Influence of Porosity and Pore-Size Distribution in Ti6Al4 V Foam on

Subscriber access provided by Grand Valley State | University

Article

Influence of porosity and pore size distribution in Ti6Al4V foam on physicomechanical properties, osteogenesis and quantitative validation of bone ingrowth by micro-CT Kausik Kapat, Pavan Kumar Srivas, Arun Prabhu Rameshbabu, Priti Prasanna Maity, Subhodeep Jana, Joy Dutta, Pallab Majumdar, Debalay Chakrabarti, and Santanu Dhara ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b13960 • Publication Date (Web): 23 Oct 2017 Downloaded from http://pubs.acs.org on October 24, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Influence of porosity and pore size distribution in Ti6Al4V foam on physicomechanical properties, osteogenesis and quantitative validation of bone ingrowth by micro-CT Kausik Kapata, Pavan Kumar Srivasa, Arun Prabhu Rameshbabua, Priti Prasanna Maitya, Subhodeep Janaa, Joy Duttaa, Pallab Majumdarb, Debalay Chakrabartib, Santanu Dharaa,ǂ a

Biomaterials & Tissue Engineering Laboratory, School of Medical Science & Technology,

Indian Institute of Technology Kharagpur, India -721302 b

Department of Metallurgical and Materials Engineering, Indian Institute of Technology

Kharagpur, India -721302

ǂ Corresponding Author: S. Dhara; Email address: [email protected]; Tel.: +91-3222-282306; fax: +91-3222-255303

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 35

Abstract Cementless fixation for orthopaedic implants aims to obviate challenges associated with bone cement providing long-term stability of bone prosthesis after implantation. Application of porous titanium and its alloy based implants is emerging for load-bearing applications due to their high specific strength, low stiffness, corrosion resistance and superior osteoconductivity. In this study, coagulant assisted foaming was utilized for fabrication of porous Ti6Al4V using egg white foam. Samples with three different porosities of 68.3, 75.4 and 83.1% and average pore sizes of 92, 178 and 297 µm, respectively were prepared and subsequently chareaterized for mechanical properties, osteogenesis and tissue ingrowth. Microstructuremechanical properties relationship study revealed that increase of porosity from 68.3 to 83.1% increased average pore size from 92 to 297 µm with subsequent reduction of compresive strength by 85% and modulus by 90%. Samples with 75.4% porosity and 178 µm average pore size produced signifcant osteogenic effects on human mesenchymal stem cells, which was further supported by immunocytochemistry and RT-PCR data. Quantitative assessment of bone ingrowth by micro-CT revealed that there was an approximately 52% higher bone formation and more than 90% higher bone penetration at the center of femoral defects in rabbit when implanted with Ti6Al4V foam (75.4% porosity) compared to the empty defects after 12 weeks. Hematoxylin & eosin (H&E) and Masson trichrome (MT) staining along with EDX mapping on the sections obtained from the retrived bone samples supports bone ingrowth into the implanted region. Keywords: Ti6Al4V foam, powder metallurgy, porous implant, microstructure, bone ingrowth, micro-CT imaging


Page 3 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction In the last few years, performance of titanium and its alloys based implants have been found superior over many of the conventional biomaterials for orthopaedic applications owing to high specific strength, superior biocompatibility and corrosion resistance.1-3 Titanium can be fabricated into different geometric patterns without alteration to its biocompatibility. Although, parallel to these advantageous traits, occurrences of fibrous tissue formation on the bio-inert surface, poor interfacial bonding to the surrounding bone, micro-motion, aseptic loosening and untimely failure of the titanium implants were also reported.4-6 Moreover, titanium and its alloys have substantially higher stiffness (elastic modulus of Ti 110 GPa, Ti6Al-4V 125 GPa) than bone (cancellous 1.5–11.2 GPa, cortical 7–20 GPa) which primarily leads to consequences of stress-shielding induced osteolysis.7 Titanium implants with a porous body or dense core with porous coating were designed decades back 8 with an objective to minimize the gap between modulus of implants and that of human bone and thereby improve interfacial bonding. Closer values of elastic modulus between implant/bone minimize stress shielding effect, cause lesser damage to the surrounding tissues vis-à-vis bone-implant interface and impart higher fatigue resistance at these sites.9 Porosity based reduction of stiffness indirectly facilitated the development of uncemented prostheses.10 Porous materials provide improved biological fixation due to enhanced bone ingrowth into the pores facilitating a higher volume of tissue-material interaction and efficient load transfer along the interface.11 Higher surface area in porous structure along with three-dimensional pore connectivity were clinically proven to promote tissue adhesion, growth and vascularization through transport of oxygen and nutrients.12-13 However, bone ingrowth into an implanted material involves highly complex intrinsic cellular and extracellular cascades.14 Among the multitude of intricate physicochemical factors, porosity, pore architecture, pore interconnectivity and surface wettability of porous titanium implants exhibit substantial effects on bone ingrowth within implants. On the other hand, porous structure is conflicting in nature as higher porosity leads to greater bone ingrowth but eventually lowers the mechanical strength of the materials.15 Thus, an optimum balance between mechanical properties and microstructure should be achieved by modulating porosity along with desired pore size for better performance of the implants within the body. Design of implants should be in accordance with the anatomical and physicomechanical properties of human bone in order to minimize implant loosening



