAP kit (TRAPeze® Telomerase Detection KitMerck Millipore). Cells were grown overnight and telomerase protein was isolated by simple cell-lysis in CHAPS lysis buffer provided in the kit. In this assay 1.5 µg of cell extract was used for each sample. Before the final PCR step, the bound ligands were removed and the elongated products were purified by extracting the DNA with phenol/chloroform/isoamyl alcohol (50:48:2). Then the DNA was precipitated overnight at – 80 °C. Reaction products were 31 ACS Paragon Plus Environment


amplified in the presence of a 36 bp internal standard according to the kit protocol. Negative control was prepared by adding no cell extract. Samples were separated on 12.5 % Native PAGE and visualized with EtBr staining. Gel images were acquired using a gel scanner (Life technology) and the band intensity data were obtained by ImageJ software. Quantitative analysis was carried out by integrating the total intensity of each PCR product ladder. The obtained values were corrected by subtracting the signal intensity of negative control. Confocal laser scanning microscopy. Cells were cultured in glass-bottomed cover slips and incubated with 5 µM of IQ1 and IQ2, separately for 24 h inside CO2 (5%) incubator at 37 °C. Cells were washed with 1x PBS twice and fixed in ice-cold 1:1 acetone-methanol for 12 min at 20 °C. Cells were further washed thrice with 1x PBS and was finally stained with NucRed-647 live. Images were taken in Olympus confocal laser scanning microscope (model IX81, ver 4.1). The raw data was analyzed in Fluoview FV10-ASW V4.2 software. Western Blot analysis. Cells were grown at a density of 1x106 cells/mL and treated with the compounds for the time period desired at 37 °C/5% CO2. Cells were then washed with 1x PBS and lysed in cell lysis buffer (150 mM NaCl, 1% Triton X 100, 1 mM EDTA and 50mM Tris.HCl, pH 8.0) on ice for 30 min. Protein was collected from the supernatant obtained after centrifugation of the cell lysate at 14000 rpm for 20 min at 4 °C. Protein was quantitated by Folin Lowry method and 70 µg of protein was loaded onto 12 % SDS-PAGE Gels, electrophoresed at 90 V to obtain sufficient separation and transferred onto the nitrocellulose membranes. The blots were blocked with 4% BSA, probed with primary antibodies (1:700 dilution) in 0.4 % BSA at concentrations designated by the manufacturer and gently rotated overnight. Blots were washed with TBST (1x) three times prior to incubation with polyclonal secondary antibodies (1:2000 dilution) for 2 hr. Then washing had been carried out for three 32 ACS Paragon Plus Environment

Page 32 of 47

Page 33 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


times more with TBST and imaged with NBT/BCIP or TMB substrate in dark. Relative band intensities were determined by using ImageJ software. Primary antibodies used: Anti c-MYC antibody - Rabbit origin (Invitrogen) Anti BCL2 antibody - Rabbit origin (SIGMA Aldrich) Anti BAX antibody - Mouse origin (SIGMA Aldrich) Anti GAPDH antibody - Mouse origin (Invitrogen) Dual luciferase reporter assay. A549 cells were cultured in 500 µL Ham’s F12K supplemented with 10 % FBS and 1 % anti-anti overnight at 37 °C, 5 % CO2. 0.2 µg of c-MYC Del4 plasmid construct (Addgene plasmid # 16604-Del4) and 0.5 µg of BCL2 promoter construct (Addgene plasmid # 15381-LB322) was transfected into A549 cells using Lipofectamine 2000 (Invitrogen). A Renilla luciferase plasmid, pRL-TK (0.030 µg) was cotransfected with each construct for normalization. Transfection was performed in serum-free medium, which was replaced by complete media after a 7 h incubation at 37 °C, 5% CO2. After a further 48 h incubation with ligands IQ1 and IQ2, cells were lysed with passive lysis buffer, and Firefly and Renilla luciferase activities were measured using the dual-luciferase reporter assay kit (Promega). Luciferase activities were expressed as relative luciferase units (RLUs) by normalizing to the Renilla expression. Each transfection experiment was run in duplicates. Cell cycle analysis. Cells were seeded in six-well plates at a density of 1 × 106 cells per well and allowed to grow for 24 h before the addition of ligands IQ1 and IQ2. Cells were treated with IQ1 and IQ2 for different times (24 h and 48 h). Then, cells were washed by PBS, trypsinized, and collected by centrifugation at 3000 RPM, washed once with cold PBS. Cells were then fixed with 2 mL ice-cold 70% ethanol, incubated overnight at 4 °C, pelleted, and resuspended in 350 µL PBS containing 0.2 µg/ mL RNase A (Invitrogen) and 5 µL of 1 mg/mL propidium iodide 33 ACS Paragon Plus Environment


