Inhibition of Quorum Sensing and Virulence in Serratia marcescens by

Jan 4, 2019 - Dietary Fructooligosaccharide and Glucomannan Alter Gut Microbiota and Improve Bone Metabolism in Senescence-Accelerated Mouse...
0 downloads 0 Views 14MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 784−795

Inhibition of Quorum Sensing and Virulence in Serratia marcescens by Hordenine Jin-Wei Zhou,†,‡,§ Ling-Yu Ruan,†,§ Hong-Juan Chen,†,∥ Huai-Zhi Luo,‡,§ Huan Jiang,‡,§ Jun-Song Wang,*,§ and Ai-Qun Jia*,‡,§ ‡

J. Agric. Food Chem. 2019.67:784-795. Downloaded from pubs.acs.org by UNIV OF WINNIPEG on 01/23/19. For personal use only.

State Key Laboratory of Marine Resource Utilization in South China Sea, Key Laboratory of Tropical Biological Resources of Ministry Education, Hainan University, Haikou, Hainan 570228, People’s Republic of China § School of Environmental and Biological Engineering, Nanjing University of Science and Technology, Nanjing, Jiangsu 210094, People’s Republic of China ∥ State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing, Jiangsu 210023, People’s Republic of China S Supporting Information *

ABSTRACT: Serratia marcescens NJ01 is a pathogenic bacterium isolated from diseased tomato leaves. Here, we report on the development of a tomato−S. marcescens host−pathogen system as a model to evaluate the effects of hordenine on quorum sensing (QS)-mediated pathogenicity under native conditions. Exposure to hordenine at 25, 50, and 100 μg/mL significantly inhibited the production of acyl-homoserine lactones and the formation of biofilms. Hordenine treatment notably enhanced the susceptibility of the preformed biofilms to ciprofloxacin by reducing the production of extracellular polysaccharides, destroying the architecture of biofilms, and changing the permeability of membranes, as evidenced by the scattered appearance and dominant red fluorescence in the combination-treated biofilms. Furthermore, the addition of hordenine affected the production of virulence factors, influenced the intracellular metabolites, and downregulated the expressions of QS- and biofilm-related genes. The plant infection model indicated that hordenine could significantly attenuate the pathogenicity of S. marcescens NJ01 in tomato plants. Thus, hordenine could act as a potential pesticide or pesticide accelerant in treating crop infections. KEYWORDS: hordenine, Serratia marcescens, quorum sensing, biofilm, virulence

■

INTRODUCTION Tomato (Lycopersicon esculentum) is one of the most popular vegetables worldwide as a result of its excellent nutrients, outstanding processing quantities, and global distribution and consumption.1 In 2011, global tomato production reached ∼160 million tons.2 However, tomato yield can be severely affected by various crop pathogens, with pathogenic bacteria posing a serious threat.3 The most common bacterial diseases of tomato crops are bacterial wilt and bacterial spot, both of which are caused by Gram-negative bacteria.3 Serratia marcescens is a pathogenic bacterium that is widespread in water, vegetable plants, food products, and medical devices and, thus, causes an increasing number of crop infections and foodborne illness.4,5 Studies have indicated that S. marcescens is one of the main pathogenic bacteria causing vegetable yellow vine disease, which causes the infliction of foliar yellowing, wilting, and even vegetable decline.5 Synthetic pesticides are the most widely used method for defending against bacterial crop diseases. However, their continued application has led to adverse impacts on human and environmental health and the development of resistance in pathogenic bacteria.6 Therefore, the development of novel control measures for S. marcescens diseases without the rampant use of pesticides is an urgent need. One possible mechanism of S. marcescens to possess multidrug resistance is attributed to biofilm formation.4 Biofilms are microbial communities, in which cells are embedded in a self-generated matrix consisting of lipids, © 2019 American Chemical Society