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 35

associated with stress shielding. Cortical bone is highly dense with apparent density of 1.99 g/cm3 (wet) and porosity in the range of 5–10%.16 Longitudinally cortical bone exhibits elastic modulus and compressive strengths in the range of 7–20 GPa (typically 17–20 GPa) and 100–250 MPa (typically 180–210 MPa), respectively, while transversely the values are found in the range of 6–13 GPa and 106–133 MPa, respectively. On the other hand, apparent density and porosity of cancellous bone typically vary in the range of 0.05–1.0 g/cm3 and 75– 90%, respectively, with a typical diameter of interconnected bone trabeculae is about 50–300 µm.17-18 Cancellous bone exhibits elastic modulus and compressive strength values ranging from 1.5 to 11.2 GPa (typically 0.76 to 4 GPa) and 11 to 24 MPa (typically 2 to 5 MPa), respectively.19 Osseointegration capacity of implants is usually governed by osteoconductive nature of the graft/implant material, which further depends upon the extent of porosity, pore size range and distribution in the implant. From literature it is known that scaffold porosity above 50%, particularly in the range of 60–70%, mechanically resembles human trabecular bone and 50– 500 µm pore size is ideal for osteoblast proliferation and differentiation.15, 20 Furthermore, a large number of studies concluded different values of optimal pore size for in vitro osteogenesis and bone ingrowth depending upon the working range of pore size. For example, in 25–500 µm pore size range, the rate of osteoblast proliferation and differentiation was substantial for 25 µm and 200 µm as compared to other pore sizes in this range.21 Similarly, optimal pore size was found as 325 µm in ranges of 85–325 µm ranges of 75–900 µm

23

, and 600 µm in ranges of 300–1000 µm

22

, 400 µm in

24

. Therefore, it is evident

from the above observations that optimum pore size for higher osteoblast activity is determined by a specific range rather than a single value. Additionally, pore interconnectivity supports neovascularization for sustainable bone development, facilitates higher volume of tissue-materials interaction at the interface and thus offers gradual load transfer along bone-implant interface. Scaffolds with > 300 µm pore size enhances vascularization, < 150 µm facilitates cell spanning across the pores and > 200 µm promotes occupancy of the cells inside the pores.15,

24, 25

Therefore, all observations

emphasizes on the necessity of appropriate pore size distribution. Regenerex™, a porous titanium alloy construct manufactured and marketed by Zimmer-Biomet, has thirty five years of clinical experience and is found to exhibit vascularized osteogenesis and rapid biological fixation with bone as early as two weeks in canine model.26 This material possess relatively lower modulus, 67% average porosity and 100–600 µm range of pore size with an average of 4 ACS Paragon Plus Environment

Page 5 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


300 µm and is structurally similar to bone. Our recent studies

27

on extrusion printed porous

Ti6Al4V having 500 ± 50 µm average size of the pores and ~58% total porosity exhibited extensive cellular coverage on its surface, mesenchymal stem cells (MSCs) differentiation towards bone lineage and enhanced osseointegration. Pore size distribution pattern of native cancellous bone is heterogeneous ranging from 50 µm to 300 µm. Besides biological tissues, random disordered pattern is also preferred at the cellular level as well. In this context, Dalby et al.

28

found better expression of osteogenic

markers by MSCs on random topographic features as compared to highly organized features. Therefore, porous titanium structure with pore size distribution ranging from 50- to 300 µm and 75–90% porosity is desirable in mimicking cancellous bone structure. Long term clinical data associated with Zimmer-Biomet porous titanium products for orthopedic application also confirms the suitability of pore size distribution over a specific range rather than precisely controlled pore size for improved interfacial bonding.26 Advanced techniques like 3D printing, laser based melting or sintering allow fabrication of complex geometries as well as functionally graded porous materials with precise control on pore architecture. 29 These processes utilize direct manufacturing of final objects where pores are mostly defined by strut geometries and their hierarchical organization. Usually the strut dimensions are constant for a specific design throughout the pore architecture. Minimum possible strut dimensions are limited to the laser source and instrument specification. However, strut dimensions could be varied at different regions of a specific design utilizing advanced CAD-CAM technique which eventually contributes to the manufacturing cost. Arabnejad et al.

30

reported tailorable microstructure with high pore interconnections and

mechanical properties of titanium based femoral stem through selective laser melting. They constrained the minimum strut thickness of 200 microns throughout the implant for ensuring manufacturability. In view of above discussion, development of a simple fabrication process of porous metallic structures with tissue specific microstructure including porosity, pore size, strut dimensions, eventually leading to variable mechanical properties, would be a preferable choice. In parallel to this, characterization of three dimensional porous materials is necessary for studying the role of pore architecture on mechanical properties along with simultaneous quantification of in vivo osteogenesis and bone ingrowth. Since conventional modalities such as quantitative histology can provide only two-dimensional information from a limited region. There are also



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 35

challenges to prepare thin histological sections from metallic structures impregnated with biological tissues. In this context, non-destructive testing with micro-CT (micro-computed tomography) is an effective and important emerging tool to study the nature of bone-material interaction and measure quantitative bone ingrowth three-dimensionally. In the present work, coagulant assisted foaming process 31, 32 was utilized to develop Ti6Al4V foam with interconnected pores and a range of pore size distribution. Following this, the effects of three different extents of foam porosity and pore size distribution on mechanical strength, wettability, protein adsorption, cell proliferation and osteogenic differentiation of MSCs through semi-quantitative PCR studies have been evaluated. Further, in vivo, critical defect healing and osseo-incorporation in rabbit model were assessed by histological staining as well as quantitative micro-CT. 2. Materials & Methods 2.1 Fabrication Porous samples of Ti6Al4V were fabricated via powder metallurgy following a novel metal foaming process developed in our previous studies. 31, 32 Briefly, Ti6Al4V powders (15–45 µm, Goodfellow, UK) were homogeneously dispersed in protein foam, which was prepared by homogenizing freshly extracted egg white in presence of 10 wt% citric acid. To tailor porosity and range of pore size distribution, metal powders were slowly dispersed into the protein foam at a different weight/volume ratio (11.0, 12.5 and 14.0 g/ml). For comparison studies, nonporous samples were also prepared without foaming by dispersing Ti6Al4V powders into egg white solution only. After casting into molds, the green samples were dried at 70 °C for 6 h under argon atmosphere followed by vacuum drying (3 h) to completely remove moisture from the samples. Finally, sintering of the samples were carried out at 1400 °C for 8 h in a tube furnace (Bysakh & Co., India) under similar controlled atmosphere. Ti6Al4V foam samples with pore size in three different ranges, as given in Table 2, and nonporous (NP) samples were taken for various studies. The samples are designated as S297, S178 and S92 based on their average pore size values. Specimens with required dimensions were cut from the sintered blocks using diamond cutter. All samples were ultrasonically cleaned sequentially with acetone, ethanol and de-ionized water for 5 min in each solvents.


