In Vivo Biochemistry: Single-Cell Dynamics of ... - ACS Publications

Subscriber access provided by READING UNIV

Article

In Vivo Biochemistry: Single-cell dynamics of cyclic di-GMP in E. coli in response to zinc overload Jongchan Yeo, Andrew B. Dippel, Xin C. Wang, and Ming C. Hammond Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00696 • Publication Date (Web): 20 Oct 2017 Downloaded from http://pubs.acs.org on October 28, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

In Vivo Biochemistry: Single-cell dynamics of cyclic di-GMP in E. coli in response to zinc overload

Jongchan Yeo1, Andrew B. Dippel1, Xin C. Wang2, and Ming C. Hammond1,2*

1

Department of Chemistry, University of California, Berkeley, 94720; USA

2

Department of Molecular & Cell Biology, University of California, Berkeley, 94720; USA

*Corresponding author: University of California, Berkeley, Department of Chemistry, 201 Lewis Hall, Berkeley, CA 94720-1460. E-mail: [email protected]. Telephone: (510) 642-0509.

1 Environment ACS Paragon Plus

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT. Intracellular signaling enzymes drive critical changes in cellular physiology and gene expression, but their endogenous activities in vivo remain highly challenging to study in real-time and for individual cells. Here we show that flow cytometry can be performed in complex media to monitor single-cell population distributions and dynamics of cyclic di-GMP signaling, which controls the bacterial colonization program. These in vivo biochemistry experiments are enabled by our second-generation RNA-based fluorescent (RBF) biosensors, which exhibit high fluorescence turn-on in response to cyclic di-GMP. Specifically, we demonstrate that intracellular levels of cyclic di-GMP in E. coli are repressed with excess zinc, but not with other divalent metals. Furthermore, in both flow cytometry and fluorescence microscopy set-ups, we monitor the dynamic rise in cellular cyclic di-GMP levels upon zinc depletion and show that this response is due to de-repression of the endogenous diguanylate cyclase DgcZ. In the presence of zinc, cells exhibit enhanced cell motility and increased sensitivity to antibiotics due to inhibited biofilm formation. Taken together, these results showcase the application of RBF biosensors to visualize single-cell dynamic changes in cyclic di-GMP signaling in direct response to environmental cues such as zinc, and highlight our ability to assess whether or not observed phenotypes are related to specific signaling enzymes and pathways.


Page 2 of 29

Page 3 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Cyclic di-GMP is an intracellular signaling molecule that is responsible for regulating bacterial colonization, as high levels of cyclic di-GMP drive the lifestyle transition from motile to sessile, attached, biofilm-forming states in many bacteria1. Since the assessment of the quality of the environmental niche for colonization is critical to bacterial survival, many enzymes involved in maintaining cyclic di-GMP levels are allosterically controlled by environmental inputs. Both diguanylate cyclases that synthesize cyclic di-GMP and phosphodiesterases that breakdown cyclic di-GMP may have their catalytic activities regulated directly by allosteric liganδ-binding domains or by being downstream of other input-driven signaling pathways, including chemotaxis, receptor histidine kinases, and quorum signaling2-5. However, connecting specific environmental cues to dynamic changes in cellular cyclic di-GMP levels has been challenging due to technical difficulties in visualizing this signaling molecule, which is present at low nanomolar concentrations in some bacteria including E. coli, a value that translates to tens or hundreds of c-di-GMP molecules per cell6. Phenotypic assays for motility and biofilm formation may serve as proxies for cyclic diGMP levels7, 8. However, while these assays can be high-throughput, they have low sensitivity and are mostly useful for knockout screens. In contrast, mass spectrometry assays are among the most sensitive and quantitative methods for analyzing cyclic di-GMP levels9. However, they are relatively low-throughput due to the dual requirements for generating cell extracts and performing liquid chromatography separations prior to MS analysis. In addition, neither phenotypic screens nor LCMS assays provide single cell resolution and real-time dynamic measurements of cyclic di-GMP levels in cells.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To provide these additional capabilities, we and others have developed different types of fluorescent biosensors selective for cyclic di-GMP10-12. These biosensors are based on either natural protein or RNA effectors that bind the signaling molecule, and give FRET ratio change or fluorescence turn-on signal, respectively. A protein-based FRET biosensor has been applied in fluorescence microscopy to visualize cyclic di-GMP dynamics during asymmetric cell division of Caulobacter crescentus10 and in flow cytometry to screen for compounds that alter cyclic diGMP levels in Salmonella typhimurium in minimal media13. Recently, we developed a suite of second-generation RNA-based fluorescent (RBF) biosensors for cyclic di-GMP that exhibit remarkable turn-on brightness in flow cytometry under both aerobic and anaerobic conditions14, which we used to perform an overexpression screen for diguanylate cyclase activity15. However, these biosensors had not been demonstrated for monitoring cyclic di-GMP signaling in response to natural chemical inputs. Furthermore, to our knowledge, visualizing temporal changes in single-cell population dynamics of cyclic di-GMP signaling using flow cytometry had not been achieved. In this study, we present RBF biosensors as a resource to the bacterial signaling community for monitoring the real-time dynamics of intracellular cyclic di-GMP in single cells using flow cytometry and fluorescence microscopy. A previous report identified the ydeH gene in E. coli as a diguanylate cyclase with a chemosensory zinc-binding (CZB) domain, which was confirmed by an x-ray crystal structure of the enzyme and led to renaming of the gene as dgcZ16. DgcZ activity was shown to be repressed by zinc and to regulate poly-GlcNAc-dependent biofilm formation, which is induced in uropathogenic E. coli and other pathogenic bacteria by sub-MIC exposure to antibiotics12. Here we have applied an RBF biosensor in flow cytometry to monitor temporal changes in cyclic di-GMP dynamics in E. coli single-cell populations upon


Page 4 of 29

Page 5 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

switching from high to low zinc conditions, which we demonstrate is dependent on DgcZ and is a specific response to zinc over other divalent metals. Furthermore, we demonstrate that zinc overload sensitizes E. coli to antibiotic growth inhibition, which shows that manipulating cyclic di-GMP signaling by natural chemical inputs has the potential to improve antibiotic efficacy. To aid in the search for novel chemical inputs, the flow cytometry experimental protocol permits minimal perturbation of bacterial cells, with no centrifugation or media changes. In addition, the protocol enables analysis in complex media, facilitates addition or depletion of media components, and offers dynamic measurements of single-cell populations. We envision that this high-throughput assay can be used to study signaling in response to various endogenous factors and to discover additional natural inputs that regulate c-di-GMP signaling.