(PI) at 37 °C for 30 min in dark. Cell distribution among cell cycle phases were collected on flow cytometer. A total of 10,000 events were recorded. Apoptosis detection. A549 cells were seeded at a density of 1x106 cells/mL in each well of a six-well plate and allowed to grow overnight. Cells were treated with the compounds for the desired time period at 37 °C. Untreated cells were considered as the positive control. The cells were trypsinized, repeatedly washed with cold PBS and centrifuged at 1800 RPM for 5 min and the supernatants were discarded. Cells were then resuspended in 350 µL of 1X Annexin-V binding buffer (0.01M HEPES, pH 7.4, 0.14M NaCl, 2.5mM CaCl2) and treated with 5 µL Annexin V-FITC and 2 µL propidium iodide (1 mg/mL). After incubation for 5 min on ice, each sample was analysed immediately using fluorescence-activated cell sorting (FACS) analysis (BD Biosciences, Mountain View, CA, USA). Approximately 10,000 cells were detected for each sample. JC-1 Assay. A549 cells were cultured on a 6-well culture plate at a density of 1x106 cells/mL and allowed to grow overnight at 37 °C. Cells were treated with IQ1 and IQ2 for 24 h and 48 h at 5 µM concentration. After incubation with the compounds, the cells were collected by trypsinization and resuspended in 500 µL of warm complete media. A solution of JC-1 reagent was added at a final concentration of 2 µM and incubated at 37 °C with 5% CO2 for 30 min. The cells were washed 3 times with warm PBS and isolated by centrifugation (1,800 rpm for 5 min at 4 °C). The resulting cell pellet was then resuspended in 350 µL PBS and analysed on the flow cytometer. Caspase 3/7 activity measurements. The FLICA (fluorescent labeled inhibitors of Caspase) reagent FAM-DEVD-FMK was used to monitor the activation of caspase 3/7. After 24 h and 48 h incubation with IQ1 and IQ2, cells were detached with trypsin and resuspended in 300 µL 34 ACS Paragon Plus Environment

Page 34 of 47

Page 35 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


culture media in flow-tubes. Then 10 µL of a 30× FLICA reagent was added and mixed by flickling the tubes and incubated for 1 hr at 37 °C/5% CO2. The tubes were thoroughly mixed twice during the 1 h incubation in darkness. The cells were then collected by centrifugation and resuspended in 1× wash buffer. Centrifugation and buffer washes were repeated twice. Finally cells were resuspended in 350 µL of wash buffer and measured on flow cytometer as previously indicated. ASSOCIATED CONTENT Supporting Information NMR data, CD spectroscopic data, additional data of FRET and fluorescence titration, NMR titration and cytotoxicity data. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author *Phone: +91 33 2473 4971, Ext 1405. E-mail: [email protected]. Author Contributions ‡These authors contributed equally. Notes The authors declare no competing financial interests. ACKNOWLEDGMENT We thank DST and DBT India for funding. JD thanks DST for a SwarnaJayanti fellowship. TD thanks DBT for a research fellowship. The authors thank Mr Tanmoy Dalui for FACS analysis, 35 ACS Paragon Plus Environment