Page 7 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.2. Characterization (a) Porosity and pore size distribution The sample porosity was measured following Archimedes’ principle by water displacement technique. Porosity was further measured by micro-CT (GE phoenix v|tome|x, Germany) using VGStudio MAX (Volume Graphics, Germany) software (voltage 110 kV, current 100 µA). To measure average pore size and distribution, sample microstructure was observed under scanning electron microscope (SEM; Carl Zeiss SMT AG, Germany) and images (n = 10) were analysed by ImageJ software (Rasband WS; NIH). (b) Mechanical Properties Universal testing machine (H25KS, Hounsfield, UK) was used to measure uniaxial compressive strength (sample size: 10 × 10 × 10 mm3) and 3-point bending strength (sample size: 35 × 6 × 5 mm3) of the Ti6Al4V foam at cross-head speed of 0.5 mm/min. Measurement of elastic modulus was carried out by micro-indentation technique using Micro Indentation Tester (MHT³) (Anton Paar, USA) fitted with Vicker´s diamond indenter (V-K 03) and maximum 200 mN load was applied at an indentation rate of 400 mN/min with a maximum depth of penetration 1000 µm. At least ten measurements were carried out for testing each sample. (c) Surface roughness and topography Micron-scale roughness of the individual samples was determined by optical surface profilometry using Bruker contour GT-X 3D optical microscope. Topography and nanoscale roughness on individual struts of the samples was measured by atomic force microscopy (Nanoscope V multimode 8 SPM, Bruker, USA) in intermittent contact mode fitted with a silicon nitride cantilever (spring constant 0.4 N/m, scan rate 1 Hz). Root mean square (RMS) values of surface roughness (Rq) and average roughness values (Ra) are reported. (d) Contact angle measurement The contact angle which indicates wettability of the sample surface was measured via static sessile drop technique by goniometer (Ramé-hart, USA). Water droplets from hypodermic needle were positioned onto the sample surface and image was captured after stabilization. The angle between the tangents of droplet and sample surface was measured by Screen Protractor software (Iconico Inc., USA).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 35

(e) Protein adsorption For protein adsorption study, samples (10 × 10 × 1 mm3) were kept in a 24-well plate and soaked with 300 µl of 0.1% bovine serum albumin (fraction V, Merck, Germany) solution prepared from phosphate buffer saline (PBS, pH 7.4). After incubation for 1 h and 24 h at 37 °

C, samples were subjected to PBS washing and adsorbed proteins were eluted by 300 µl of 2

% sodium dodecyl sulfate solution prepared from PBS. Bicinchoninic Acid (BCA) Kit (Sigma, USA) containing BCA reagent and 4% copper sulfate pentahydrate solutions (50:1) was used to estimate adsorbed protein concentration as per manufacturer’s instructions. The absorbance of purple-blue colored protein/Cu1+/BCA complex was measured at 562 nm using microplate absorbance reader (BIO-RAD, iMark, USA). 2.3 In vitro cell culture study 2.3.1 Isolation and culture of human amniotic MSCs (HAMSCs) HAMSCs were isolated and characterized according to the protocol followed in our previous work.

33

For this, necessary approval from Institutional Ethical Committee was obtained

before. The amniotic membrane was separated from human placenta, washed with HBSS medium (Gibco, USA) and digested with 0.05% solution of trypsin–EDTA (Gibco, USA). After 60 min incubation, the supernatant was discarded and tissues were washed with EBSS (Gibco, USA) followed by chopping into pieces. The chopped tissues were again digested with 2 mg/ml solution of collagenase Type IV (Gibco, USA) for 60 min and supernatant was collected using cell strainer. The filtrate was centrifuged at 1500 rpm for 10 min for cell pelletization, re-suspended with Dulbecco's Modified Eagle Medium (DMEM low glucose, containing 10% FBS, 100 µg/ml streptomycin, 100 units/ml penicillin) and transferred to flasks (Nunc, USA) for expansion. The cells were passaged after 70% confluency using 0.25% solution of trypsin–EDTA (Gibco, USA) and upto five passages were used for the following studies. 2.3.2 In vitro studies using HAMSCs Sample preparation Clean and dried samples (NP, S92, S178 and S297) were subjected to moist heat sterilization (120 °C for 20 min) in an autoclave. Samples were soaked in a 24 well plate under complete DMEM low glucose (Gibco, Life Technologies, NY) at 37 °C, 24 h. In each well 5 × 104 cells were seeded and medium was changed after every 72 h. 8 ACS Paragon Plus Environment