METHODS AND MATERIALS General reagents and oligonucleotides Cyclic di-GMP was purchased from Axxora, LLC (Farmingdale NY). DFHBI and DFHBI-1T were synthesized as described previously17, 18. Stock solutions (1 M) of ZnCl2, MnCl2, NiCl2, and CuCl2 were made freshly by dissolving salts in sterilized water and filtering through 0.2 µm nitrocellulose filter. pET31b(+) plasmids encoding the RNA-based fluorescent biosensor and control constructs used in this study are available on Addgene (Pl-B: #79161, Spinach2: #79783). Pl-B biosensor (see Fig. S1) and constitutively dye-binding Spinach2 constructs are flanked by a tRNA scaffold and were cloned into the BglII and XhoI sites of pET31b(+) as previously described14. Oligonucleotides for generating targeted knockout, cloning, and sequencing were purchased from Elim Biopharmaceuticals (Hayward, CA). Generation of dgcZ- strain


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The dgcZ- strains of BL21 (DE3) Star E. coli cells (Life Technologies) and MG1655 E. coli cells were generated using the TargeTron Gene Knockout System (Sigma-Aldrich) following the manufacturer’s protocol. The TargeTron PCR kit was used to create a mutated group II intron containing a kanamycin marker that will specifically insert into and disrupt the target gene. The primers necessary for the mutation PCR were designed on the TargeTron website (http://www.sigma-genosys.com/targetron) and the sequences are as follows: IBS: AAAAAAGCTTATAATTATCCTTAAATTGCTGCCATGTGCGCCCAGATAGGGTG EBS1d: CAGATTGTACAAATGTGGTGATAACAGATAAGTCTGCCATCTTAACTTACCTTTCTTTG T EBS2: TGAACGCAAGTTTCTAATTTCGGTTCAATTCCGATAGAGGAAAGTGTCT The mutated sequence was cloned into the intron expression vector pACD4K-C following the manufacturer’s protocol. The plasmid was transformed into E. coli cells to express the RNA-protein complex that inserts the intron sequence into the dgcZ gene. Transcription followed by splicing of the group II intron into the genome is required for the host cell to acquire kanamycin resistance, because the kanamycin marker is interrupted by a group I intron sequence that is excised after transcription. Thus, knockout cells were selected by plating on LB agar containing kanamycin and colony PCR was used to confirm the intron insertion into the dgcZ gene. The intron inserts between nucleotides 32 and 33 in the gene, so the genotype is dgcZ::Targetron-kan. The TargeTron system uses a mobile group II intron to disrupt the gene of interest and is not designed to be reversible. In order to complement the dgcZ- strain, WT dgcZ was expressed on an inducible, low-copy plasmid, pCola-duet, similar to the approach used to complement a


Page 6 of 29

Page 7 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

∆dgcZ strain with a foreign diguanylate cyclase to examine effects on biofilm formation.30 While biosensor fluorescence confirmed that the complemented strain has increased cyclic di-GMP levels, the levels were much higher than for WT and no decrease in fluorescence with zinc addition was observed due to artificially high enzyme levels (data not shown).

Flow cytometry endpoint analysis of cellular cyclic di-GMP levels A single colony of wild-type or dgcZ- BL21(DE3) Star E. coli cells transformed with Pl-B or Spinach2 was resuspended in ZYP-5052 autoinduction media (1 mM MgSO4, 25 mM (NH4)2SO4, 50 mM KH2PO4, 50 mM Na2HPO4, 0.5 % glycerol (v/v), 0.05% glucose, 0.2% αlactose, 1% tryptone, 0.5% yeast extract)19 and grown for two hours at 37 °C, then each culture was divided into four tubes and ZnCl2 was added to each tube to final concentrations of 0, 0.1, 0.5, and 1 mM, respectively. For metal selectivity experiments, MnCl2, NiCl2, FeSO4, and CuCl2 were added instead of ZnCl2. All cultures were grown for 16-20 h at 37 °C with shaking to induce biosensor production. To prepare spent media to be used for diluting cultures for flow cytometry analysis, 600 µL aliquot of each culture was taken and centrifuged at 5,000 rpm for 5 min followed by sterile filtration (0.22 µm), then DFHBI-1T was added to a final concentration of 25 µM. DFHBI-1T also was added to the remaining culture, which was incubated at 37 °C for 10 min with shaking for dye equilibration. For flow cytometry analysis, 1 µL of each culture was diluted into 500 µL of the appropriate spent media solution (see Fig. 1 for schematic). The mean fluorescence intensities (MFI) of 10,000 events were analyzed for each diluted culture sample (100 µL) loaded on a round bottom, non-treated, sterile polypropylene 96-well plate (Corning) using the Attune NxT flow cytometer (Life Technologies) equipped with a 488 nm laser for excitation and 515/15 filter for emission.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 29

Flow cytometry analysis of cyclic di-GMP dynamics As described above, wild-type or dgcZ- BL21(DE3) Star E. coli cells transformed with Pl-B or Spinach2 were grown in ZYP-5052 autoinduction media