Indian Institute of Chemical Biology, Kolkata, Mr Arijit Pal for confocal microscopy, DBT-IPLS unit, University of Calcutta. REFERENCES (1) Hurley, L. H. (2002) DNA and its associated processes as targets for cancer therapy. Nat. Rev. Cancer 2, 188–200. (2) Lipps, H. J., and Rhodes, D. (2009) G-quadruplex structures: in vivo evidence and function. Trends Cell Biol. 19, 414–422. (3) Balasubramanian, S., Hurley, L. H., and Neidle, S. (2011) Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nat. Rev. Drug. Discov. 10, 261–275. (4) Murat, P., and Balasubramanian, S. (2014) Existence and consequences of G-quadruplex structures in DNA. Curr. Opin. Genet. Dev. 25, 22–29. (5) Neidle, S. (2016) Quadruplex nucleic acids as novel therapeutic targets. J. Med. Chem. 59, 5987–6011. (6) Hansel-Hertsch, R., Di Antonio, M., and Balasubramanian, S. (2017) DNA G-quadruplexes in the human genome: detection, functions and therapeutic potential. Nat. Rev. Mol. Cell. Bio. 18, 279–284. (7) Neidle, S. (2017) Quadruplex nucleic acids as targets for anticancer therapeutics. Nat. Rev. Chem. 1, 0041. (8) Monchaud, D., and Teulade-Fichou, M. P. (2008) A hitchhiker's guide to G-quadruplex ligands. Org. Biomol. Chem. 6, 627–636. (9) Collie, G. W., and Parkinson, G. N. (2011) The application of DNA and RNA Gquadruplexes to therapeutic medicines. Chem. Soc. Rev. 40, 5867–5892.


Page 36 of 47

Page 37 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(10) Rodriguez, R., Miller, K. M., Forment, J. V., Bradshaw, C. R., Nikan, M., Britton, S., Oelschlaegel, T., Xhemalce, B., Balasubramanian, S. and Jackson, S. P. (2012) Small-moleculeinduced DNA damage identifies alternative DNA structures in human genes. Nat. Chem. Biol. 8, 301–310. (11) Rhodes, D., and Lipps, H. J. (2015) G-quadruplexes and their regulatory roles in biology. Nucleic Acids Res. 43, 8627–8637. (12) Moyzis, R. K., Buckingham, J. M., Cram, L. S., Dani, M., Deaven, L. L., Jones, M. D., Meyne, J., Ratliff, R. L., and Wu, J. R. (1988) A highly conserved repetitive DNA-sequence, (TTAGGG)n, present at the telomeres of human chromosomes. P. Natl. Acad. Sci. U.S.A. 85, 6622–6626. (13) Wright, W. E., Tesmer, V. M., Huffman, K. E., Levene, S. D., and Shay, J. W. (1997) Normal human chromosomes have long G-rich telomeric overhangs at one end. Gene Dev. 11, 2801– 2809. (14) Biffi, G., Tannahill, D., McCafferty, J., and Balasubramanian, S. (2013) Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 5, 182–186. (15) Huppert, J. L., and Balasubramanian, S. (2007) G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res. 35, 406–413. (16) Huppert, J. L. (2008) Four-stranded nucleic acids: structure, function and targeting of Gquadruplexes. Chem. Soc. Rev. 37, 1375–1384. (17) Lei, M., Podell, E. R., and Cech, T. R. (2004) Structure of human POT1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat. Struct. Mol. Biol. 11, 1223–1229. (18) Zakian, V. A. (1989) Structure and function of telomeres. Annu. Rev. Genet. 23, 579–604. 37 ACS Paragon Plus Environment


(19) Blackburn, E. H. (1991) Structure and function of telomeres. Nature 350, 569–573. (20) Rhodes, D., and Giraldo, R. (1995) Telomere structure and function. Curr. Opin. Struc. Biol. 5, 311–322. (21) de Lange, T. (2005) Shelterin: the protein complex that shapes and safeguards human telomeres. Gene Dev. 19, 2100–2110. (22) Masutomi, K., Yu, E. Y., Khurts, S., Ben-Porath, I., Currier, J. L., Metz, G. B., Brooks, M. W., Kaneko, S., Murakami, S., DeCaprio, J. A., et al. (2003) Telomerase maintains telomere structure in normal human cells. Cell 114, 241–253. (23) Osterhage, J. L., and Friedman, K. L. (2009) Chromosome end maintenance by telomerase. J. Biol. Chem. 284, 16061–16065. (24) Lin, S. Y., and Elledge, S. J. (2003) Multiple tumor suppressor pathways negatively regulate telomerase. Cell 113, 881–889. (25) Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L. C., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011–2015. (26) Haider, S., Parkinson, G. N., and Neidle, S. (2002) Crystal structure of the potassium form of an Oxytricha nova G-quadruplex. J. Mol. Biol. 320, 189–200. (27) Neidle, S., and Parkinson, G. N. (2003) The structure of telomeric DNA. Curr. Opin. Struc. Biol. 13, 275–283. (28) Patel, D. J., Phan, A. T., and Kuryavyi, V. (2007) Human telomere, oncogenic promoter and 5'-UTR G-quadruplexes: Diverse higher order DNA and RNA targets for cancer therapeutics. Nucleic Acids Res. 35, 7429–7455.