Page 9 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(a) Live/Dead Assay Assessment of cell viability on samples after seeding with HAMSCs was performed using Live/Dead assay Kit (Life Technologies, NY) according to the manufacturer’s protocol. Brieﬂy, the samples after 7 days of cell seeding were incubated with solution of 2 µM calceinacetomethoxy (AM) and 4 µM ethidium homodimer at 25 °C, 60 min. Before microscopy, samples were repeatedly washed with PBS to avoid interference from nonspecific staining. Finally, samples were observed under an inverted ﬂuorescent microscope (AxioVision, Zeiss, Germany). (b) DNA quantification Cell proliferation on porous samples was evaluated by estimating total DNA contents using DNA Quantitation Kit (DNAQF, Sigma, USA) at various time points. After 1d, 3d and 5d, cell lysis was carried out using lysis buffer (200 µL) containing Triton X-100 (0.2% v/v), Tris (10 mM, pH 7.0) and EDTA (1 mM). Ten microliter of the lysed solution was mixed with 200 µL of reagent solution which contains bisBenzimide (Hoechst 33258), a fluorophore that complexes with DNA. Total DNA contents were detected from fluorescence measured at λex/λem =350/460 nm from the calibration curve using microplate absorbance reader (BIORAD, iMark, USA). (c) Morphological Assessment Samples were fixed with 4% paraformaldehyde after 5 days of in vitro culture, permeabilized with 0.1% solution of Triton X-100 and repeatedly washed with PBS (pH 7.4) followed by rhodamine-phalloidin (Invitrogen, USA) and DAPI (Invitrogen, USA) staining as per manufacturer's protocol. Fluorescence microscopy was carried out using Axio Observer Z1 microscope (Carl Zeiss, Germany) for capturing images of the samples. For morphological assessment, similarly fixed cell-seeded samples were dehydrated with a series of isopropanol solution with ascending concentration (50–100%) and observed under SEM. (d) Osteogenic differentiation study Porous titanium samples after sterilization and 24 h of pre-soaking with complete DMEM medium were seeded with 1 × 106 cells. After 1 d, samples were supplemented with osteogenic medium consisting of complete DMEM low glucose medium along with βglycerol-phosphate (10 mM), ascorbate-2-phosphate (50 µM) and dexamethasone (0.1 µM) and medium change was performed after every 72 h. 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 35

Immunocytochemistry for expression of collagen I After 21 days of osteogenic culture, fixation of cells on sample surface was carried out with 4% paraformaldehyde and immunocytochemistry was performed for COL I expression as per the manufacturer’s instructions. Samples were permeabilized with 0.1% solution of Triton X-100, followed by soaking with 1% BSA. After PBS wash, anti-collagen I antibody (1:100; Abcam, USA) were added to the samples, followed by Alexa flour@488 goat anti-rabbit secondary antibody (1:300; Life Technologies, USA) and DAPI, subsequently. Finlly, samples were observed under fluorescence microscope. Reverse Transcriptase-PCR (RT-PCR) After 21 days cell culture under osteogenic supplementation, total RNA was extracted from the cultured porous Ti6Al4V samples (n = 5) using RNASure Mini Kit (Genetix Biotech, USA)

following

manufacturer's

protocol

and

quantified

using

NanoVue

Plus

Spectrophotometer (GE Health Care, USA). Synthesis of cDNA was carried out from isolated total RNA using cDNA synthesis kit (Thermo Scientific, USA) inside a thermal cycler (Eppendorf Mastercycler, USA). Gene specific primers (mentioned in Table 1) were used to measure expression levels of osteogenic genes, such as collagen type 1 (COL-1), osteocalcin (OCN) and osteopontin (OPN) after 21 days of osteogenic culture. PCR products were run through an EtBr-treated agarose gel (1%). Further, images were captured to visualize different bands of DNA using UV gel doc (Bio-Rad, USA) and band intensities were calculated by ImageJ software. Normalization of relative gene expressions was carried out with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Table 1: Designed primers for RT-PCR Genes

Primer Sequences Forward 5'-3'

Amplicon Reverse 5'-3'

Size (bp)

Housekeeping GAPDH CCATGGAGAAGGCTGGGG

CAAAGTTGTCATGGATGACC

195

Osteogenic

COL I

CAACCTCAAGAAGGCCCT

TTACAGGAAGCAGACAGGGC

250

OPN

CCAGAGTGCTGAAACCCA

TTAATTGACCTCAGAAGATGCACT

250

OCN

ATGAGAGCCCTCACACTCCTC GCCGTAGAAGCGCCGATAGGC

294

2.4 In vivo studies (animal trial) Necessary approvals were taken from Ethical Committee, IIT Kharagpur before conducting trials on New Zealand white rabbits. Since, nonporous metallic implants face challenges like 10 ACS Paragon Plus Environment

Page 11 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


poor interfacial bonding and loosening issues; only porous Ti6Al4V samples were selected for osseointegration and bone ingrowth studies and compared with empty defects (control). Porous Ti6Al4V samples (sample size: 4 mm × 2 mm x 6 mm) were subjected to ultrasonic cleaning for 5 min using acetone, ethanol, and de-ionized water sequentially and finally autoclaved at 120 °C for 15 min to sterilize the samples. (a) Subcutaneous implantation Sterilized Ti6Al4V foam samples (n=3) were implanted subcutaneously in rabbit and soft tissue adhesion and ingrowth were evaluated after eight weeks. For this, S178 was chosen for possession of porosity and pore size values almost average to that of the other two samples. New Zealand white rabbits (12 months, 2.5–3 kg) were acclimatized for 2 weeks in the animal care facility with adequate diet. Before surgery, they were anesthetized by ketamine hydrochloride injection. (b) In vivo osseoincorporation study For in vivo osseoincorporation study, longitudinal medial para patellar incision was made to the bilateral knees of the anesthetized rabbits (n=3), and articular surface of the femoral condyles were exposed after dislocation of patella. Critical defects (5 mm diameter) were made in the patellar groove of distal femur with a sterile stainless steel drill bit operated by electric drill. After washing the cavities with normal saline, sterilized Ti6Al4V samples were inserted into the defects. Empty defects were considered as a control. Incisions were closed in a layered fashion with 3-0 absorbable catgut suture for muscles and 4-0 nonabsorbable vicryl suture for the skin. Subcutaneous implantation was also made to observe soft tissue ingrowth. After 4 and 12 weeks of implantation, rabbits were euthanized by injecting overdose of pentobarbital solution for injection and specimens with surrounding tissues were retrieved for gross evaluation under stereo zoom microscope. The specimens were fixed in formalin for further studies. (c) Micro-CT analysis for bone ingrowth The fixed specimens were scanned in a micro-CT (GE phoenix v|tome|x, Germany) using Xray radiation (source voltage 85 kV and beam current 75µA) to obtain 3D imaging for the purpose of evaluating the quality of neo-bone formation at the defect site along with quantitative evaluation of osseoincorporation. The scanning resolution was achieved up to 25 µm for analyzing defined region of interest (ROI). Bone ingrowth and ratio of bone volume 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 35