exopolysaccharides, proteins, and nucleic acids that can block the entry of antimicrobial agents into cells.7,8 Biofilm formation by S. marcescens is reported to be closely related to quorum sensing (QS),9 which is a bacterial communication system used to increase cell density and regulate gene expression by the binding of receptors and autoinducers.4 N-Acyl-Lhomoserine lactones (AHLs) are secreted as major autoinducers in Gram-negative bacteria. Similar to other Gramnegative bacteria, S. marcescens produces C4−C8 homoserine lactones for mediating biofilm formation, motility, and extracellular product synthesis with respect to pathogenicity.10 It has been evidenced that QS-deficient S. marcescens showed reduced exoenzyme activity, prodigiosin levels, and biofilm biomass.11,12 Therefore, interfering with the QS system could be a compelling alternative for attenuating pathogenicity and protecting the host against infection by pesticide-resistant S. marcescens. In the search for QS inhibitors, dietary phytochemicals have attracted considerable interest as a result of their diverse biological functions and non-toxic nature.13 For example, 3-Omethyl ellagic acid (Figure 1) from Anethum graveolens significantly inhibited virulence production and biofilm formation in S. marcescens.13 Vanillic acid (Figure 1) in Received: Revised: Accepted: Published: 784

October 28, 2018 December 31, 2018 January 4, 2019 January 4, 2019 DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

with an inoculum of 1 × 105 colony-forming units (CFU)/mL in Müller−Hinton broth (Sangon Biotech, Shanghai, China).16 For the growth curve, overnight cultures of S. marcescens NJ01 were added to 30 mL of LB broth to achieve 0.05 at an optical density of 620 nm (OD620). The cultures were supplemented with hordenine at concentrations ranging from 25 to 100 μg/mL and then cultured for a further 24 h. Growth was determined at OD620 using a microplate reader (BioTek Elx800, Winooski, VT, U.S.A.). Analysis of AHL Production. The inhibitory efficiency of hordenine on the production of QS signal molecules was quantified by inoculating 0.1% overnight cultures of S. marcescens into LB broth.16 After incubation at 28 °C for 24 h, the cultures were centrifuged and the supernatant was extracted using the same volume of acidified ethyl acetate. The solvent was then eliminated, and residues were dissolved in methanol. The species of AHL were determined using liquid chromatography−tandem mass spectrometry (LC−MS/MS) according to the retention time of standard chemicals and their MS/MS2 spectra.7 AHL levels were normalized to the standard chemicals for relative quantification without the need of a standard curve.19 Biofilm Inhibition. Biofilms were cultivated in LB broth supplemented with or without hordenine in 24-well polystyrene plates (Costar 3524, Corning, Corning, NY, U.S.A.) using the modified method described by Sethupathy et al.14 After 24 h of static incubation, cultures and planktonic cells were removed and the sessile cells were stained with 0.05% crystal violet, of which the excess was then rinsed off using distilled water. After dissolution with 95% ethanol, the biofilm biomass was determined by reading OD570. To investigate cell viability, biofilms were washed with PBS and digested with dextranase (5 units, D8144, Sigma-Aldrich, St. Louis, MO, U.S.A.), followed by 30 s of sonication, as described previously.20 The number of viable cells in the treated biofilms was counted by plating at 28 °C for 24 h.20 Biofilm Dispersion. The biofilm dispersion assay was performed according to Ramanathan et al.,8 with minor modification. Biofilms were cultivated in LB broth in 24-well polystyrene plates at 28 °C without shaking. After 24 h of cultivation, the cultures were removed and the biofilms were rinsed with PBS and then supplemented with fresh LB broth and hordenine, ciprofloxacin (0.3 μg/mL), or their combination. After another 24 h of cultivation, the formed biofilms were washed with PBS, subsequently fixed with methanol, stained using crystal violet, solubilized with ethanol, and eventually quantified at 570 nm using a microplate reader. For cell viability, sessile cells were washed with PBS, digested with dextranase, and then sonicated for 30 s. The number of CFU/biofilm was quantified by LB agar plating. Microscopy Analysis. Biofilms of S. marcescens NJ01 were cultivated in 24-well polystyrene plates with circular glass coverslips, as mentioned above. After cultivation, coverslips were washed with PBS, fixed with 2.5% glutaraldehyde, and dehydrated with ethanol. Samples were then freeze-dried, gold-coated, and detected with scanning electron microscopy (SEM, JSM6360, JEOL, Tokyo, Japan). To determine the biomass of the S. marcescens biofilms, samples were observed using confocal laser scanning microscopy (CLSM, Zeiss LSM 700, Carl Zeiss, Jena, Germany). Biofilms that formed on the coverslips were washed with PBS and subsequently stained with acridine orange (AO) and ethidium bromide (EB) (1:1). Excess dye was removed, and the biofilms were washed using PBS. Stained biofilms were then visualized by CLSM with a 63×/1.4 numerical aperture oil objective.16 A ∼110 μm (x) × 110 μm (y) area was screened in 1 μm z intervals (z stack) via green (excitation, 488 nm; emission filter, 501−545 nm), and red (excitation, 488 nm; emission filter, 570−670 nm) channels, respectively. For each group, at least five random areas in three independent cultures were selected for image analysis. Three-dimensional reconstructions were obtained with ZEISS confocal software (ZEN 2012). The images were analyzed using PHLIP (version 0.7) and ImageJ [National Institutes of Health (NIH, Bethesda, MD, U.S.A.] software to calculate quantitative mean thickness.21