19

without or with 1 mM zinc or other

metals (0.5-1 mM) overnight at 37 °C with shaking to induce biosensor production. For zinc depletion experiments, 1 µL of the zinc-containing culture was added to 500 µL of filtered spent media from the culture without zinc to achieve 1:500 dilution (1 mM to 2 µM), whereas for control experiments, 1 µL of the zinc-containing culture was diluted into 500 µL of filtered spent media from the same culture (see Fig. 1 for schematic). The diluted cultures were transferred to 37 °C and incubated for 10 min for dye equilibration, then 70 µL aliquots were taken every 5 min for flow cytometry analysis. To obtain the MFI value, we analyze single-cell fluorescence of a population of 10,000 cells per time point per biological replicate for at least three independent biological replicates per cell type. One important difference between this approach and fluorescence microscopy is that individual cells are not tracked over time, because they are discarded after analysis in the flow chamber. Instead, in flow cytometry, the single-cell fluorescence of a given cell population is sampled over time, which provides highly statistically reliable MFI values that reflect the mean intracellular cyclic di-GMP levels. Furthermore, cells analyzed in flow cytometry are not exposed to repeated light excitation or centrifugation and media changes. ∆MFI/MFI values were calculated by taking the difference between the two MFI values at each time point (MFI–Zn – MFI+Zn) and dividing it into the MFI+Zn value.

Fluorescence microscopy imaging of cyclic di-GMP dynamics


Page 9 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Wild-type or dgcZ- BL21(DE3) Star E. coli cells transformed with Pl-B or Spinach2 were grown in ZYP-5052 autoinduction media19 with 1 mM zinc for 18 h at 37 °C with shaking to induce biosensor production. To prepare cells for microscopy, 50 µL of the culture was gently spun down using a mini-centrifuge for 30 sec, pelleted cells were washed once with 100 µL of M9 minimal media containing 1 mM ZnCl2, spun down again, then resuspended in 200 µL of M9 minimal media (47.7 mM Na2HPO4, 22 mM KH2PO4, 8.55 mM NaCl, 18.7 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2, 0.4% glucose) containing 1 mM ZnCl2. A 50 µL aliquot of cells was transferred to one sample well of a CELLview Slide (Greiner Bio-One) and incubated for 15 min at 37 °C for cells to attach. For depletion experiments, the sample well was washed twice gently with M9 media without ZnCl2, then cells were incubated for 10 min in M9 media without ZnCl2 containing 200 µM DFHBI-1T. For control experiments, the same was performed with M9 media containing 1 mM ZnCl2. Fluorescence images were obtained every 3 min with a Zeiss AxioObserver Z1 microscope (Zeiss, Jena, Germany) using an 100X oil objective lens and equipped with a Pecon chamber temperature control and Hamamatsu 9100-13 EMCCD camera with GFP filter set. Fluorescence of 30 bacterial cells picked using only the DIC images from at least two independent images taken on different days were quantified using the fluorescence images using ImageJ software and the fluorescence intensity value from the first time point (10 min) was used to calculate ∆F/F for each time point (∆F/F = F – F10min) / F10min).

Soft agar motility assays Wild type and dgcZ- MG1655 cells transformed with Spinach2 were grown at 37 °C for two hours in liquid culture in LB media. Each culture was divided into two tubes and to one of these tubes ZnCl2 was added to a final concentration of 1 mM. After overnight growth at 37 °C, culture


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 29

densities were adjusted to OD600 = 4 then 3 µL of the cultures were spotted onto agar plates containing 0.5% tryptone, 0.5% NaCl, and 0.3% agar. These conditions were chosen because motility is highly repressed for WT MG1655 cells on LB plates, which contains 1% tryptone and 0.5% yeast extract, so changes in motility phenotypes are not observable. Cells grown with 1 mM zinc were spotted on agar plates containing 0.1 mM zinc. Concentrations of zinc on plates were lowered because WT MG1655 cells did not appear to grow on these plates with 1 mM zinc, although they grow normally on LB plates with 1 mM zinc. Cells grown without zinc were spotted on agar plates without zinc. Plates were allowed to air dry at room temperature for 30 min before being inverted and incubated at 28 ˚C overnight. Digital photos of the plates were taken and the diameters of the growth zones on each plate were measured.

Antibiotic susceptibility assays LB agar plates were prepared with or without supplementation with 0.5 mM metal salts (ZnCl2, MnCl2, NiCl2, or CuCl2) and with varying concentrations of antibiotics (0, 2, or 4 µg/mL kanamycin or 0, 1 or 2 µg/mL chloramphenicol). Wild-type MG1655 cells were grown in LB media overnight at 37 °C with shaking, then 30 µL of the overnight culture was used to inoculate 3 mL of LB media. The culture was grown at 37 °C with shaking for 4 h, diluted to an OD600 of 0.25 with PBS (~2x108 cells/mL), and then serial dilutions were prepared in PBS (1:100, 1:500, 1:2500, 1:12,500). A 10 µL aliquot of each serial dilution was spotted in duplicate onto each plate, the plates were incubated at 37 °C overnight, then digital photos were taken of the colonies formed on the plates.


Page 11 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1. Schematics for endpoint and dynamic flow cytometry experiments. Method for expressing biosensor and preparing dilute cell cultures for flow cytometry experiments without changing media composition is shown. Top plot is a representative forward scatter versus side scatter dot plot with box indicating the gate used to select cells for analysis. Other plots are representative histograms of fluorescence intensity signals for single cells from the selected population. RESULTS Effect of zinc on cyclic di-GMP production in live E. coli cells To provide direct visualization of changes in intracellular cyclic di-GMP levels induced by zinc supplementation, we used an RNA-based biosensor called Pl-B that exhibits bright fluorescence turn-on, nanomolar sensitivity, and fast response to cyclic di-GMP (Fig. S1)20. Pl-B was expressed in E. coli BL21(DE3) Star cells by growth in autoinduction media for 18 h with different zinc concentrations. To analyze intracellular cyclic di-GMP levels by flow cytometry,