to total volume were calculated by using VGStudio MAX (Volume Graphics, Germany) software. (d) Histological evaluation The recovered specimens were fixed with 4% paraformaldehyde, decalcified by 10% w/v solution of ethylenediamine tetraacetic acid (EDTA), dehydrated by series of ethanolic solution with ascending concentration (50–100%), xylene and finally embedded in paraffin for histological sectioning. Sections were obtained from the paraffin blocks using microtome (Leica RM2125 RTS, Germany) and staining was carried out using hematoxylin & eosin (H&E) as well as Masson trichrome (MT) to investigate bone ingrowth into the porous Ti6Al4V samples. After staining, images of histological samples were captured using Axio Observer Z1 microscope. Elemental mapping of the thick sections (without gold sputter coating) was also carried out under SEM to investigate the formation of bone apatites within titanium foam. 2.5 Statistical analysis The obtained values were reported as mean (µ) ± standard deviation (σ). Significant differences amongst different experimental as well as control groups were analysed for oneway ANOVA student's t-test using GraphPad Prism software (version 5.02). The significance level was determined as p 150 µm leads to fibrosis and necrotic tissue, between 40–150 µm forms both bone as well as fibrous tissue, while < 20 µm results in osteogenesis.

62

Implants fixation by using bone cements itself is considered a major cause of loosening creating cement disease.

63

Therefore, cementless fixation is always preferred. In this

direction, initial fixation of an implant could be achieved through press-fitting or mechanical interlock (macro-interlock) of a slightly oversized component into the bony cavity. According to Hulbert et al.

56

, samples with a porous interface provide an opportunity for biological

fixation through tissue ingrowth. Thus, long term fixation could be obtained through a combination of macro- and micro-interlock, where micro-interlock essentially refers to osseoincorporation into the porous implant without fibrotic tissue formation. This happens between 4–12 weeks of implantation and continues upto three years. Nature of adhesion with the soft tissue along with blood vessels formation gives primary indication of biocompatibility and tissue ingrowth. When implanted in rabbit femoral bone, recovery of critical size defects was quantitatively evaluated showing different extents of healing could be achieved using Ti6Al4V foam containing different porosities. Although, H&E staining assured bone ingrowth and MT staining confirmed collagen deposition, as evidences for neo-bone formation within porous implants, conventional histology involving metallic implants is highly challenging due to difficulties in sample preparation, since disruption of the newly grown tissue occurs due to abrasion with the chipped off metal particles. Moreover, histology provides only two-dimensional (2D) data from limited region of samples. In this context, micro-CT analysis is effective to evaluate qualitative bone formation through radiography and quantitative three-dimensional bone ingrowth in a non-destructive way. Extents of bone ingrowth using different porous implants were compared with empty defects treated as control, since nonporous sample does not provide space for tissue ingrowth due to absence of porosity. This study reveals that porous implants act as support for bone ingrowth and presence of higher porosity facilitates more ingrowth. Histology and micro-CT data were further 29 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 35

validated with elemental analysis of the retrieved samples after 12 weeks, which demonstrated the presence of calcium and phosphate within fragmented titanium particles. These results reveal bone apatite formation which is an evidence for osseo-incorporation into porous Ti6Al4V samples. Pore interconnectivity plays a major role for cellular infiltration, tissue ingrowth and blood vessel formation. In the present study, pore interconnectivity higher than 11% was achieved for the samples with porosity more than 75%. 5. Conclusion Mechanical strength of the scaffolds plays a critical role for orthopaedic applications. In this study, microstructure-mechanical properties relationship revealed that with the increase in porosity, mechanical strength of the samples is compromised as demonstrated with three different samples (S92, S178 and S297) with compressive strengths of 42.8±6.5, 14.7±0.9, 6.3±0.5 MPa to their corresponding porosity values of 68.3, 75.4 and 83.1%, respectively. Increase of porosity from 68.3% to 83.1% significantly reduced the modulus values of the porous samples (upto 90%) which is essential for reducing issues of implants loosening associated with stress shielding due to modulus mismatch. Introducing more porosity to the samples leads to higher amount of protein adsorption and cell proliferation. In this work, S178 is found to be superior to S297 not only in terms of mechanical strength and in vitro osteogenesis, it also exhibits comparable bone ingrowth estimated through micro-CT analysis. Therefore, it is reasonable to infer that the newly developed technique is effective for fabrication of orthopaedic implants, especially those having bulk porosity (e.g., spinal shunts) or a porous interface (e.g., hip prosthesis, acetabular cup). According to reported values 64, cancellous bone possess compressive strength of 2–70 MPa and Young’s modulus of 0.01–3 GPa. S178 samples in this study exhibits similar mechanical properties. Furthermore, the porous samples exhibit higher in vitro cell response towards osteogenesis, resulting in excellent fixation through bone ingrowth in rabbit model. Therefore, it is suggested that the porous Ti6Al4V with porosity above 70% and average pore size in the range of 150 to 200 µm are promising choices for creating interface on load bearing implants for cementless fixation. Acknowledgment This research was financially supported by the Defence Research and Development Organization (DRDO) (Grant no. DLS/81/48222/LSRB-241/BDB/2012), Ministry of Human Resource and Development (MHRD) (Grant no. IIT/SRIC/SMST/DJR/2013-14/224), 30 ACS Paragon Plus Environment

Page 31 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Government of India, BIRAC-SRISTI and Department of Biotechnology (DBT) (Grant no. BIRAC SRISTI PMU-2016/004). Authors also acknowledge Central Research Facility (CRF), IIT Kharagpur for support in materials characterization.