Page 38 of 47

Page 39 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Phan, A. T. (2010) Human telomeric G-quadruplex: structures of DNA and RNA sequences. Febs J. 277, 1107–1117. (30) Zahler, A. M., Williamson, J. R., Cech, T. R., and Prescott, D. M. (1991) Inhibition of telomerase by G-quartet DNA structures. Nature 350, 718–720. (31) Neidle, S. (2010) Human telomeric G-quadruplex: The current status of telomeric Gquadruplexes as therapeutic targets in human cancer. Febs J. 277, 1118–1125. (32) Burger, A. M., Dai, F. P., Schultes, C. M., Reszka, A. P., Moore, M. J., Double, J. A., and Neidle, S. (2005) The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res. 65, 1489–1496. (33) Das, R. N., Debnath, M., Gaurav, A., and Dash, J. (2014) Environment-sensitive probes containing a 2,6-Diethynylpyridine motif for fluorescence turn-on detection and induction of nanoarchitectures of human telomeric quadruplex. Chem-Eur. J. 20, 16688–16693. (34) Phatak, P., Cookson, J. C., Dai, F., Smith, V., Gartenhaus, R. B., Stevens, M. F. G., and Burger, A. M. (2007) Telomere uncapping by the G-quadruplex ligand RHPS4 inhibits clonogenic tumour cell growth in vitro and in vivo consistent with a cancer stem cell targeting mechanism. Brit. J. Cancer 96, 1223–1233. (35) Salvati, E., Leonetti, C., Rizzo, A., Scarsella, M., Mottolese, M., Galati, R., Sperduti, I., Stevens, M. F. G., D'Incalci, M., Blasco, M., et al. (2007) Telomere damage induced by the Gquadruplex ligand RHPS4 has an antitumor effect. J. Clin. Invest. 117, 3236–3247. (36) Shin-ya, K., Wierzba, K., Matsuo, K., Ohtani, T., Yamada, Y., Furihata, K., Hayakawa, Y., and Seto, H. (2001) Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J. Am. Chem. Soc. 123, 1262–1263. 39 ACS Paragon Plus Environment


(37) Kim, M. Y., Vankayalapati, H., Kazuo, S., Wierzba, K., and Hurley, L. H. (2002) Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J. Am. Chem. Soc. 124, 2098–2099. (38) Rodriguez, R., Muller, S., Yeoman, J. A., Trentesaux, C., Riou, J. F., and Balasubramanian, S. (2008) A novel small molecule that alters shelterin integrity and triggers a DNA-damage response at telomeres. J. Am. Chem. Soc. 130, 15758–15759. (39) Riou, J. F., Guittat, L., Mailliet, P., Laoui, A., Renou, E., Petitgenet, O., Megnin-Chanet, F., Helene, C., and Mergny, J. L. (2002) Cell senescence and telomere shortening induced by a new series of specific G-quadruplex DNA ligands. P. Natl. Acad. Sci. U.S.A. 99, 2672–2677. (40) Gueddouda, N. M., Hurtado, M. R., Moreau, S., Ronga, L., Das, R. N., Savrimoutou, S., Rubio, S., Marchand, A., Mendoza, O., Marchivie, M., et al. (2017) Design, synthesis, and evaluation of 2,9-bis[(substituted-aminomethyl)phenyl]-1,10-phenanthroline derivatives as Gquadruplex ligands. Chemmedchem 12, 146–160. (41) Maji, B., and Bhattacharya, S. (2014) Advances in the molecular design of potential anticancer agents via targeting of human telomeric DNA. Chem. Commun. 50, 6422–6438. (42) Doi, T., Yoshida, M., Shin-ya, K., and Takahashi, T. (2006) Total Synthesis of (R)Telomestatin. Org. Lett. 8, 4165–4167. (43) Yang, D. Z., and Okamoto, K. (2010) Structural insights into G-quadruplexes: towards new anticancer drugs. Future Med. Chem. 2, 619–646. (44) Philipson, J. D., Roberts, M. F, and Zenk, M. H. (1985) The chemistry and biology of isoquinoline alkaloids, Springer Verlag: Berlin. (45) Bentley, K. W. (1998) The isoquinoline alkaloids, Harwood Academic: Amsterdam, Vol- 1.


