Identification of Microbial Populations Assimilating Nitrogen from RDX

Aug 2, 2013 - RDX in Munitions Contaminated Military Training Range Soils by ... triazine) from particulates deposited in live-fire military training ...
1 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/est

Identification of Microbial Populations Assimilating Nitrogen from RDX in Munitions Contaminated Military Training Range Soils by High Sensitivity Stable Isotope Probing Peter Andeer,† David A. Stahl,†,‡ Lorraine Lillis,† and Stuart E. Strand*,† †

Department of Civil and Environmental Engineering, University of Washington, 201 More Hall, Seattle, Washington 98195-2700, United States ‡ Department of Microbiology, University of Washington, Seattle, Washington 98195-7242, United States S Supporting Information *

ABSTRACT: The leaching of RDX (hexahydro-1,3,5-trinitro-1,3,5triazine) from particulates deposited in live-fire military training range soils contributes to significant pollution of groundwater. In situ microbial degradation has been proposed as a viable method for onsite containment of RDX. However, there is only a single report of RDX degradation in training range soils and the soil microbial communities involved in RDX degradation were not identified. Here we demonstrate aerobic RDX degradation in soils taken from a target area of an Eglin Air Force Base bombing range, C52N Cat’s Eye, (Eglin, Florida U.S.A.). RDX-degradation activity was spatially heterogeneous (found in less than 30% of initial target area field samples) and dependent upon the addition of exogenous carbon sources to the soils. Therefore, biostimulation (with exogenous carbon sources) and bioaugmentation may be necessary to sustain timely and effective in situ microbial biodegradation of RDX. High sensitivity stable isotope probing analysis of extracted soils incubated with fully labeled 15N-RDX revealed several organisms with 15N-labeled DNA during RDX-degradation, including xplA-bearing organisms. Rhodococcus was the most prominent genus in the RDX-degrading soil slurries and was completely labeled with 15N-nitrogen from the RDX. Rhodococcus and Williamsia species isolated from these soils were capable of using RDX as a sole nitrogen source and possessed the genes xplB and xplA associated with RDX-degradation, indicating these genes may be suitable genetic biomarkers for assessing RDX degradation potential in soils. Other highly labeled species were primarily Proteobacteria, including: Mesorhizobium sp., Variovorax sp., and Rhizobium sp.

■

INTRODUCTION The leaching of high explosives into groundwater from live-fire ranges is of increasing concern, for example, as highlighted by the detection of RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) in a drinking water aquifer near the Army training range, Camp Edwards (Cape Cod, MA).1 RDX in groundwater originates from the dissolution of high explosives particles dispersed from low-order (incomplete) ordnance detonations.2 RDX contamination of soils on military range target areas differ from point source contamination because the ultimate source of the RDX is particulate matter. This leads to a highly heterogeneous dispersal of RDX and wide ranges of concentrations, as high as 1.3 g RDX/kg soil under explosive particles in a recent field study.3 To prevent RDX from leaching into groundwater from military range soils, effective containment strategies are needed that are applicable to large areas of surface soils contaminated with particulate high explosives. Possible strategies include in situ microbial RDX degradation in training range surface soils where RDX concentrations tend to be highest.1,3 Thus, promotion of aerobic microbial RDX degradation in these © 2013 American Chemical Society

soils may be the most effective way to prevent RDX intrusion into the soil column. Research on the RDX-degradation potential of microbial communities in military range surface soils is limited4 and putative RDX-degraders in range soils have not been identified. However, bacteria capable of degrading RDX have been identified in a variety of other munitions contaminated environments using conventional techniques5−17 and stable isotope probing (SIP).18,19 The previous 15N-SIP work identified several fragments in a density gradient, but the degree of 15N enrichment of those fragments was not determined.18 The only bacterial isolates capable of using RDX as a sole nitrogen source during aerobic growth are a number of Actinobacteria, most commonly Rhodoccocus spp., that possess the xplA gene, which encodes a novel RDX-degrading Received: Revised: Accepted: Published: 10356

April 22, 2013 August 2, 2013 August 2, 2013 August 2, 2013 dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363