References 1. Geetha, M.; Singh, A.; Asokamani, R.; Gogia, A., Ti based biomaterials, the ultimate choice for orthopaedic implants–a review. Prog. Mater. Sci. 2009, 54 (3), 397-425. 2. John, A. A.; Jaganathan, S. K.; Supriyanto, E.; Manikandan, A., Surface modification of titanium and its alloys for the enhancement of osseointegration in orthopaedics. Curr. Sci. 2016, 111 (6), 1003-1015. 3. Veiga, C.; Davim, J.; Loureiro, A., Properties and applications of titanium alloys: a brief review. Rev. Adv. Mater. Sci 2012, 32 (2), 133-148. 4. Sakka, S.; Coulthard, P., Implant failure: etiology and complications. Med. Oral. Patol. Oral Cir. Bucal. 2011, 16 (1), e42-44. 5. Petersen, R. C., Titanium Implant Osseointegration Problems with Alternate Solutions Using Epoxy/Carbon-Fiber-Reinforced Composite. Metals 2014, 4 (4), 549-569. 6. Horowitz, S.; Purdon, M., Mechanisms of cellular recruitment in aseptic loosening of prosthetic joint implants. Calcif. Tissue Int. 1995, 57 (4), 301-305. 7. Sumner, D.; Turner, T.; Igloria, R.; Urban, R.; Galante, J., Functional adaptation and ingrowth of bone vary as a function of hip implant stiffness. J. Biomech. 1998, 31 (10), 909-917. 8. Ryan, G.; Pandit, A.; Apatsidis, D. P., Fabrication methods of porous metals for use in orthopaedic applications. Biomaterials 2006, 27 (13), 2651-2670. 9. Vardiman, R.; Kant, R., The improvement of fatigue life in Ti-6Al-4V by ion implantation. J. Appl. Phys. 1982, 53 (1), 690-694. 10.Schneider, E.; Kinast, C.; Eulenberger, J.; Wyder, D.; Eskilsson, G.; Perren, S. M., A comparative study of the initial stability of cementless hip prostheses. Clin. Orthop. Rel. Res. 1989, 248, 200209. 11.Kujala, S.; Ryhänen, J.; Danilov, A.; Tuukkanen, J., Effect of porosity on the osteointegration and bone ingrowth of a weight-bearing nickel–titanium bone graft substitute. Biomaterials 2003, 24 (25), 4691-4697. 12.Alvarez, K.; Nakajima, H., Metallic scaffolds for bone regeneration. Materials 2009, 2 (3), 790-832. 13.Van Bael, S.; Chai, Y. C.; Truscello, S.; Moesen, M.; Kerckhofs, G.; Van Oosterwyck, H.; Kruth, J.-P.; Schrooten, J., The effect of pore geometry on the in vitro biological behavior of human periosteum-derived cells seeded on selective laser-melted Ti6Al4V bone scaffolds. Acta Biomater. 2012, 8 (7), 2824-2834. 14.Dimitriou, R.; Jones, E.; McGonagle, D.; Giannoudis, P. V., Bone regeneration: current concepts and future directions. BMC Med. 2011, 9 (1), 66. 15.Karageorgiou, V.; Kaplan, D., Porosity of 3D biomaterial scaffolds and osteogenesis. Biomaterials 2005, 26 (27), 5474-5491. 16.Currey, J., Cortical bone. In Handbook of biomaterial properties, Springer: 1998; pp 3-14. 17.Rho, J.-Y.; Kuhn-Spearing, L.; Zioupos, P., Mechanical properties and the hierarchical structure of bone. Med. Eng. Phys. 1998, 20 (2), 92-102. 18.Keaveny, T., Cancellous bone. In Handbook of biomaterial properties, Springer: 1998; pp 15-23. 19.Veiseh, M.; Edmondson, D., Bone as an Open Cell Porous Material: ME 599K: Special Topics in Cellular Solids. 2003. 20.Otsuki, B.; Takemoto, M.; Fujibayashi, S.; Neo, M.; Kokubo, T.; Nakamura, T., Pore throat size and connectivity determine bone and tissue ingrowth into porous implants: three-dimensional micro31 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 35