Page 40 of 47

Page 41 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(46) Bentley, K. W. (2002) beta-phenylethylamines and the isoquinoline alkaloids. Nat. Prod. Rep. 19, 332–356. (47) Maiti, M., and Kumar, G. S. (2010) Polymorphic nucleic acid binding of bioactive isoquinoline alkaloids and their role in cancer. J. Nucleic Acids 2010, 593408. (48) Bhadra, K., and Kumar, G. S. (2011) Therapeutic potential of nucleic acid-binding isoquinoline alkaloids: binding aspects and implications for drug design. Med. Res. Rev. 31, 821– 862. (49) Ferraroni, M., Bazzicalupi, C., Bilia, A. R., and Gratteri, P. (2011) X-Ray diffraction analyses of the natural isoquinoline alkaloids Berberine and Sanguinarine complexed with double helix DNA d(CGTACG). Chem. Commun. 47, 4917–4919. (50) Cushman, M., Dekow, F. W., and Jacobsen, L. B. (1979) Conformations, DNA binding parameters, and antileukemic activity of certain cytotoxic protoberberine alkaloids. J. Med. Chem. 22, 331–333. (51) Franceschin, M., Rossetti, L., D'Ambrosio, A., Schirripa, S., Bianco, A., Ortaggi, G., Savino, M., Schultes, C., and Neidle, S. (2006) Natural and synthetic G-quadruplex interactive berberine derivatives. Bioorg. Med. Chem. Lett. 16, 1707–1711. (52) Zhang, W. J., Ou, T. M., Lu, Y. J., Huang, Y. Y., Wu, W. B., Huang, Z. S., Zhou, J. L., Wong, K. Y., Gu, L. Q. (2007) 9-Substituted berberine derivatives as G-quadruplex stabilizing ligands in telomeric DNA. Bioorg. Med. Chem. 15, 5493–5501. (53) Ma, Y., Ou, T. M., Hou, J. Q., Lu, Y. J., Tan, J. H., Gu, L. Q., and Huang, Z. S. (2008) 9-Nsubstituted berberine derivatives: stabilization of G-quadruplex DNA and down-regulation of oncogene c-myc. Bioorg. Med. Chem. 16, 7582–7591.



(54) Bessi, I., Bazzicalupi, C., Richter, C., Jonker, H.R., Saxena, K., Sissi, C., Chioccioli, M., Bianco, S., Bilia, A.R., Schwalbe, H., et al. (2012) Spectroscopic, molecular modeling, and NMR-spectroscopic investigation of the binding mode of the natural alkaloids berberine and sanguinarine to human telomeric G-quadruplex DNA. ACS Chem. Biol. 7, 1109–1119. (55) Bazzicalupi, C., Ferraroni, M., Bilia, A. R., Scheggi, F., Gratteri, P. (2013) The crystal structure of human telomeric DNA complexed with berberine: An interesting case of stacked ligand to G-tetrad ratio higher than 1:1. Nucleic Acids Res. 41, 632–638. (56) Rocca, R., Moraca, F., Costa, G., Alcaro, S., Distinto, S., Maccioni, E., Ortuso, F., Artese, A., and Parrotta, L. (2014) Structure-based virtual screening of novel natural alkaloid derivatives as potential binders of h-telo and c-myc DNA G-quadruplex conformations. Molecules, 20, 206– 223.(57) Noureini, S.K., Esmaeili, H., Abachi, F., Khiali, S., Islam, B., Kuta, M., Saboury, A. A., Hoffmann, M., Sponer, J., Parkinson, G. et al. (2017) Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (tFRET) assay. BBA-General Subjects, 1861, 2020–2030. (58) Isanbor, C., and O'Hagan, D. (2006) Fluorine in medicinal chemistry: A review of anticancer agents. J. Fluorine Chem. 127, 303–319. (59) Ojima, I. (2994) Use of fluorine in the medicinal chemistry and chemical biology of bioactive compounds - A case study on fluorinated taxane anticancer agents. Chembiochem 5, 628–635. (60) Rostovtsev, V. V., Green, L. G., Fokin, V. V. and Sharpless, K. B. (2002) A stepwise huisgen cycloaddition process: copper (I)‐catalyzed regioselective “ligation” of azides and terminal alkynes. Angew. Chem. 114, 2708–2711. 42 ACS Paragon Plus Environment