Environmental Science & Technology

Article

cytochrome P450 (XplA).5,6,13,20,21 However, it is unknown whether xplA-bearing organisms are present in military range soils and could be used to promote in situ RDX degradation. The ability of organisms to grow on RDX as a sole nitrogen source makes SIP with 15N-labeled RDX an attractive cultureindependent method for identifying potential RDX degraders.18 Under oxic conditions, several bioavailable nitrogenous compounds result from RDX degradation including: nitrite, ammonium, NDAB (4-nitro-2,4-diazabutanal), MEDINA (methylenedinitramine), and formamide.22 Research has demonstrated that nitrite, which is liberated prior to ring cleavage, is the primary form of nitrogen produced by RDX by xplA-bearing organisms. Therefore, to properly label these xplA-bearing populations for SIP analysis, at least under aerobic growth, it is important to use RDX with 15N-labeled nitro groups. Here, we present studies designed to evaluate both the potential for in situ RDX-degradation in military range soils and to identity microbial populations that contribute to degradation. Surface soils were screened for aerobic RDX degradation and the presence of the xplA gene. Active degradation was demonstrated in multiple samples when stimulated by the addition of exogenous carbon. Addition of fully labeled 15NRDX as a sole nitrogen source to soil slurries established from range soils was used to identify potential RDX degraders by high sensitivity stable isotope probing (SIP), a method that allowed quantification of the degree of 15N enrichment of the putative RDX degraders and avoided bias caused by the poor separation of labeled and unlabeled DNA when using 15N SIP.

intensively used area of an Eglin Air Force Base (Eglin AFB) live-fire training range (June 2007) with the assistance of explosive ordnance detection personnel. The soils were of the Lakeland Sand series. Sampling locations were chosen based on area features, including the interior and exterior of two former impact zones (craters), areas near debris, and areas with differing plant species or soil appearances (e.g., brown sand, red sand). Additional samples, referred to as “bulk soil”, were obtained from six additional locations at C52N Cat’s Eye on a subsequent visit (November, 2009). RDX Degradation in Soil Slurries. RDX degradation potential of the collected soils was evaluated individually and in mixtures of 5 or 6 soil samples (10−12% w/v soils) using the culture media described above. RDX concentrations were monitored in the aqueous phase by removing 500 μL samples, and centrifuging at 16 000g for 10 min. The supernatant was mixed with acetonitrile (1 volume), centrifuged, and the supernatant was analyzed by HPLC. For stable isotope probing experiments, soils (11.5% w/v) were incubated in 45 mL of RDX enrichment media amended with approximately 40 ppm unlabeled or fully labeled 15N-RDX. Soil slurries contained either: (1) bulk soils showing no RDX-degradation in screening experiments (inactive soils) or (2) the inactive bulk soils amended (20 wt %) with a mixture of six soil samples that screened positive for RDX-degradation (active soils) (Supporting Information Table S1). Soil slurries were shaken at 100 rpm at 30 °C in 250 mL baffled flasks. RDX concentrations were monitored as above and the soil pellet was stored at −80 °C for DNA extraction. HPLC Analysis. HPLC analysis was conducted using a modular HPLC system consisting of a Waters (Milford, MA) 717+ autosampler, two Waters 515 HPLC pumps, and a Waters 9926 photodiode array detector. A 4.6 × 250 mm Hypersil Gold reverse phase column (ThermoFisher; Waltham, MA) was used for separation with a 50:50 mobile phase (HPLC water 83% MeOH/17% ACN) monitored at 254 nm. Peak integration and data analysis was conducted using the Millennium32 software supplied with the instrument. DNA Extraction. DNA was extracted from the soil samples and slurries using the aluminum sulfate method described previously.27 Genomic DNA was extracted from pure cultures using the Gram Positive DNA Extraction Kit (Epicenter, Madison, WI), modified by adding 1 μL of mutanolysin (150 U, Sigma-Aldrich, St. Louis, MO) and 1 μL of achromopeptidase (10 U, Sigma-Aldrich). Density Gradient Centrifugation, Fractionation, and Purification. Soil slurry DNA (1.5−6 μg, 98 μL) in DNA suspension buffer (10 mM Tris−0.1 mM EDTA, Teknova, Hollister, CA) was combined with 172 μL of gradient buffer (100 mM Tris, 100 mM KCl, 10 mM EDTA) and 4.53 mL of cesium chloride (CsCl) solution (approximately 1.71 g/mL buoyant density, by mass) in 10 mM Tris-10 mM EDTA. Centrifugation conditions, fractionation into PCR tubes (VWR, International; Radnor, PA) and buoyant density (BD) measurements were performed as previously described.27 Eight density gradients (five end point samples and three midpoint samples) were generated and analyzed. The five end point samples consisted of three 15N-labeled samples (1.50− 5.90 μg of DNA each), one unlabeled control (5.95 μg of DNA), and one inactive control (2.1 μg of DNA), and the three midpoint samples included two 15N-labeled samples (1.90 μg and 2.20 μg of DNA) and one unlabeled control (4.80 μg of DNA) (Supporting Information Table S2).