CT based structural analyses of porous bioactive titanium implants. Biomaterials 2006, 27 (35), 5892-5900. 21.Stangl, R.; Rinne, B.; Kastl, S.; Hendrich, C., The influence of pore geometry in cp Ti-implants—A cell culture investigation. Eur. Cell. Mater. 2001, 2 (2), 1-9. 22.Murphy, C. M.; Haugh, M. G.; O'Brien, F. J., The effect of mean pore size on cell attachment, proliferation and migration in collagen–glycosaminoglycan scaffolds for bone tissue engineering. Biomaterials 2010, 31 (3), 461-466. 23.Li, Y.; Xiong, J.; Hodgson, P. D.; Wen, C. e., Effects of structural property and surface modification of Ti6Ta4Sn scaffolds on the response of SaOS 2 cells for bone tissue engineering. J Alloys Compd. 2010, 494 (1), 323-329. 24.Frosch, K.-H.; Barvencik, F.; Lohmann, C.; Viereck, V.; Siggelkow, H.; Breme, J.; Dresing, K.; Stürmer, K., Migration, matrix production and lamellar bone formation of human osteoblast-like cells in porous titanium implants. Cells Tissues Organs. 2002, 170 (4), 214-227. 25.de Wild, M.; Zimmermann, S.; Rüegg, J.; Schumacher, R.; Fleischmann, T.; Ghayor, C.; Weber, F. E., Influence of Microarchitecture on Osteoconduction and Mechanics of Porous Titanium Scaffolds Generated by Selective Laser Melting. 3D Print. Addit. Manuf. 2016, 3 (3), 142-151. 26.Biomet Orthopedics, Inc. 01–50-0926 P.O. Box 587 56 East Bell Drive Warsaw, Indiana 46581 Regenerex® Porous Titanium Construct - Biomet/RegenerexBrochure.pdf. 27.Srivas, P. K.; Kapat, K.; Dadhich, P.; Pal, P.; Dutta, J.; Datta, P.; Dhara, S., Osseointegration assessment of extrusion printed Ti6Al4V scaffold towards accelerated skeletal defect healing via tissue in-growth. Bioprinting 2017, 6, 8-17. 28.Dalby, M. J.; Gadegaard, N.; Tare, R.; Andar, A.; Riehle, M. O.; Herzyk, P.; Wilkinson, C. D.; Oreffo, R. O., The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder. Nat. Mater. 2007, 6 (12), 997-1003. 29.Sing, S.L.; An, J.; Yeong, W.Y.; Wiria, F.E., Laser and electron-beam powder-bed additive manufacturing of metallic implants: A review on processes, materials and designs. J. Orthop. Res. 2016, 34(3), 369-385. 30.Arabnejad, S.; Johnston, B.; Tanzer, M.; Pasini, D., Fully porous 3D printed titanium femoral stem to reduce stress-shielding following total hip arthroplasty. J. Orthop. Res. 2017, 35(8), 1774-1783. 31.Kapat, K.; Srivas, P. K.; Dhara, S., Coagulant assisted foaming–A method for cellular Ti6Al4V: Influence of microstructure on mechanical properties. Mater. Sci. Eng. A Struct. Mater. 2017, 689, 63-71. 32.Srivas, P. K.; Kapat, K.; Dhara, S., Process of Dough Forming of Polymer-Metal Blend Suitable for Shape Forming. US Patent App. 14/939,605: 2015. 33.Rameshbabu, A. P.; Ghosh, P.; Subramani, E.; Bankoti, K.; Kapat, K.; Datta, S.; Maity, P. P.; Subramanian, B.; Roy, S.; Chaudhury, K., Investigating the potential of human placenta-derived extracellular matrix sponges coupled with amniotic membrane-derived stem cells for osteochondral tissue engineering. J. Mater. Chem. B 2016, 4 (4), 613-625. 34.Zhou, C.; Lei, F.; Chodosh, J.; Paschalis, E. I., The Role of Titanium Surface Microtopography on Adhesion, Proliferation, Transformation, and Matrix Deposition of Corneal CellsEffect of Ti Surface Topography on Corneal Cells. Invest. Ophthalmol. Vis. Sci. 2016, 57 (4), 1927-1938. 35.Tsuruga, E.; Takita, H.; Itoh, H.; Wakisaka, Y.; Kuboki, Y., Pore size of porous hydroxyapatite as the cell-substratum controls BMP-induced osteogenesis. J. Biochem. 1997, 121 (2), 317-324. 36.Tsou, Y.-H.; Khoneisser, J.; Huang, P.-C.; Xu, X., Hydrogel as a bioactive material to regulate stem cell fate. Bioactive Materials 2016, 1 (1), 39-55. 37.Hahn, M. S.; Miller, J. S.; West, J. L., Three-dimensional biochemical and biomechanical patterning of hydrogels for guiding cell behavior. Advanced Materials 2006, 18 (20), 2679-2684. 38.Phadke, A.; Hwang, Y.; Kim, S. H.; Kim, S. H.; Yamaguchi, T.; Masuda, K.; Varghese, S., Effect of scaffold microarchitecture on osteogenic differentiation of human mesenchymal stem cells. Eur. Cell. Mater. 2013, 25, 114-129.