Figure 1. Chemical structures of hordenine, C4-HSL, C6-HSL, vanillic acid, and 3-O-methyl ellagic acid.

kiwifruit markedly diminished the pathogenicity of S. marcescens by regulating proteins involved in the synthesis of histidine, S-layers, fatty acid, and flagellin.14 The phenolic phytochemical hordenine (Figure 1) is abundant in sprouting barley and is known as a vasoconstrictive agent.15 Our previous study showed that hordenine possessed potent virulence suppression activity against Pseudomonas aeruginosa by downregulating the expressions of QS-related genes.16 However, how about the QS inhibitory potential of hordenine on other pathogens, especially those that cause severe losses in tomato yield? Interestingly, through extensive screening in the current study, we found that hordenine exhibited potent QS inhibitory activity against S. marcescens NJ01, a pathogenic bacterium isolated from diseased tomato leaves. Herein, for the first time, we reported on the development of the tomato−S. marcescens host−pathogen system as a model for assessing the antivirulence potential of hordenine as a pesticide or pesticide accelerant under native conditions.

■

MATERIALS AND METHODS

Isolation and Identification of the Spoilage Bacterium. Diseased tomato leaves were collected by Prof. Yongyu Li from the Experimental Farm of Fujian Agriculture and Forestry University (Fuzhou, China) in July 2018. The bacterial strain was isolated using Luria−Bertani (LB, Sangon Biotech, Shanghai, China) agar plates, as described in prior research.17 The bacterium was grown at 28 °C for 24 h, after which the colony morphology was characterized. Total DNA was extracted using a DNA extraction kit (Tiangen Biotech, Beijing, China), and the 16S rRNA sequence was amplified using primers 27F (5′-GAGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGCTACCTTGTTACGAC-3′). The 16S rRNA sequence was compared to similar sequences in GenBank using BLAST searching. Plant Inoculation. A pathogenicity assay was performed according to previous research, with slight modification.18 Overnight cultures of S. marcescens NJ01 were transferred to fresh LB broth (1:1000, v/v) and incubated at 28 °C overnight. The cultures were then added dropwise to trays of 3 week old tomato (Solanum lycopersicum) plants. The control group was treated with phosphatebuffered saline (PBS) only, without the addition of strain cultures. Pictures were taken after 96 h of infection. Growth Measurement. The S. marcescens BJ02 strain was purchased from the National Center for Medical Culture Collections (CMCC, 41002), and the S. marcescens FS14 strain (GenBank CP005927) was obtained from Prof. Weiwu Wang (Nanjing Agricultural University, Nanjing, China). The minimum inhibitory concentration (MIC) of hordenine (0.31−10 mg/mL) against S. marcescens was determined using the 2-fold serially diluted method 785

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry Table 1. PCR Primers for qRT-PCR gene

primer direction

sequence (5′ → 3′)

amplicon size (bp)

f imA

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

TTAGCCTGGAGAAATGTGAAGC GGCAGAGTAGAGCCGTTGTTAT AGCAGTTCAACACCTCCTTCAT CGGATATTTACCCGGCAGA CCTCCGCGATGTTCCGTCTTG GGTCAGGCGTTCGATGGTCTG CGGAAGTGACGCTGGAACACG TGCTGCTGTTGATGGTGTAATCGG ATGGCTTTATGGGCGTGTC TGAAGGTCAGTTCGCTCCAC TTCGTCACAAACCGCACTATT CGTCTTTCACCGCCCATT CTGCTGACCGTTGACGTGTGG CGCTGCGAAGGTCCAGTTGAC GAGAAGGTGAAGGTACTGCGTTCG TTCGGTGCTGCTGCTCTTGTTC CAACACCGAGTAAGCGAAGG ACGAAAGGAACGCCGATT