■

MATERIALS AND METHODS Media. RDX enrichment media (used for soil slurries), a phosphate buffered minimal media with glucose, glycerol, and succinate supplied as carbon sources, was prepared as described previously.23 For pure cultures, (0.4 mL/1 L of 1000× solution) vitamin solution24 was added, omitting lineolic acid. Additional media with twice autoclaved soil extract (8% of a 33% w/v soil solution)25 or yeast extract (5 mg/L) were also tested for stimulation of RDX-degradation. Unlabeled RDX was supplied by Accustandard (New Haven, CT) and [U−15N]labeled RDX was supplied by Guy Ampleman of the Defense Research and Development Canada (Valcartier, QC). For nitrite minimal media, RDX was replaced with sodium nitrite (500 μM and 5 mM). Media used for isolation of microbial populations consisted of: the above minimal media (with RDX, nitrite or nitrogen free) solidified with noble agar (1.5%), R2A,26 nutrient agar, 10× diluted nutrient agar, and LB agar. All agar was supplied by Difco (Becton Dickinson, Franklin, NJ). Enrichment and Isolation. Populations were isolated for further analysis based on their ability to grow using RDX and/ or nitrite as a sole nitrogen source. Enrichment cultures were generated using the RDX enrichment media described above in 10 mL culture tubes inoculated with 200 mg or less of the RDX-degrading Eglin soil samples or soil slurries. RDXdegrading cultures were plated on the described minimal media. Colonies were isolated and purity was verified by repeated streaking for isolation on the various media described above. Growth on RDX or nitrite was verified in 3 mL of minimal media that was monitored for RDX or nitrite consumption as described. Sample Collection. Soils were collected into previously unopened resealable freezer bags or sterile 50 mL conical tubes from 23 discrete locations within “C52N Cat’s Eye”, an 10357

dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363

Environmental Science & Technology

Article

(i.e., cultures were pooled together by plate rows of the 96 well plate) and 96 clones (Supporting Information Tables S5−S6) were selected for sequencing based on the TRFLP profiles. DNA Sequencing. Recombinant colonies from clone libraries were submitted to “High-Throughput Sequencing Solutions” (www.htseq.org), and sequenced using the T7 promoter. The primers, reagents, and software used to amplify, sequence, and analyze the 16S rRNA genes and functional genes are described in section 2 of the Supporting Information. The GenBank accession numbers for sequences used in this study are: KF571869−KF71926. Nitrite Assays. Nitrite concentrations were analyzed using the Griess assay:31 (1) samples (10 μL) and a standard dilution series of sodium nitrite (10 μL, 0.5−250 μM) were mixed with double distilled H2O (70 μL) and Griess reagent31 (20 μL) in clear 96-well polystyrene plates, (2) incubated at room temperature for 10 min, and (3) absorbance (540 nm) read in a TECAN Infinite500 plate reader (TECAN, Mannedorf, Switzerland). Sample concentrations were determined based on sodium nitrite standard curves.