Page 33 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


39.Zhang, L.; Hanagata, N.; Maeda, M.; Minowa, T.; Ikoma, T.; Fan, H.; Zhang, X., Porous hydroxyapatite and biphasic calcium phosphate ceramics promote ectopic osteoblast differentiation from mesenchymal stem cells. Science and technology of advanced materials 2009, 10 (2), 025003. 38. 40.Arinzeh, T. L.; Tran, T.; Mcalary, J.; Daculsi, G., A comparative study of biphasic calcium phosphate ceramics for human mesenchymal stem-cell-induced bone formation. Biomaterials 2005, 26 (17), 3631-3638. 41.Meseguer-Olmo, L.; Bernabeu-Esclapez, A.; Ros-Martinez, E.; Sanchez-Salcedo, S.; Padilla, S.; Martin, A.; Vallet-Regi, M.; Clavel-Sainz, M.; Lopez-Prats, F.; Meseguer-Ortiz, C., In vitro behaviour of adult mesenchymal stem cells seeded on a bioactive glass ceramic in the SiO 2–CaO–P 2 O 5 system. Acta Biomater. 2008, 4 (4), 1104-1113. 42.Calabrese, G.; Giuffrida, R.; Fabbi, C.; Figallo, E.; Furno, D. L.; Gulino, R.; Colarossi, C.; Fullone, F.; Giuffrida, R.; Parenti, R., Collagen-hydroxyapatite scaffolds induce human adipose derived stem cells osteogenic differentiation in vitro. PLoS ONE 2016, 11 (3), e0151181. 43.Sanaei-rad, P.; Kashi, T.-s. J.; Seyedjafari, E.; Soleimani, M., Enhancement of stem cell differentiation to osteogenic lineage on hydroxyapatite-coated hybrid PLGA/gelatin nanofiber scaffolds. Biologicals 2016, 44 (6), 511-516. 44.Giovanna, C.; Giuffrida, R.; Forte, S.; Fabbi, C.; Figallo, E.; Salvatorelli, L.; Memeo, L.; Parenti, R.; Massimo, G. R. G., Human adipose-derived mesenchymal stem cells seeded into a collagenhydroxyapatite scaffold promote bone augmentation after implantation in the mouse. Sci. Rep. 2017, 7(1):7110. 45.Sollazzo, V.; Palmieri, A.; Girardi, A.; Farinella, F.; Carinci, F., Trabecular titanium induces osteoblastic bone marrow stem cells differentiation. J Biotechnol. Biomaterial. 2011, 1 (1), 1-5. 46.Blanco, J. F.; Sánchez-Guijo, F. M.; Carrancio, S.; Muntion, S.; García-Briñon, J.; del Canizo, M.-C., Titanium and tantalum as mesenchymal stem cell scaffolds for spinal fusion: an in vitro comparative study. Eur. Spine J. 2011, 20 (3), 353-360. 47.Yang, F.; Chen, C.; Zhou, Q.; Gong, Y.; Li, R.; Li, C.; Klämpfl, F.; Freund, S.; Wu, X.; Sun, Y., Laser beam melting 3D printing of Ti6Al4V based porous structured dental implants: fabrication, biocompatibility analysis and photoelastic study. Sci. Rep. 2017, 7:45360. 48.Lucaciu, O.; Soriţău, O.; Gheban, D.; Ciuca, D. R.; Virtic, O.; Vulpoi, A.; Dirzu, N.; Câmpian, R.; Băciuţ, G.; Popa, C., Dental follicle stem cells in bone regeneration on titanium implants. BMC Biotechnol. 2015, 15 (1), 114. 49.Cheng, A.; Cohen, D. J.; Boyan, B. D.; Schwartz, Z., Laser-Sintered Constructs with Bio-inspired Porosity and Surface Micro/Nano-Roughness Enhance Mesenchymal Stem Cell Differentiation and Matrix Mineralization In Vitro. Calcified Tissue Int. 2016, 99 (6), 625-637. 50.Underwood, E. E., Quantitative stereology for microstructural analysis. In Microstructural Analysis, Springer: 1973; pp 35-66. 51.Esen, Z.; Bor, Ş., Characterization of Ti–6Al–4V alloy foams synthesized by space holder technique. Mater. Sci. Eng. A 2011, 528 (7), 3200-3209. 52.Wenzel, R.N., Resistance of solid surfaces to wetting by water. Ind. Eng. Chem., 1936, 28(8), 988994. 53.Puleo, D. A.; Bizios, R., eds., Biological interactions on materials surfaces: understanding and controlling protein, cell, and tissue responses. Springer Science & Business Media: 2009. 54.Wang, K.; Zhou, C.; Hong, Y.; Zhang, X., A review of protein adsorption on bioceramics. Interface Focus 2012, 2(3), 259-277. 55.Fang, F.; Satulovsky, J.; Szleifer, I., Kinetics of protein adsorption and desorption on surfaces with grafted polymers. Biophys J. 2005, 89 (3), 1516-1533. 56.Hulbert, S.; Young, F.; Mathews, R.; Klawitter, J.; Talbert, C.; Stelling, F., Potential of ceramic materials as permanently implantable skeletal prostheses. J. Biomed. Mater. Res. 1970, 4 (3), 433-456.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 35

57.Itälä, A. I.; Ylänen, H. O.; Ekholm, C.; Karlsson, K. H.; Aro, H. T., Pore diameter of more than 100 μm is not requisite for bone ingrowth in rabbits. J Biomed. Mater. Res. 2001, 58 (6), 679-683. 58.Götz, H.; Müller, M.; Emmel, A.; Holzwarth, U.; Erben, R.; Stangl, R., Effect of surface finish on the osseointegration of laser-treated titanium alloy implants. Biomaterials 2004, 25 (18), 4057-4064. 59.Kuboki, Y.; Jin, Q.; Takita, H., Geometry of carriers controlling phenotypic expression in BMPinduced osteogenesis and chondrogenesis. J Bone Joint Surg. Am. 2001, 83 (1), S105-S115. 60.Roosa, S. M. M.; Kemppainen, J. M.; Moffitt, E. N.; Krebsbach, P. H.; Hollister, S. J., The pore size of polycaprolactone scaffolds has limited influence on bone regeneration in an in vivo model. J Biomed. Mater. Res. A 2010, 92 (1), 359-368. 61.Kumar, G.; Tison, C.K.; Chatterjee, K.; Pine, P.S.; McDaniel, J.H.; Salit, M.L.; Young, M.F.; Simon, C.G., The determination of stem cell fate by 3D scaffold structures through the control of cell shape. Biomaterials, 2011, 32(35), 9188-9196. 62.Engh, C. A.; O'connor, D.; Jasty, M.; McGovern, T. F.; Bobyn, J. D.; Harris, W. H., Quantification of implant micromotion, strain shielding, and bone resorption with porous-coated anatomic medullary locking femoral prostheses. Clin. Orthop. Relat. Res. 1992, 285, 13-29. 63.Khanuja, H. S.; Vakil, J. J.; Goddard, M. S.; Mont, M. A., Cementless femoral fixation in total hip arthroplasty. JBJS 2011, 93 (5), 500-509. 64.Goldstein, S.A., The mechanical properties of trabecular bone: dependence on anatomic location and function. J. Biomech. 1987, 20, 1055-1061.


Page 35 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphical Abstract 157x157mm (150 x 150 DPI)

ACS Paragon Plus Environment

Influence of Porosity and Pore-Size Distribution in Ti6Al4 V Foam on

Recommend Documents