145

f imC f lhD bsmB pigA pigC sodB zwf rpsL

216 149 150 117 186 108 156 140

were added to LB broth (1:100, v/v) with DMSO or 100 μg/mL hordenine for 24 h. After incubation, cells were harvested after 10 min of centrifugation at 10 000 rpm. Cells were washed with PBS and then homogenized to extract the metabolites, as described previously.24 The dried metabolites were dissolved in D2O phosphate buffer and then transferred to NMR tubes for NMR analysis (Bruker AVANCE, 500 MHz).24 Metabolites were assigned by referring to publicly accessible metabolomics databases.24 Reactive Oxygen Species (ROS) and H2O2 Measurement. ROS were determined as described previously, with minor modification.25 In brief, bacterial strains were cultured with 6carboxy-2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA, 1 mM, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) at 28 °C for 30 min and then washed with PBS. The cells were resuspended in 1 mL of PBS, and ROS were detected at 485 nm for excitation and 525 nm for emission using a Hitachi 2700 fluorescence spectrophotometer (Hitachi, Japan). For H2O2 assessment, bacterial cultures were pelleted and resuspended with 1 mL of PBS. Intracellular H2O2 passed through the membranes and equilibrated with the buffer. Cells were then centrifugated at 6000g for 1 min. The suspension was used for H2O2 measurement using the horseradish peroxidase−scopoletin (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) method.26 Quantitative Real-Time Polymerase Chain Reaction (qRTPCR). The extraction of total RNA and synthesis of first-strand complementary DNA was performed as described previously.16 The qRT-PCR assay was carried out using the Applied Biosystems 7300 system to assess the expressions of QS- and biofilm-related genes (Table 1). The rplU gene of S. marcescens was set as the internal control.9 Pathogenicity Inhibition Assay in Tomato Plants. The S. marcescens infection assay was performed as described above. Briefly, overnight cultures of S. marcescens NJ01 were diluted 1:1000 into fresh LB broth with or without hordenine (25, 50, and 100 μg/mL) and incubated at 28 °C overnight. The same amount of DMSO and vanillic acid (100 μg/mL) served as the negative and positive controls, respectively. The treated cultures were then added dropwise to trays of 3 week old tomato plants. The normal control group was treated with PBS only, without the addition of strain cultures. Pictures and leaf area measurements were taken after 48 and 96 h of infection. The single leaf area was calculated by the multiplication of the length and width multiplied by a corrected coefficient of 0.75.27 The whole leaf area of the treated plants was calculated from all single leaf areas. Statistical Analysis. Each assay was performed in triplicate, and data were presented as means ± standard deviation (SD). Statistical significance was determined using SPSS 18.0.