The BD values measured for the midpoint gradient fractions were denser than the respective fractions of the end point gradients because of sample evaporation prior to measurements. To account for this increase, the BDs of these midpoint gradient fractions were adjusted so that the xplA gene copy profiles were aligned with the end point gradient profiles when comparing 15N-assimilation between gradients (data not shown). Gradient fraction volumes were normalized (∼150 μL) with 5 μg of linear acrylamide (Ambion, Austin, TX) in PCR certified water (Teknova) and mixed with 300 μL of PEG precipitation solution (30% PEG 6000, 1.6 M NaCl). DNA was precipitated as described,28 rinsed three times with 70% ethanol and then resuspended in DNA suspension buffer (50−80 μL). Samples were stored at −20 °C until analysis. Quantitative PCR (qPCR) and TRFLP. All qPCR analyses were performed in at least duplicate using a MJ-Research PTC200 gradient thermocycler with a Chromo 4 real-time PCR detector with the Opticon Monitor 3.1 software (BioRad, Hercules, CA). Quantitation and subsequent terminal restriction fragment length polymorphisms (TRFLP) analysis of the 16S rRNA genes was performed as described previously27 with minor modifications to the amplification cycling and digestion protocols. A detailed description of the modified protocol is located in section 2 of the Supporting Information. Relative xplA gene copies were measured in fractions using the primer-probe set described previously29 with a modified reverse primer sequence: xplAtaqF, GGAGGACATGAGATGACCGCT; xplAtaqR, CCTGTTGCAGTCGCCTATACC; xplAtaqprobe, [6′-FAM]-TCCCGAATTCAGGAACAACCCCTATCC-[BHQ1a] (6′-carboxyfluorescein, black hole quencher 1; Eurofins MWG Operon; Huntsville, AL). The pHSXI plasmid20 containing the xplA gene was used as a quantification standard for xplA. For quantification of the xplA gene in soils, four DNA samples were run for each soil sample: a 10-fold and 20-fold dilution of two separate DNA extractions, unless otherwise indicated. The dilutions were performed to minimize potential inhibition of the qPCR reaction by compounds in the soil.30 Details of the reactions can be found in section 2 of the Supporting Information. qPCR-TRFLP Analysis of Gradient Fractions. Detailed descriptions using examples are provided in section 3 (Figures S1−S6, Table S4) of the Supporting Information. To organize, process and analyze the data outputted by the Dax software, qPCR-TRFLP data from the fractionated gradients (15−25 fractions, 2−3 chromatograms/fraction) were transferred to Microsoft Excel spreadsheets programmed with Macros written in Visual Basic (VB). These VB scripts: (1) calculated average values, standard deviations and the number of samples for each restriction fragment (RF) peak at each BD value, (2) determined the three highest copy number positions (i.e., gradient BDs) for each RF peak, and calculated p-values between each of the three positions, (3) normalized the BD values between gradients by using linear interpolation to calculate RF copy number at 0.0015 g/mL BD intervals, and (4) used the interpolated values to generate two heat maps for visualization of relative RF copy numbers at each gradient BD. Clone Library Generation. Clone libraries were generated from selected fractions for sequencing. A description of the amplification, purification and cloning reactions can be found in Section 2 of the Supporting Information. Transformed colonies were grown in 96 deep-well plates (ThermoFisher) and TRFLP was performed on plasmids extracted from aggregate cultures

■

RESULTS AND DISCUSSION RDX-Degradation Potential and xplA Gene Abundance in Eglin AFB Range Soils. Surface soils (23 total) collected in May 2007 within the C-52N Cat’s Eye area of the Eglin bombing range were screened in bulk mixtures incubated without addition of exogenous carbon sources and supplemented with either: yeast extract, soil extract, a mixture of glucose, glycerol, and succinate. RDX degradation was observed in a subset of mixtures but only when supplied with glucose, glycerol, and succinate. RDX loss was insignificant in soils supplemented with yeast extract, soil extract, or without exogenous carbon sources. On the basis of these observations, we individually screened the 23 soils in small enrichment cultures containing RDX as the only added nitrogen source and supplemented with glucose, glycerol, and succinate. RDX was degraded in seven of these samples (Table 1). Quantification of the xplA-gene was conducted in a subset (16 soils) of the 23 soils prior to enrichment on RDX; the gene was detected in 11 of the 16 soils tested. In five of these analyses, amplification was inconsistent (Table 1), and there was no apparent correlation between the presence of the xplA gene or xplA gene copy number and RDX degradation under the conditions tested. Although distributed activity may be related to the spatial heterogeneity of munitions in contaminated soils,1,2 our sampling regime was not exhaustive enough to make this association.32,33 Neither could we make an association between the presence of the xplA gene and activity. These results indicated that live-fire training sites are enriched in xplAcontaining organisms, but under the conditions used to assess activity (requiring exogenous carbon addition) some of the populations with xplA lacked the capacity to grow on RDX. Nonetheless, these data suggest that biostimulation34 with simple carbon sources may be an effective strategy for containing RDX in military range soils. In addition, because of the highly heterogeneous distribution of xplA-bearing organisms and RDX-degradation activity, bioaugmentation with RDX degrading aerobic organisms may promote timely and effective degradation of RDX as it leaches from munitions particulates. High Sensitivity Stable Isotope Probing of Range Soil Mixtures. Six soils that did not degrade RDX were seeded with 10358

dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363

Environmental Science & Technology

Article

Table 1. RDX Degradation in Eglin Soil Samples Compared with Amounts of xplA Gene Copies Detected by qPCR RDX sample degradationa 1 2e 3 4e 5 6e 7e 8 9 10 11 12−13 14e 15 16 17 18e 19 20 21−23