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 29

Pl-B-expressing cells were diluted into filtered spent media collected from each culture (Fig. 1, see Materials and Methods for details), the fluorescent dye DFHBI-1T was added, then biosensor fluorescence was measured for 10,000 individual bacterial cells per sample replicate. As expected, mean fluorescence intensity (MFI) values for the cell population decreased with increasing zinc exposure (Fig. 2a, b), such that the MFI of cells grown with 1 mM zinc was about 50% that of cells grown without externally added zinc. In contrast, biosensor fluorescence in the corresponding dgcZ- strain was constant regardless of zinc concentrations, consistent with the requirement for this signaling enzyme in zinc response. Mass spectrometry analysis of cyclic di-GMP content in the corresponding bulk cell extracts agreed with these observations, although cyclic di-GMP levels were below the detection limit in the presence of zinc (Fig. S2). In addition, we found that cells expressing the constitutively fluorescent RNA construct, Spinach2, did not exhibit changes in MFI with varying zinc concentrations (Fig. 2a). This result combined with the dgcZ- data show that changes in intracellular zinc concentrations do not influence biosensor fluorescence directly, but rather through DgcZ-dependent changes in cyclic di-GMP levels. Based on the reported affinities of metalloregulatory proteins, the intracellular concentration of free zinc is thought to be maintained in the femtomolar range21, and DgcZ has affinity for zinc in this range16. Finally, we showed that the growth of E. coli cells in autoinduction media is not significantly affected by 1 mM zinc supplementation (Fig. S3), similar to published results in LB media22, 23. Taken together, these results demonstrate that the Pl-B fluorescent biosensor is sensitive enough to detect single-cell changes in intracellular cyclic di-GMP modulated by a natural chemical input, zinc, which acts through a single diguanylate cyclase, DgcZ.


Page 13 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. Observation of zinc repressing cyclic di-GMP synthesis by the diguanylate cyclase DgcZ in live E. coli cells. (a) Average mean fluorescence intensity (MFI) values measured by flow cytometry for WT and dgcZ- BL21(DE3) Star cells expressing either Pl-B or Spinach2 grown overnight at 37 °C in autoinduction media containing 0 to 1 mM zinc. MFI values were normalized by dividing by the MFI value for cells grown without zinc. Error bars represent standard deviation between six independent biological replicates. P-values were determined by student’s t-test and those not shown are >0.25. (b) Representative flow histogram for cells expressing Pl-B grown without zinc or with 1 mM zinc. (c) Normalized changes in MFI values (∆MFI/MFI) for WT and dgcZ- BL21(DE3) Star cells expressing either Pl-B or Spinach2 upon 1:500 dilution of cells to reduce zinc concentrations at time 0. First timepoint was at 10 min to ensure dye equilibration. Error bars represent standard deviation between at least three independent biological replicates.

Dynamics of cyclic di-GMP production in cells upon zinc depletion Based on the above results, we expect that zinc depletion should de-repress DgcZ and thus increase cyclic di-GMP levels. This depletion experiment provides a direct view of DgcZdependent changes in cyclic di-GMP levels, whereas the converse experiment, with zinc addition, involves not only DgcZ but also the activity of phosphodiesterases that specifically degrade cyclic di-GMP. Furthermore, we found that zinc chloride precipitates upon addition to


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 29

spent media, whereas it readily dissolves in freshly prepared media. So, for both experimental and practical reasons, we chose to analyze cyclic di-GMP dynamics upon zinc depletion. E. coli BL21(DE3) Star cells were grown in autoinduction media for 18 h with 1 mM zinc to express the Pl-B biosensor and to repress DgcZ activity. At time 0, cells were diluted 1:500 into filtered spent media either with or without supplemented zinc and the fluorescent dye DFHBI-1T was added. After 10 min incubation at 37 °C to allow the dye to diffuse and equilibrate in cells, we measured MFI values of the cell populations by flow cytometry in 5 min intervals. To show the effect of zinc depletion, we report the data as ∆MFI/MFI, which calculates the difference between the two MFI values at each time point (MFI–Zn – MFI+Zn) and divides by the MFI+Zn. As shown, Pl-B biosensor fluorescence increases with time upon zinc depletion in wildtype E. coli cells, reaching a plateau within 30 min (Fig. 2c). Previously we showed that the biosensor gives half-maximal signal within 1 min20, so the observed timeframe reflects enzyme activation and cyclic di-GMP buildup as the slow step. In contrast, no change in Pl-B biosensor fluorescence is observed in the dgcZ- strain, or if the constitutively fluorescent RNA construct, Spinach2, is expressed in these strains instead of the biosensor. Furthermore, a non-responsive variant of the biosensor, Pl-B-M1, showed minimal fluorescence irrespective of zinc levels (Fig. S1d). Taken together, these results demonstrate that flow cytometry with the Pl-B biosensor can be used to monitor real-time single-cell population dynamics of cellular cyclic di-GMP levels in response to environmental changes, which we have modeled with zinc depletion. Importantly, we visualize this physiological response in wild-type E. coli cells going from high to low zinc levels (1 mM to 2 µM based on 1:500 dilution of cells) and show that this response is dependent on the diguanylate cyclase DgcZ.


Page 15 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Effect of other divalent metals on cyclic di-GMP levels In addition to zinc, other divalent metals are essential for many biological processes, serving as cofactors or structural components of metalloproteins24. While the CZB domain in a methylaccepting chemotaxis protein has been shown to be specific for zinc25 and DgcZ has been shown to bind zinc with high affinity16, the metal specificity of DgcZ has not been investigated. With the flow cytometry methods described above, we analyzed the effect of other divalent metals at different concentrations on steady-state cyclic di-GMP levels and dynamics of cyclic di-GMP production in wild-type and dgcZ- cells.