Virulence Factors and Competitive Binding Assay. Overnight S. marcescens cultures were added to LB broth (1:100, v/v) supplemented with hordenine at increasing concentrations (25−100 μg/mL). Dimethyl sulfoxide (DMSO) and QS inhibitor vanillic acid (100 μg/mL) served as the negative and positive controls, respectively.14 After 24 h of cultivation at 28 °C, 75 μL of the supernatant was mixed with 125 μL of buffered azocasein. The mixtures were cultivated at 37 °C for 15 min, followed by the addition of 600 μL of 10% trichloroacetic acid. Protease activity was determined at 440 nm using a microplate reader after terminating the reaction with 1 M NaOH.9 Lipolytic activity was assessed using p-nitrophenyl palmitate (pNPP) as described previously.22 Briefly, 100 μL of culture supernatant was added to 900 μL of buffered substrate containing 0.3% (w/v) pNPP in isopropanol and 0.2% (w/v) sodium deoxycholate and 0.1% (w/v) gummi arabicum in 50 mM Na2PO4 buffer. After 1 h of incubation, 1 mL of 1 M Na2CO3 was supplemented, followed by 5 min of centrifugation at 12 000 rpm. Lipolytic activity was determined at OD410. For prodigiosin, 1 mL of culture was centrifuged for 10 min. Cells were harvested and supplemented with 1 mL of acidified ethanol (4%, 1 M HCl). The pigments were determined at 534 nm using a microplate reader.13 For the hemolysin assay, the supernatant was mixed with a sheep’s blood suspension (1:9, v/v) followed by 1 h of incubation at 37 °C. After 10 min of centrifugation at 3000 rpm, the supernatant was quantified at OD530.9 Extracellular polysaccharides (EPS) were quantified using the carbohydrate estimation method.23 Biofilms attached to the coverslips were washed with PBS and then added to 500 μL of 0.9% NaCl and 5% phenol and 2.5 mL of 0.2% hydrazine sulfate. After 1 h of incubation in the dark, EPS were quantified at OD490. For swarming motility, 1 μL of bacterial culture was inoculated in the swarming medium containing 1% peptone, 0.5% NaCl, 0.5% glucose, and 0.5% agar. The plates were cultivated at 28 °C for 24 h, and the swarming migration zones were determined.22 For the competitive binding assay, overnight cultures of S. marcescens were 0.1% inoculated into LB broth supplemented with 100 μg/mL hordenine, 5 μM C4-HSL, 5 μM C6-HSL, 100 μg/mL hordenine and 5 μM C4-HSL, and 100 μg/mL hordenine and 5 μM C6-HSL, separately. DMSO served as the negative control. After 24 h of cultivation at 28 °C, the competitive binding effect of hordenine with the receptors was evaluated by measuring prodigiosin levels, as described above. 1 H Nuclear Magnetic Resonance (NMR)-Based Analysis of Intracellular Metabolites. Overnight, S. marcescens NJ01 cultures 786

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 2. Isolation and identification of S. marcescens NJ01 and effects of hordenine on its growth. (A) Isolation and characterization of S. marcescens NJ01 and its in vivo infection assay in tomato leaves: (a) bacteria isolated from diseased tomato leaves, (b) purified strain of S. marcescens NJ01, (c) application of Gram’s stain in identifying S. marcescens NJ01, (d) inoculation of tomato leaves with PBS without strain, and (e) inoculation of tomato leaves with S. marcescens NJ01. (B) Evolutionary relationships between S. marcescens NJ01 and other related strains. (C) Growth profile of S. marcescens NJ01 following exposure to 25, 50, and 100 μg/mL hordenine for 24 h in LB broth. DMSO served as the negative control. Error bars represent standard deviations of three measurements.

Figure 3. HPLC chromatograms of C4-HSL and C6-HSL secreted by S. marcescens treated with (C) DMSO, (D) 25 μg/mL hordenine, (E) 50 μg/ mL hordenine, and (F) 100 μg/mL hordenine. (A) Standard chemical of C4-HSL (4 μM). (B) Standard chemical of C6-HSL (15 μM). C4-HSL and C6-HSL were identified according to the retention time of standard chemicals.

787

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 4. Identification and quantification of C4-HSL and C6-HSL by LC−MS/MS chromatograms. C4-HSL and C6-HSL were identified according to MS/MS2 spectra. (A) MS spectra of C4-HSL and C6-HSL: (a) full MS spectra of C4-HSL, (b) MS2 spectra of C4-HSL, (c) full MS spectra of C6-HSL, and (d) MS2 spectra of C6-HSL. (B) Quantitative analysis of C4-HSL treated with 25, 50, and 100 μg/mL hordenine, separately, based on the area calculation relative to the standard chemical of C4-HSL (4 μM). (C) Quantitative analysis of C6-HSL treated with 25, 50, and 100 μg/mL hordenine, separately, based on the area calculation relative to the standard chemical of C6-HSL (15 μM). Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗∗∗) p < 0.001 versus the DMSO control.