− + − + − + + − − − ± − + − − − + − − −

xplA copies/16S rRNA gene copies (av, (std dev))b 5.08 ND NT 5.75 3.31 1.27 ND 1.32 4.09 2.31 NT ND 5.78 6.82 1.51 NT 1.55 NT 3.33 NT

× 10−6

× 10−6 (4.77 × 10−6) × 10−6 (1.75 × 10−6) × 10−5 (5.88 × 10−6)

number of reactions with xplA detectedc 1 0

× 10−5 (7.57 × 10−6) × 10−6 (1.64 × 10−7) × 10−3 (1.48 × 10−3)

4 2 4 0d 3 2 4

× 10−5 (1.76 × 10−5) × 10−6 × 10−5 (7.56 × 10−6)

0 4 1 3

× 10−4 (7.64 × 10−5)

4

× 10−6 (2.12 × 10−6)

2

Figure 1. RDX degradation in soil slurries (∼12% w/v) incubated with RDX enrichment media. Samples with active soils (20% soils mass, colored lines) degraded RDX in 49−80 h after a delay of ∼115 h. Unlabeled RDX concentrations are plotted solid lines and 15N-RDX concentrations with dashed lines. Gray lines show average concentrations of RDX in inactive soil slurries (both unlabeled and 15 N) with error bars showing one standard deviation. Small soil samples (99.9% identity between these fragments and those in strain MA1 (data not shown) indicating that not only are xplAbearing organisms present in range soils, but large fragments of DNA containing the xplA gene. The assimilation of 15N-nitrogen from labeled RDX in several populations that have not been associated with aerobic RDX degradation (Figure 2) suggests that a wider diversity of bacteria than now represented in the culture collection are capable of using RDX as a nitrogen source. Past studies have identified nitrite, NDAB, MEDINA (methylenedinitramine), and formamide to be nitrogenous degradation products of RDX-degradation.9,11,21,41 These observations indicate metabolites from RDX may be available to bacteria in the soil that did not degrade RDX and may account for the 15N assimilation by some of the labeled populations identified in our analyses. Thus, although our studies served to confirm the general

fragment size) . The fragment size of DNA prepared for SIP analyses was in the range of 1500−20 000 bps (data not shown). Unlabeled DNA with a 67% G+C has a calculated BD of approximately 1.73 g/mL versus approximately 1.715-1.720 g/mL for DNA with 55− 60% G+C content (corresponding to a fragment of 2500 to 21 500 bps from Rhodococcus containing a 16S rRNA gene; Table 2).40 These values are in good agreement with those measured in the 14N-end point gradients (Figures 2 and 3). Intragenomic variation in G+C content (Table 2) is therefore important to consider in SIP analyses. A previous SIP experiment looked for evidence of a known xplAbearing organism in bands extracted from CsCl gradients containing xplA.18 The analysis presented here shows that this strategy may not be effective in 16S rRNA gene-based identification of RDX degraders, especially when the separated DNA fragments are less than 20 kbps (Table 2). Analysis of RDX-Degrading Isolates from Range Soils. Putative RDX-degraders that assimilated 15N-nitrogen were identified from density gradients using qPCR-TRFLP of the 16S rRNA gene27 and Taqman qPCR of xplA.29 A Rhodococcus sp. was prominent and most highly 15N-labeled in the density gradients, as well as a number of other species. Several bacteria were isolated from the active soils (Figure 2 and Supporting Information Table S7), but only three were able to use RDX as a nitrogen source: Williamsia sp. EG1, and two Rhodococcus species, EG2A and EG2B. EG2A and EG2B had different morphologies, but their partial 16S rRNA gene sequences (1417 bps) were identical and were between 97% and 99% identical to the Rhodococcus sp. clones generated from the density gradient DNA. However, differences in the 16S rRNA gene sequence between the Rhodococcus sp. isolates and the cloned sequences from the gradients are much smaller (1− 10361

dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363

Environmental Science & Technology

Article

nitrogen source by a Rhodococcus sp., strain DN22. Soil Biol. Biochem. 1998, 30 (8−9), 1159−1167. (9) Ye, J.; Singh, A.; Ward, O. P. Biodegradation of nitroaromatics and other nitrogen-containing xenobiotics. World J. Microbiol. Biotechnol. 2004, 20 (2), 117−135. (10) Thompson, K. T.; Crocker, F. H.; Fredrickson, H. L. Mineralization of the cyclic nitramine explosive hexahydro-1,3,5trinitro-1,3,5-triazine by Gordonia and Williamsia spp. Appl. Environ. Microbiol. 2005, 71 (12), 8265−72. (11) Crocker, F. H.; Indest, K. J.; Fredrickson, H. L. Biodegradation of the cyclic nitramine explosives RDX, HMX, and CL-20. Appl. Microbiol. Biotechnol. 2006, 73 (2), 274−90. (12) Nejidat, A.; Kafka, L.; Tekoah, Y.; Ronen, Z. Effect of organic and inorganic nitrogenous compounds on RDX degradation and cytochrome P-450 expression in Rhodococcus strain YH1. Biodegradation 2008, 19 (3), 313−20. (13) Seth-Smith, H. M.; Edwards, J.; Rosser, S. J.; Rathbone, D. A.; Bruce, N. C. The explosive-degrading cytochrome P450 system is highly conserved among strains of Rhodococcus spp. Appl. Environ. Microbiol. 2008, 74 (14), 4550−2. (14) Bernstein, A.; Adar, E.; Nejidat, A.; Ronen, Z. Isolation and characterization of RDX-degrading Rhodococcus species from a contaminated aquifer. Biodegradation 2011, 22 (5), 997−1005. (15) Zhao, J. S.; Halasz, A.; Paquet, L.; Beaulieu, C.; Hawari, J. Biodegradation of hexahydro-1,3,5-trinitro-1,3,5-triazine and its mononitroso derivative hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine by Klebsiella pneumoniae strain SCZ-1 isolated from an anaerobic sludge. Appl. Environ. Microbiol. 2002, 68 (11), 5336−41. (16) Arnett, C. M.; Rodriguez, G.; Maloney, S. W. Analysis of bacterial community diversity in anaerobic fluidized bed bioreactors treating 2,4-dinitroanisole (DNAN) and n-methyl-4-nitroaniline (MNA) using 16S rRNA gene clone libraries. Microbes. Environ. 2009, 24 (1), 72−75. (17) Kitts, C. L.; Cunningham, D. P.; Unkefer, P. J. Isolation of three hexahydro-1,3,5-trinitro-1,3,5-triazine-degrading species of the family Enterobacteriaceae from nitramine explosive-contaminated soil. Appl. Environ. Microbiol. 1994, 60 (12), 4608−11. (18) Roh, H.; Yu, C. P.; Fuller, M. E.; Chu, K. H. Identification of hexahydro-1,3,5-trinitro-1,3,5-triazine-degrading microorganisms via N-15-stable isotope probing. Environ. Sci. Technol. 2009, 43 (7), 2505−2511. (19) Cho, K. C.; Lee, D. G.; Roh, H. K.; Fuller, M. E.; Hatzinger, P. B.; Chu, K.-H. Application of (13)C-stable isotope probing to identify RDX-degrading microorganisms in groundwater. Environ. Pollut. 2013, 178 (0), 350−60. (20) Seth-Smith, H. M.; Rosser, S. J.; Basran, A.; Travis, E. R.; Dabbs, E. R.; Nicklin, S.; Bruce, N. C. Cloning, sequencing, and characterization of the hexahydro-1,3,5-trinitro-1,3,5-triazine degradation gene cluster from Rhodococcus rhodochrous. Appl. Environ. Microbiol. 2002, 68 (10), 4764−71. (21) Jackson, R. G.; Rylott, E. L.; Fournier, D.; Hawari, J.; Bruce, N. C. Exploring the biochemical properties and remediation applications of the unusual explosive-degrading P450 system XplA/B. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (43), 16822−7. (22) Paquet, L.; Monteil-Rivera, F.; Hatzinger, P. B.; Fuller, M. E.; Hawari, J. Analysis of the key intermediates of RDX (hexahydro-1,3,5trinitro-1,3,5-triazine) in groundwater: Occurrence, stability and preservation. J. Environ. Monit. 2011, 13 (8), 2304−11. (23) Binks, P. R.; Nicklin, S.; Bruce, N. C. Degradation of hexahydro1,3,5-trinitro-1,3,5-triazine (RDX) by Stenotrophomonas maltophilia PB1. Appl. Environ. Microbiol. 1995, 61 (4), 1318−22. (24) Brandis, A.; Thauer, R. K. Growth of Desulfovibrio species on hydrogen and sulfate as sole energy-source. J. Gen. Microbiol. 1981, 126 (Sep), 249−252. (25) Hurst, C. J.; Knudsen, G. R. Manual of Environmental Microbiology. ASM Press: Washington, D.C., 1997. (26) Reasoner, D. J.; Geldreich, E. E. A new medium for the enumeration and subculture of bacteria from potable water. Appl. Environ. Microbiol. 1985, 49 (1), 1−7.