Figure 3. Cellular cyclic di-GMP production is directly repressed by zinc and not other divalent cations. Similar endpoint and dynamic experiments as described in Fig. 2 were repeated for manganese, nickel, iron, and copper (see Fig. S8 for other concentrations). Error bars represent standard deviation between four independent biological replicates for (a). P-values were determined by student’s t-test (* < 0.04, ** < 0.007, or unlabeled > 0.1). Three independent biological replicates were analyzed for (b), but error bars are not shown for clarity. In contrast to overnight zinc supplementation, which led to decreased MFI values in a concentration-dependent manner (Fig. 2), we do not see consistent trends in MFI values with different concentrations of manganese, nickel, iron, or copper (Fig. 3a, S4). We did not test cadmium or cobalt because these metals are highly toxic to E. coli23. The maximum concentration of nickel, iron, and copper added to the media was 0.5 mM, because 1 mM nickel inhibited cell growth and 1 mM iron or copper produced large population heterogeneity that


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 29

interfered with accurate fluorescence analysis (data not shown). Similar controls were performed as for zinc supplementation, and showed that DgcZ knockout has no effect and that other tested metals do not affect the constitutively fluorescent RNA construct, Spinach2. These data are consistent with manganese, nickel, iron, and copper not affecting DgcZ activity or cyclic di-GMP levels in vivo. Since the MFI values from overnight supplementation were somewhat variable, we considered that the cyclic di-GMP dynamics experiment could be more instructive. In particular, we had shown that the DgcZ-dependent increase in cyclic di-GMP levels occurs within 30 min of zinc depletion (Fig. 2b), so we expect to observe direct effects of environmental inputs on signaling enzyme activity in this time range. The same depletion experiments with manganese, nickel, iron, or copper showed no change in biosensor fluorescence in this timeframe (Fig. 3b). Taken together, these results reveal that cyclic di-GMP signaling in E. coli selectively responds to zinc and not to manganese, nickel, or iron, copper. The throughput and dynamic monitoring capacity of the in vivo biosensor further allowed us to show that zinc responsiveness requires DgcZ and to distinguish between direct versus indirect effects on the signaling pathway. Thus, this flow cytometry method demonstrates high promise for screening and discovering other environmental inputs that directly regulate cyclic di-GMP signaling. Microscopy imaging of cyclic di-GMP production upon zinc depletion While flow cytometry is useful for real-time single-cell population dynamics measurements, fluorescence microscopy is a more commonly employed method for live cell imaging. We repeated the zinc depletion experiments to demonstrate that our biosensor also is suited for analyzing cyclic di-GMP dynamics using fluorescence microscopy. One important change in the experimental protocol was that cells had to be pelleted by centrifugation, resuspended in M9


Page 17 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

minimal media with or without zinc, and attached to lysine coated slides, because the autoinduction media exhibits too high autofluorescence for microscopy analysis. In contrast, the flow cytometry experiments did not require centrifugation, media changes, or surface attachment.

Figure 4. Fluorescence microscopy tracking of cyclic di-GMP production in single cells upon zinc depletion. (a) Representative fluorescence images at four timepoints and corresponding differential interference contrast (DIC) images for WT and dgcZ- BL21(DE3) Star cells expressing either Pl-B or Spinach2 upon media change into M9 media without zinc (-Zn) or with zinc (+Zn, control). (b) Normalized changes in fluorescence values (∆F/F) at each time point for 30 cells from two independent microscopy experiments.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 29

Fortunately, these manipulations of the cells had minimal effects on biosensor fluorescence (Fig. S5). At time 0, the unattached cells were rinsed out and attached cells on the slide were incubated with M9 minimal media either with or without supplemented zinc and the fluorescent dye DFHBI-1T was added. After 10 min incubation at 37 °C to allow the dye to diffuse and equilibrate in cells, fluorescence of cells was measured in 3 min intervals. Representative raw fluorescence images are shown in Fig. 4a and recapitulate what was observed in flow cytometry. Only wild-type cells expressing the Pl-B biosensor show clear fluorescence increases with time upon zinc depletion. To track the effect of zinc depletion in individual cells, we report the data as ∆F/F for two independent microscopy experiments (Fig. 4b). The results for cyclic di-GMP single-cell dynamics obtained by fluorescence microscopy correspond to the results obtained by flow cytometry, demonstrating that the Pl-B biosensor is useful for visualizing cyclic di-GMP dynamics in both formats.

Applying biosensor findings to cyclic di-GMP phenotypes in non-engineered E. coli One potential critique of our experiments is that we observe cyclic di-GMP levels in an engineered E. coli strain expressing the Pl-B biosensor. However, we consider this system to be a useful, genome sequenced, and genetically tractable in vivo model that allows us to predict effects in non-engineered strains harboring the same diguanylate cyclase genes. To illustrate the applicability of the findings from our model system, we analyzed cyclic di-GMP-dependent phenotypes in E. coli MG1655, a strain that is motile and has minimal genetic mutations from the original K-12 isolate. Flagellar-based motility is inversely related to cyclic di-GMP levels in E. coli, e.g. lower intracellular cyclic di-GMP leads to higher motility. Binding of cyclic di-GMP to the PilZ


Page 19 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

domain of YcgR induces a conformational change that strengthens the interaction of YcgR with the flagellar switch-complex proteins FliG and FliM3, 26. This leads to reduced torque generation efficiency and creates a counterclockwise motor bias3, thus YcgR is called a flagellar brake. Since biosensor fluorescence showed that externally added zinc reduces cyclic di-GMP levels, we hypothesize that zinc would increase cell motility of E. coli MG1655, a strain commonly used to study motility phenotypes. WT and dgcZ- MG1655 cells were grown with 1 mM zinc in liquid culture, then motility was measured by spotting of cells on soft agar plates with 0.5% tryptone and either 0.1 mM zinc or no supplemented zinc (Fig. 5a). WT MG1655 cells grown on zinc plates exhibited 31 ± 6% higher motility compared to cells grown without zinc supplementation, consistent with lower cyclic di-GMP levels in cells in presence of zinc. In contrast, dgcZ- MG1655 cells grown with and without zinc exhibited equal motilities, consistent with zinc response being dependent on this diguanylate cyclase. Without zinc supplementation, dgcZ- MG1655 cells exhibited 15 ± 5% higher motility compared to WT MG1655 cells, which shows that DgcZ activity normally contributes to cyclic di-GMP under these conditions. These results show that DgcZ increases cellular motility of WT E. coli under high zinc exposure.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 29