Page 42 of 47

Page 43 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(61) Moorhouse, A. D., Santos, A. M., Gunaratnam, M., Moore, M., Neidle, S., and Moses, J. E. (2006) Stabilization of G-quadruplex DNA by highly selective ligands via click chemistry. J. Am. Chem. Soc. 128, 15972–15973. (62) Drewe, W. C. and Neidle, S. (2008) Click chemistry assembly of G-quadruplex ligands incorporating a diarylurea scaffold and triazole linkers. Chem. Commun. 42, 5295–5297. (63) Garner, T. P., Williams, H. E. L., Gluszyk, K. I., Roe, S., Oldham, N. J., Stevens, M. F. G., Moses, J. E., and Searle, M. S. (2009) Selectivity of small molecule ligands for parallel and antiparallel DNA G-quadruplex structures. Org. Biomol. Chem. 7, 4194–4200. (64) Ritson, D. J., and Moses, J. E. (2012) A fragment based click chemistry approach towards hybrid G-quadruplex ligands: design, synthesis and biophysical evaluation. Tetrahedron 68, 197–203. (65) Haider, S. M., Parkinson, G. N., and Neidle, S. (2003) Structure of a G-quadruplex-ligand complex. J. Mol. Biol. 326, 117–125. (66) Campbell, N. H., Parkinson, G. N., Reszka, A. P., and Neidle, S. (2008) Structural basis of DNA quadruplex recognition by an acridine drug. J. Am. Chem. Soc. 130, 6722–6724. (67) Campbell, N. H., Patel, M., Tofa, A. B., Ghosh, R., Parkinson, G. N., and Neidle, S. (2009) Selectivity in ligand recognition of G-quadruplex loops. Biochemistry 48, 1675–1680. (68) Panda, D., Debnath, M., Mandal, S., Bessi, I., Schwalbe, H., and Dash, J. (2015) A nucleusimaging probe that selectively stabilizes a minor conformation of c-MYC G-quadruplex and down-regulates c-MYC transcription in human cancer cells. Sci. Rep. 5,13183.



(69) Panda. D., Saha. P., Das. T., and Dash. J. (2017) Target guided synthesis using DNA nanotemplates for selectively assembling a G-quadruplex binding c-MYC inhibitor. Nat. Commun. 8, 16103. (70) De Cian, A., Guittat, L., Kaiser, M., Sacca, B., Amrane, S., Bourdoncle, A., Alberti, P., Teulade-Fichou, M. P., Lacroix, L., and Mergny, J. L. (2007) Fluorescence-based melting assays for studying quadruplex ligands. Methods 42, 183–195. (71) Wang, Y., and Patel, D. J. (1993) Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure 15, 263–282. (72) Siddiqui-Jain, A., Grand, C. L., Bearss, D. J., and Hurley, L. H. (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. P. Natl. Acad. Sci. U.S.A. 99, 11593–11598. (73) Dai, J. X., Dexheimer, T. S., Chen, D., Carver, M., Ambrus, A., Jones, R. A., and Yang, D. Z. (2006) An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution. J. Am. Chem. Soc. 128, 1096–1098. (74) Dai, J. X., Chen, D., Jones, R. A., Hurley, L. H., and Yang, D. Z. (2006) NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region. Nucleic Acids Res. 34, 5133–5144. (75) Cogoi, S., and Xodo, L. E. (2006) G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription. Nucleic Acids Res. 34, 2536–2549.