importance of xplA in RDX degradation and was fully consistent with culture-based analyses, without isolation it is difficult to ascribe a primary role of all labeled organisms in RDX degradation, since cells may become labeled through cross-feeding instead through the direct assimilation of the target compound.28,42,43 Nonetheless, our results show that the most highly labeled species in the SIP gradients were consistent with the genera that have been isolated using RDX as a nitrogen source and illustrate the importance of carbon addition and possibly bioaugmentation in the stimulation of RDX degradation in training range soils.

■

ASSOCIATED CONTENT

* Supporting Information S

Overview of data analyses methods with examples, supporting tables, supporting figures, and data. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +1 (206) 5435350. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was funded by the Department of Defense Strategic Environmental Research and Development Program (SERDP; ERs 1504 and 1608). We thank Chandi Sun for her assistance with this research, Guy Ampleman (Defence Research and Development; Valcartier, QC) for the synthesis of the 15N-Labeled RDX, Michael Hunt, Edward O’Connell and the Eglin Air Force Base EOD personnel for their assistance in collecting samples.

■

REFERENCES

(1) Clausen, J.; Robb, J.; Curry, D.; Korte, N. A case study of contaminants on military ranges: Camp Edwards, Massachusetts, USA. Environ. Pollut. 2004, 129 (1), 13−21. (2) U.S. Environmental Protection Agency. Handbook on the Management of Munitions Response Actions; EPA, 505-B-01-001; Office of Solid Waste and Emergency Response: Washington, D.C., 2005. (3) Walsh, M. E.; Taylor, S.; Hewitt, A. D.; Walsh, M. R.; Ramsey, C. A.; Collins, C. M. Field observations of the persistence of Comp B explosives residues in a salt marsh impact area. Chemosphere 2010, 78 (4), 467−73. (4) Fuller, M. E.; Schaefer, C. E.; Steffan, R. J. Evaluation of a peat moss plus soybean oil (PMSO) technology for reducing explosive residue transport to groundwater at military training ranges under field conditions. Chemosphere 2009, 77 (8), 1076−83. (5) Indest, K. J.; Jung, C. M.; Chen, H. P.; Hancock, D.; Florizone, C.; Eltis, L. D.; Crocker, F. H. Functional characterization of pGKT2, a 182-kilobase plasmid containing the xplAB genes, which are involved in the degradation of hexahydro-1,3,5-trinitro-1,3,5-triazine by Gordonia sp. strain KTR9. Appl. Environ. Microbiol. 2010, 76 (19), 6329−37. (6) Andeer, P. F.; Stahl, D. A.; Bruce, N. C.; Strand, S. E. Lateral transfer of genes for hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) degradation. Appl. Environ. Microbiol. 2009, 75 (10), 3258−62. (7) Fuller, M. E.; McClay, K.; Hawari, J.; Paquet, L.; Malone, T. E.; Fox, B. G.; Steffan, R. J. Transformation of RDX and other energetic compounds by xenobiotic reductases XenA and XenB. Appl. Microbiol. Biotechnol. 2009, 84 (3), 535−44. (8) Coleman, N. V.; Nelson, D. R.; Duxbury, T. Aerobic biodegradation of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) as a 10362

dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363

Environmental Science & Technology

Article

(27) Andeer, P.; Strand, S. E.; Stahl, D. A. High-sensitivity stableisotope probing by a quantitative terminal restriction fragment length polymorphism protocol. Appl. Environ. Microbiol. 2012, 78 (1), 163−9. (28) Neufeld, J. D.; Dumont, M. G.; Vohra, J.; Murrell, J. C. Methodological considerations for the use of stable isotope probing in microbial ecology. Microb. Ecol. 2007, 53 (3), 435−42. (29) Indest, K. J.; Crocker, F. H.; Athow, R. A TaqMan polymerase chain reaction method for monitoring RDX-degrading bacteria based on the xplA functional gene. J. Microbiol. Methods 2007, 68 (2), 267− 74. (30) Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 1997, 63 (10), 3741−51. (31) Green, L. C.; Wagner, D. A.; Glogowski, J.; Skipper, P. L.; Wishnok, J. S.; Tannenbaum, S. R. Analysis of nitrate, nitrite, and [N15]-labeled nitrate in biological-fluids. Anal. Biochem. 1982, 126 (1), 131−138. (32) Jenkins, T.; Walsh, M. Field Screening Methods for Munitions Residues in Soils; EPA/625/K-93/001: Office of Research and Development, Washington D.C., 1993. (33) Jenkins, T. F.; Grant, C. L.; Brar, G. S.; Thorne, P. G.; Schumacher, P. W.; Ranney, T. A. Sampling error associated with collection and analysis of soil samples at TNT-contaminated sites. Field Anal. Chem. Technol. 1997, 1 (3), 151−163. (34) Hopkins, G. D.; Semprini, L.; Mccarty, P. L. Microcosm and in situ field studies of enhanced biotransformation of trichloroethylene by phenol-utilizing microorganisms. Appl. Environ. Microbiol. 1993, 59 (7), 2277−2285. (35) Thompson, J. R.; Pacocha, S.; Pharino, C.; Klepac-Ceraj, V.; Hunt, D. E.; Benoit, J.; Sarma-Rupavtarm, R.; Distel, D. L.; Polz, M. F. Genotypic diversity within a natural coastal bacterioplankton population. Science 2005, 307 (5713), 1311−3. (36) van der Meer, J. R.; de Vos, W. M.; Harayama, S.; Zehnder, A. J. Molecular mechanisms of genetic adaptation to xenobiotic compounds. Microbiol. Rev. 1992, 56 (4), 677−94. (37) Trefault, N.; De la Iglesia, R.; Molina, A. M.; Manzano, M.; Ledger, T.; Perez-Pantoja, D.; Sanchez, M. A.; Stuardo, M.; Gonzalez, B. Genetic organization of the catabolic plasmid pJP4 from Ralstonia eutropha JMP134 (pJP4) reveals mechanisms of adaptation to chloroaromatic pollutants and evolution of specialized chloroaromatic degradation pathways. Environ. Microbiol. 2004, 6 (7), 655−68. (38) Jung, C. M.; Crocker, F. H.; Eberly, J. O.; Indest, K. J. Horizontal gene transfer (HGT) as a mechanism of disseminating RDX-degrading activity among Actinomycete bacteria. J. Appl. Microbiol. 2011, 110 (6), 1449−59. (39) Dehal, P. S.; Joachimiak, M. P.; Price, M. N.; Bates, J. T.; Baumohl, J. K.; Chivian, D.; Friedland, G. D.; Huang, K. H.; Keller, K.; Novichkov, P. S.; Dubchak, I. L.; Alm, E. J.; Arkin, A. P. MicrobesOnline: An integrated portal for comparative and functional genomics. Nucleic Acids Res. 2010, 38 (Database issue), D396−400. (40) Osterman, L. A. Methods of Protein and Nucleic Acid Research; Springer-Verlag: Berlin, 1984. (41) Annamaria, H.; Manno, D.; Strand, S. E.; Bruce, N. C.; Hawari, J. Biodegradation of RDX and MNX with Rhodococcus sp. strain DN22: New insights into the degradation pathway. Environ. Sci. Technol. 2010, 44 (24), 9330−6. (42) Manefield, M.; Griffiths, R.; McNamara, N. P.; Sleep, D.; Ostle, N.; Whiteley, A. Insights into the fate of a 13C-labelled phenol pulse for stable isotope probing (SIP) experiments. J. Microbiol. Methods 2007, 69 (2), 340−4. (43) Lueders, T.; Pommerenke, B.; Friedrich, M. W. Stable-isotope probing of microorganisms thriving at thermodynamic limits: syntrophic propionate oxidation in flooded soil. Appl. Environ. Microbiol. 2004, 70 (10), 5778−86.

10363

dx.doi.org/10.1021/es401729c | Environ. Sci. Technol. 2013, 47, 10356−10363