■

H]+ ions at 172.10 and 200.13 corresponding to C4-HSL and C6-HSL, respectively (spectra a and c of Figure 4A). In addition, the presence of C4-HSL and C6-HSL was confirmed by their MS2 spectra (spectra b and d of Figure 4A).28 After 24 h of treatment with hordenine, peaks and areas of C4-HSL and C6-HSL were notably decreased (chromatograms D−F of Figure 3). The levels of C4-HSL and C6-HSL were quantified on the basis of the area calculation relative to their standard chemicals (panels B and C of Figure 4). Exposure to hordenine at 25, 50, and 100 μg/mL resulted in more than 40, 60, and 80% reduction in C4-HSL, respectively (Figure 4B). A similar inhibitory effect was also observed in C6-HSL (Figure 4C). Thus, these results indicate that hordenine may act as a potent QS inhibitor against S. marcescens NJ01. Inhibitory Effect on Biofilm Formation. The biofilm inhibitory impact of hordenine was investigated by crystal violet assay. Exposure to hordenine at concentrations of 25, 50, and 100 μg/mL markedly reduced biofilms by 45, 58, and 66%, respectively (panel a of Figure 5A). We also detected viable cells in the treated biofilms. Hordenine treatment led to a notable reduction in viable cells relative to the DMSO control (panel b of Figure 5A). In addition, hordenine also showed an inhibitory effect on biofilm formation and viable cells of S. marcescens BJ02 and FS14 (Figure S1 of the Supporting Information). Visual confirmation of the potential of hordenine against biofilms was obtained through SEM (Figure 5B). SEM images of the DMSO control depicted a dense and net-structured biofilm coated with EPS. After hordenine treatment, biofilms were significantly reduced. Exposure to hordenine resulted in a

RESULTS Identification of Spoilage Phytopathogen. Among several phytopathogenic bacteria isolated from diseased tomato leaves, isolate NJ01 was particularly aggressive, producing striking red guttates and showing fast growth compared to other isolates (panel a of Figure 2A). Thus, isolate NJ01 was chosen for further study. On the basis of morphological characteristics (panel b and c of Figure 2A) and 16S rDNA sequence data, NJ01 was identified as S. marcescens (Figure 2B). The sequence was deposited in GenBank under accession number MK092719. Strain NJ01 was a Gram-negative, motile, and short rod-shaped bacterium able to produce red pigments (panel b and c of Figure 2A). In vivo inoculation assays with tomato leaves showed that S. marcescens NJ01 could colonize tomato leaves, causing chlorosis and wilting characteristics of the disease (panel e of Figure 2A). MIC and Growth Profile. On the basis of the doubling dilution assay, the MIC of hordenine for all S. marcescens strains was determined to be 2.5 mg/mL. The growth profile of S. marcescens NJ01 indicated that, at sub-MIC ranging from 25 to 100 μg/mL, hordenine exhibited no significant inhibition on bacterial growth (Figure 2C). Evaluation of AHL Production. The putative anti-QS capacity of hordenine against S. marcescens NJ01 was investigated by determining the AHL levels produced by this organism. The HPLC chromatograms of the AHL standards showed retention times of 3.19 and 10.27 min corresponding to C4-HSL and C6-HSL, respectively (chromatograms A and B of Figure 3). MS study of the AHL standards showed [M + 788

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 5. Inhibitory effect of hordenine on S. marcescens NJ01 biofilm formation. (A) Quantification of biofilms using (a) crystal violet staining and (b) cell viability methods. (B) SEM images of biofilms treated with (a) DMSO, (b) 25 μg/mL hordenine, (c) 50 μg/mL hordenine, and (d) 100 μg/mL hordenine. (C) CLSM images of biofilms treated with (a) DMSO, (b) 25 μg/mL hordenine, (c) 50 μg/mL hordenine, and (d) 100 μg/mL hordenine. (a′−d′) Corresponding three-dimensional biofilm structures. Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗∗∗) p < 0.001 versus the DMSO control.

Figure 6. Effects of hordenine and ciprofloxacin against preformed S. marcescens NJ01 biofilms using (A) crystal violet staining and (B) cell viability methods. Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗∗∗) p < 0.001 versus the corresponding control.

resulted in a scattered appearance and disrupted integrity of the preformed biofilms, as observed through SEM (Figure 7A) and CLSM (Figure 7B) analyses. Treatment of the preformed biofilms with hordenine combined with ciprofloxacin resulted in a remarkable reduction in S. marcescens biofilm biomass and higher mortality of bacterial cells in the treated biofilms relative to the corresponding single-agent treatment (Figure 6). Concentration-dependent analysis showed that more than 50% of biofilm biomass and sessile cells were eradicated when exposed to hordenine (25−100 μg/mL) and 0.3 μg/mL ciprofloxacin (MIC, 0.5 μg/mL).