Page 44 of 47

Page 45 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(76) Rankin, S., Reszka, A. P., Huppert, J., Zloh, M., Parkinson, G. N., Todd, A. K., Ladame, S., Balasubramanian, S., and Neidle, S. (2005) Putative DNA quadruplex formation within the human c-kit oncogene. J. Am. Chem. Soc. 127, 10584−10589. (77) Fernando, H., Reszka, A. P., Huppert, J., Ladame, S., Rankin, S., Venkitaraman, A. R., Neidle, S., and Balasubramanian, S. (2006) A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene. Biochemistry 45, 7854−7860. (78) Luu, K. N., Phan, A. T., Kuryavyi, V., Lacroix, L., and Patel, D. J. (2006) Structure of the human telomere in K+ solution: An intramolecular (3+1) G-quadruplex scaffold. J. Am. Chem. Soc. 128, 9963–9970. (79) Ambrus, A., Chen, D., Dai, J., Jones, R., A., and Yang, D. (2005) Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter, implications for GQuadruplex stabilisation. Biochemistry 44, 2048–2058. (80) Dai, J., Carver, M., Hurley, L. H., and Yang, D. (2011) Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design. J. Am. Chem. Soc. 44, 17673–17680. (81) Maji, B., Kumar, K., Kaulage, M., Muniyappa, K., and Bhattacharya, S. (2014) Design and synthesis of new benzimidazole-carbazole conjugates for the stabilization of human telomeric DNA, telomerase inhibition, and their selective action on cancer cells. J. Med. Chem. 57, 6973– 6988. (82) Jain, A. K., Paul, A., Maji, B., Muniyappa, K., and Bhattacharya, S. (2012) Dimeric 1,3-Phenylene-bis(piperazinyl benzimidazole)s: Synthesis and structure-activity investigations on their binding with human telomeric G-quadruplex DNA and telomerase inhibition properties. J. Med. Chem. 55, 2981–2993.



(83) Mathad, R. I., Hatzakis, E., Dai, J. X., Yang, D. Z. (2011) c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallelstranded G-quadruplex stability. Nucleic Acids Res. 39, 9023–9033. (84) Reed, J., Gunaratnam, M., Beltran, M., Reszka, A. P., Vilar, R., and Neidle, S. (2008) TRAP−LIG, a modified telomere repeat amplification protocol assay to quantitate telomerase inhibition by small molecules. Anal. Biochem. 380, 99−105. (85) Zheng, X. -H., Nie, X., Liu, H.-Y., Fang, Y.-M., Zhao, Y., and Xia L.-X. (2016) TMPyP4 promotes cancer cell migration at low doses, but induces cell death at high doses. Sci. Rep. 6, 26592. (86) He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Identification of c-MYC as a target of the APC pathway. Science 281, 1509–1512. (87) Heckman, C. A., Mehew, J. W., Ying, G. G., Introna, M., Golay, J, and Boxer, L. M. (2000) A-Myb up-regulates Bcl-2 through a Cdx binding site in t(14,18) lymphoma cells. J. Biol. Chem. 275, 6499–6508. (88) Lopes, J., Piazza, A., Bermejo, R., Kriegsman, B., Colosio, A., Teulade-Fichou, M. P., Foiani, M., and Nicolas, A. (2011) G-quadruplex-induced instability during leading-strand replication. Embo J. 30, 4033–4046. (89) Dash, J., Shirude, P. S., Hsu, S. T. D., and Balasubramanian, S. (2008) Diarylethynyl amides that recognize the parallel conformation of genomic promoter DNA G-quadruplexes. J. Am. Chem. Soc. 130, 15950–15956.


Page 46 of 47

Page 47 of 47 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(90) Midya, G. C., Paladhi, S., Bhowmik, S., Saha, S., and Dash, J. (2013) Design and synthesis of an on-off "click" fluorophore that executes a logic operation and detects heavy and transition metal ions in water and living cells. Org. Biomol. Chem. 11, 3057–3063. (91) Dash, J., Waller, Z. A. E., Pantos, G. D., and Balasubramanian, S. (2011) Synthesis and binding studies of novel diethynyl-pyridine amides with genomic promoter DNA Gquadruplexes. Chem-Eur. J. 17, 4571–4581. (92) Hwang, T. L., and Shaka, A. J. (1995) Water suppression that works. excitation sculpting using arbitrary wave-forms and pulsed-field gradients. J. Magn. Res. Series A 112, 275–279. (93) Sklenar, V., and Bax, A. (1987) Spin-echo water suppression for the generation of purephase two-dimensional NMR spectra J. Magn. Res. 74, 469–479.

TOC


Human Telomeric G-quadruplex Selective Fluoro-isoquinolines

Recommend Documents