Figure 5. Effect of zinc supplementation on cyclic di-GMP signaling phenotypes in E. coli MG1655. (a) Cell motility on soft agar plates for WT and dgcZ- MG1655 cells grown with or without zinc. Representative photos are shown and the radii of motility zones were measured for three independent biological replicates. P-values were determined by student’s t-test. (b) Cell growth of WT MG1655 cells spotted at four different serial dilutions on LB plates with or without zinc and various concentrations of kanamycin or chloramphenicol. Biofilm formation is also strongly associated with cyclic di-GMP levels in many bacteria including E. coli; higher intracellular cyclic di-GMP generally induces biofilm formation. A previous study reported that sub-MIC exposure to a wide panel of ribosome-targeting antibiotics strongly induces biofilm formation in E. coli, while deletion of the dgcZ gene specifically impairs formation of biofilm in response to aminoglycoside class antibiotics27. Without the ability to make protective biofilms, the E. coli K-12 csrA::Tn5 ∆dgcZ mutant strain (called ∆ydeH in the original paper) showed increased sensitivity to sub-MIC of antibiotics27. A later study showed that zinc reduces poly-GlcNAc-dependent biofilms in E. coli, whereas the ∆dgcZ strain or strain harboring a zinc-blind dgcZ allele do not show zinc-dependent effects on biofilm


Page 21 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

formation16. However, these studies were performed in a csrA- ppGpp0 strain, which has elevated dgcZ and pgaABCD expression16. Thus, we considered whether repression of DgcZ activity by its natural chemical input, zinc, could sensitize wild-type E. coli to aminoglycoside antibiotics. WT MG1655 cells were first grown without zinc supplementation in liquid culture, then serial dilutions of cells were spotted on LB agar plates with antibiotics and/or zinc and cell growth was visualized after 16 h incubation at 37 °C (Fig. 5b). Slight growth inhibition is observed on plates containing both 2 µg/mL of kanamycin and 0.5 mM zinc, which is a zinc concentration shown to partially repress DgcZ activity (Fig. 2a), whereas no growth inhibition is observed on plates only containing 2 µg/mL of kanamycin, which is a sub-MIC concentration shown to induce biofilm formation27. Antibiotic sensitization is more clearly observed comparing cells grown on LB agar plates containing 4 µg/mL of kanamycin with and without 0.5 mM zinc. This effect is not due to zinc toxicity, because MG1655 cells grow the same on LB agar plates containing no antibiotics with and without 0.5 mM zinc (Fig. 5b, first column). Furthermore, this effect is strongest for aminoglycoside antibiotics, which were shown to induce biofilm in a DgcZ-dependent manner, compared to chloramphenicol, which still induces partial biofilm in a ∆dgcZ strain27. These results show that we can rationally program cyclic di-GMP-dependent behavior, including cell motility and antibiotic-resistant biofilm formation, with a natural chemical input, zinc. Surprisingly, we found that copper had an extremely potent antibiotic sensitization effect with kanamycin, whereas manganese and nickel did not (Fig. S6). Since all three of these divalent metals were shown to not affect cyclic di-GMP levels (Fig. 3), we had not expected any of them to affect antibiotic susceptibility. However, previous studies showed that copperkanamycin complexes can generate reactive oxygen species28 and cause cleavage of mRNA


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 29

transcripts in E. coli29. Thus, antibiotic sensitization by copper appears to be independent of effects on biofilm formation. We did not test iron because it also is well-known to cause oxidative stress. Indeed, this result emphasizes that visualizing cyclic di-GMP dynamics in bacterial cells provides a way to distinguish phenotypic effects of chemical inputs that are related to the signaling pathway versus unrelated mechanisms.

DISCUSSION This study demonstrates that a chemical input can be validated by our flow cytometry assay to specifically and directly control cyclic di-GMP levels by targeting an endogenous diguanylate cyclase enzyme in E. coli cells. Specificity for cyclic di-GMP signaling is conferred by applying an RNA-based fluorescent biosensor that responds only to cyclic di-GMP compared to other cyclic dinucleotides and is even ~2000-fold selective against the linear dinucleotide pGpG20. By monitoring the dynamics of cyclic di-GMP response in single cell populations, we show that zinc depletion leads to an increase in intracellular cyclic di-GMP by de-repressing the enzyme DgcZ, whereas other divalent metals do not appear to directly affect cyclic di-GMP signaling. The ability to perform both endpoint (after overnight incubation) and timepoint assays in a highthroughput format with single-cell resolution is highly enabling for discovery and validation of direct chemical inputs to cyclic di-GMP signaling. In particular, we reveal that the biosensor detects increasing cyclic di-GMP levels within 15-30 mins after zinc depletion. This timeframe could be used to diagnose direct inputs to the signaling enzymes, as zinc is for DgcZ, versus indirect effects on the signaling pathway. These results further demonstrate that DgcZ activity is specifically regulated by zinc in vivo. A recent study found that the CZB domain of DgcZ interacts with a subunit of the fumarate


Page 23 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

reductase complex, but the effect of zinc on this interaction was not evaluated30. In addition, the chemoreceptor TlpD, which harbors the first identified CZB domain, has been shown to respond to iron and other sources of oxidative stress31. Thus, we considered whether the actual regulatory signal may be oxidative stress, which can be caused by zinc and copper as well as iron. Our results clearly show that cyclic di-GMP levels can be measurably and rapidly altered in live wildtype E. coli cells going from an environment with 1 mM to at least 2 µM zinc, but no such direct effects are seen with depletion of copper or iron. Importantly, these concentration ranges of zinc are relevant to different host-associated environment niches. The mean zinc concentration in human blood serum and urine is high (>15 µM)32, whereas in most host cells free zinc concentrations are thought to be very low (60-270 pM)33. It also has been shown that upon infection, host immune cells can release zinc from intracellular stores, greatly increasing the local free zinc concentration and potentially enhancing bactericidal capacity34. The diguanylate cyclase required for zinc responsiveness, DgcZ, is highly conserved in E. coli strains, including uropathogenic (CFT073) and enterohaemorrhagic (O157) strains, and Pfam identifies homologous diguanylate cyclases with CZB and GGDEF domains in diverse gram negative bacteria (Table S1). Thus, we expect that these bacteria could be sensitized to antibiotics, particularly aminoglycosides but potentially other antibiotic classes as well, by exploiting the ability of zinc to repress biofilm formation in these organisms. Promisingly, 0.4 mM of zinc alone has already been shown to inhibit Shiga toxin production and reduce intestinal damage by enterohaemorrhagic E. coli35, and several field trials have shown that zinc supplementation reduces the duration and severity of diarrhea in children36. Given the key role of cyclic di-GMP in promoting bacterial attachment and surface colonization, and our demonstration here that these levels of zinc repress cyclic di-GMP signaling in wild-type E. coli


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cells, this study advances the mechanistic hypothesis that DgcZ is the physiological target for these clinically beneficial effects of zinc. Beyond zinc and DgcZ, these results support a rationally designed approach to prebiotic treatments that enhance antibiotics efficacy. By doing in vivo biochemistry experiments in model, genetically tractable bacterial strains, we aim to discover natural chemical inputs that reduce cyclic di-GMP levels and trace the signaling response to inactivation of a specific diguanylate cyclases or activation of a specific phosphodiesterase enzyme. This knowledge can be coupled to transcriptomic analyses of cyclic di-GMP signaling enzymes expressed in clinical isolates or microbiome samples to predict chemical inputs that reduce biofilm formation and manipulate niche colonization by different bacterial pathogens. The converse logic may be applied to promote colonization of beneficial commensal bacteria. Targeting multiple signaling enzymes in the same pathway may lead to additive effects and reduce the occurrence of singlegene resistance mechanisms. Thus, it remains imperative to discover the chemical inputs that directly regulate the activity of cyclic di-GMP signaling enzymes in different bacteria.

ASSOCIATED CONTENT Supporting Information. Supplemental methods, results (Figures S1-S10, Table S1), and references. Acknowledgements. We thank Dr. Steven Ruzin and Dr. Denise Schichnes from Biological Imaging Facility, University of California, Berkeley for training and technical assistance on use of the Zeiss AxioObserver Z1 inverted fluorescence microscope. We thank Dr. Anthony Lavarone from QB3/Chemistry Mass Spectrometry Facility for technical assistance on the mass spectrometry experiment.


Page 24 of 29

Page 25 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Funding Information. This work was funded by the National Institutes of Health (NIH) DP2 OD008677 and R01 GM124589 grants to M.C.H. Notes. The authors declare no competing financial interest.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 29

References [1] Romling, U., Galperin, M. Y., and Gomelsky, M. (2013) Cyclic di-GMP: the first 25 years of a universal bacterial second messenger, Microbiol. Mol. Biol. Rev. 77, 1-52. [2] Sondermann, H., Shikuma, N. J., and Yildiz, F. H. (2012) You've come a long way: c-di-GMP signaling, Curr. Opin. Microbiol. 15, 140-146. [3] Paul, K., Nieto, V., Carlquist, W. C., Blair, D. F., and Harshey, R. M. (2010) The c-di-GMP binding protein YcgR controls flagellar motor direction and speed to affect chemotaxis by a "backstop brake" mechanism, Mol. Cell 38, 128-139. [4] Navarro, M. V., Newell, P. D., Krasteva, P. V., Chatterjee, D., Madden, D. R., O'Toole, G. A., and Sondermann, H. (2011) Structural basis for c-di-GMP-mediated inside-out signaling controlling periplasmic proteolysis, PLoS Biol. 9, e1000588. [5] Deng, Y., Schmid, N., Wang, C., Wang, J., Pessi, G., Wu, D., Lee, J., Aguilar, C., Ahrens, C. H., Chang, C., Song, H., Eberl, L., and Zhang, L. H. (2012) Cis-2-dodecenoic acid receptor RpfR links quorum-sensing signal perception with regulation of virulence through cyclic dimeric guanosine monophosphate turnover, Proc. Natl. Acad. Sci. U. S. A. 109, 15479-15484. [6] Hengge, R. (2009) Principles of c-di-GMP signalling in bacteria, Nat. Rev. Microbiol. 7, 263273. [7] Wolfe, A. J., and Berg, H. C. (1989) Migration of bacteria in semisolid agar, Proc. Natl. Acad. Sci. U. S. A. 86, 6973-6977. [8] O'Toole, G. A., Pratt, L. A., Watnick, P. I., Newman, D. K., Weaver, V. B., and Kolter, R. (1999) Genetic approaches to study of biofilms, Methods Enzymol. 310, 91-109. [9] Spangler, C., Bohm, A., Jenal, U., Seifert, R., and Kaever, V. (2010) A liquid chromatography-coupled tandem mass spectrometry method for quantitation of cyclic diguanosine monophosphate, J. Microbiol. Methods 81, 226-231. [10] Christen, M., Kulasekara, H. D., Christen, B., Kulasekara, B. R., Hoffman, L. R., and Miller, S. I. (2010) Asymmetrical distribution of the second messenger c-di-GMP upon bacterial cell division, Science 328, 1295-1297. [11] Kellenberger, C. A., Wilson, S. C., Sales-Lee, J., and Hammond, M. C. (2013) RNA-based fluorescent biosensors for live cell imaging of second messengers cyclic di-GMP and cyclic AMP-GMP, J. Am. Chem. Soc. 135, 4906-4909. [12] Ho, C. L., Chong, K. S., Oppong, J. A., Chuah, M. L., Tan, S. M., and Liang, Z. X. (2013) Visualizing the perturbation of cellular cyclic di-GMP levels in bacterial cells, J. Am. Chem. Soc. 135, 566-569. [13] Mills, E., Petersen, E., Kulasekara, B. R., and Miller, S. I. (2015) A direct screen for c-diGMP modulators reveals a Salmonella Typhimurium periplasmic L-arginine-sensing pathway, Sci. Signal 8, ra57. [14] Wang, X. C., Wilson, S. C., and Hammond, M. C. (2016) Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP, Nucleic Acids Res. 44, e139. [15] Hallberg, Z. F., Wang, X. C., Wright, T. A., Nan, B., Ad, O., Yeo, J., and Hammond, M. C. (2016) Hybrid promiscuous (Hypr) GGDEF enzymes produce cyclic AMP-GMP (3', 3'cGAMP), Proc. Natl. Acad. Sci. U. S. A. 113, 1790-1795. [16] Zahringer, F., Lacanna, E., Jenal, U., Schirmer, T., and Boehm, A. (2013) Structure and signaling mechanism of a zinc-sensory diguanylate cyclase, Structure 21, 1149-1157.


Page 27 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[17] Song, W., Strack, R. L., Svensen, N., and Jaffrey, S. R. (2014) Plug-and-play fluorophores extend the spectral properties of Spinach, J. Am. Chem. Soc. 136, 1198-1201. [18] Paige, J. S., Nguyen-Duc, T., Song, W., and Jaffrey, S. R. (2012) Fluorescence imaging of cellular metabolites with RNA, Science 335, 1194. [19] Studier, F. W. (2005) Protein production by auto-induction in high density shaking cultures, Protein Expr. Purif. 41, 207-234. [20] Wang, X. C., Wilson, S. C., and Hammond, M. C. (2016) Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP, Nucleic Acids Res. [21] Outten, C. E., and O'Halloran, T. V. (2001) Femtomolar sensitivity of metalloregulatory proteins controlling zinc homeostasis, Science 292, 2488-2492. [22] Yamamoto, K., and Ishihama, A. (2005) Transcriptional response of Escherichia coli to external zinc, J. Bacteriol. 187, 6333-6340. [23] Brocklehurst, K. R., and Morby, A. P. (2000) Metal-ion tolerance in Escherichia coli: analysis of transcriptional profiles by gene-array technology, Microbiology 146 ( Pt 9), 2277-2282. [24] Porcheron, G., Garenaux, A., Proulx, J., Sabri, M., and Dozois, C. M. (2013) Iron, copper, zinc, and manganese transport and regulation in pathogenic Enterobacteria: correlations between strains, site of infection and the relative importance of the different metal transport systems for virulence, Front. Cell. Infect. Microbiol. 3, 90. [25] Draper, J., Karplus, K., and Ottemann, K. M. (2011) Identification of a chemoreceptor zincbinding domain common to cytoplasmic bacterial chemoreceptors, J. Bacteriol. 193, 4338-4345. [26] Ryjenkov, D. A., Simm, R., Romling, U., and Gomelsky, M. (2006) The PilZ domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria, J. Biol. Chem. 281, 30310-30314. [27] Boehm, A., Steiner, S., Zaehringer, F., Casanova, A., Hamburger, F., Ritz, D., Keck, W., Ackermann, M., Schirmer, T., and Jenal, U. (2009) Second messenger signalling governs Escherichia coli biofilm induction upon ribosomal stress, Mol. Microbiol. 72, 1500-1516. [28] Szczepanik, W., Kaczmarek, P., Sobczak, J., Bal, W., Gatner, K., and Jezowska-Bojczuk, M. (2002) Copper(ii) binding by kanamycin A and hydrogen peroxide activation by resulting complexes, New J. Chem. 26, 1507-1514. [29] Chen, C. A., and Cowan, J. A. (2002) In vivo cleavage of a target RNA by copper kanamycin A. Direct observation by a fluorescence assay, Chem Commun (Camb), 196197. [30] Lacanna, E., Bigosch, C., Kaever, V., Boehm, A., and Becker, A. (2016) Evidence for Escherichia coli Diguanylate Cyclase DgcZ Interlinking Surface Sensing and Adhesion via Multiple Regulatory Routes, J. Bacteriol. 198, 2524-2535. [31] Collins, K. D., Andermann, T. M., Draper, J., Sanders, L., Williams, S. M., Araghi, C., and Ottemann, K. M. (2016) The Helicobacter pylori CZB Cytoplasmic Chemoreceptor TlpD Forms an Autonomous Polar Chemotaxis Signaling Complex That Mediates a Tactic Response to Oxidative Stress, J. Bacteriol. 198, 1563-1575. [32] Vallee, B. L., and Falchuk, K. H. (1993) The biochemical basis of zinc physiology, Physiol. Rev. 73, 79-118. [33] Maret, W. (2015) Analyzing free zinc(II) ion concentrations in cell biology with fluorescent chelating molecules, Metallomics 7, 202-211.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[34] Djoko, K. Y., Ong, C. L., Walker, M. J., and McEwan, A. G. (2015) The Role of Copper and Zinc Toxicity in Innate Immune Defense against Bacterial Pathogens, J. Biol. Chem. 290, 18954-18961. [35] Crane, J. K., Byrd, I. W., and Boedeker, E. C. (2011) Virulence inhibition by zinc in shigatoxigenic Escherichia coli, Infect. Immun. 79, 1696-1705. [36] Bhandari, N., Bahl, R., Taneja, S., Strand, T., Molbak, K., Ulvik, R. J., Sommerfelt, H., and Bhan, M. K. (2002) Substantial reduction in severe diarrheal morbidity by daily zinc supplementation in young north Indian children, Pediatrics 109, e86.


Page 28 of 29

Page 29 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

FOR TABLE OF CONTENTS USE ONLY In Vivo Biochemistry: Single-cell dynamics of cyclic di-GMP in E. coli in response to zinc overload Jongchan Yeo, Andrew B. Dippel, Xin C. Wang, and Ming C. Hammond


In Vivo Biochemistry: Single-Cell Dynamics of ... - ACS Publications

Recommend Documents