scattered appearance and disrupted integrity of the biofilms. To investigate the efficiency of hordenine on biofilm formation visually, biofilms were observed using CLSM. After 100 μg/mL hordenine treatment, biofilm thickness notably decreased from 12.13 ± 3.02 to 3.53 ± 1.25 μm (Figure 5C). Biofilm biomass was also significantly reduced by ∼70%, and an obvious scattered appearance was presented. Disruption of Preformed Biofilms. When used alone, hordenine and ciprofloxacin resulted in minor but nonsignificant reductions in biofilm biomass and number of sessile S. marcescens cells (Figure 6). However, hordenine treatment 789

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 7. (A) SEM and (B) CLSM images of preformed biofilms treated with (a) DMSO, (b) 0.3 μg/mL ciprofloxacin, (c) 25 μg/mL hordenine, (d) 50 μg/mL hordenine, (e) 100 μg/mL hordenine, (f) 0.3 μg/mL ciprofloxacin and 25 μg/mL hordenine, (g) 0.3 μg/mL ciprofloxacin and 50 μg/mL hordenine, and (h) 0.3 μg/mL ciprofloxacin and 100 μg/mL hordenine.

levels were evidenced under the 100 μg/mL hordenine and vanillic acid treatments, respectively (Figure 8B). Prodigiosin is a prominent red pigment produced by S. marcescens and is essential for invasion, survival, and pathogenicity.29 The synthesis of prodigiosin is under the control of QS. As presented in Figure 8C, a concentrationdependent reduction in prodigiosin was observed after treatment with hordenine. Exposure to 100 μg/mL hordenine resulted in the inhibition of ∼70% of prodigiosin production, which was more potent than that of vanillic acid (50%). Hordenine also showed an inhibitory effect on prodigiosin production of S. marcescens BJ02 and FS14 (Figure S2B of the Supporting Information). Hemolysin, another well-studied virulence factor secreted by S. marcescens, was also significantly reduced (Figure 8D). At 100 μg/mL, hordenine reduced the production of hemolysin by more than 70% compared to 40% by vanillic acid. This inhibitory effect was also observed in S. marcescens BJ02 and FS14 (Figure S2C of the Supporting Information). EPS are a vital ingredients in biofilms and play important roles in maintaining cohesion, obtaining nutrition, and blocking entry of antimicrobial agents into cells.9 Our results showed significantly reduced production of EPS with hordenine treatment (Figure 8E). At concentrations of 25, 50, and 100 μg/mL, EPS were reduced by 35, 50, and 70%, respectively. When treated with 100 μg/mL vanillic acid, a nearly 40% reduction in EPS was observed. In addition, we also assessed the effect of hordenine on swarming motility and obtained a similar inhibitory effect (panels F and G of Figure 8). The competitive binding assay showed that the exogenous addition of C4-HSL or C6-HSL significantly promoted the

Both SEM and CLSM images (panels A and B of Figure 7) also demonstrated the efficiency of hordenine and ciprofloxacin in disrupting the preformed biofilms. SEM analysis of the treated biofilms clearly revealed few and scattered remaining cells, with disintegration of the samples and notable reduction in EPS compared to the untreated control (Figure 7A). CLSM analysis also evidenced the reduced thickness and altered architecture in the hordenine- and ciprofloxacin-treated biofilms (Figure 7B). After exposure to hordenine and ciprofloxacin, the thickness of biofilms declined from 13.40 ± 3.38 to 4.07 ± 1.49 μm. The antibiotic agent ciprofloxacin penetrated the biofilms and killed the cells, as evidenced through the dominant red fluorescence (representing dead cells) in the hordenine/ciprofloxacin combination groups (panels f−h of Figure 7B). Interference of Virulence Factors. Hordenine was investigated for its QS inhibitory potential against S. marcescens virulence factors. Protease, which is a vital virulence factor controlled by QS, can affect host immune responses.14 Chemicals suppressing the secretion of protease can be employed to potentiate the innate immune response of the host. Exposure to hordenine at 100 μg/mL resulted in a 65% inhibition in protease activity compared to the untreated control (Figure 8A). This is more effective than QS inhibitor vanillic acid, whose application resulted in a 33% inhibition in protease activity.14 In addition, hordenine also showed an inhibitory effect on protease activity of S. marcescens BJ02 and FS14 (Figure S2A of the Supporting Information). Lipolytic enzymes are involved in degrading the phospholipid bilayer and mediating cell signaling pathways of the host.14 In the current study, levels of lipase were notably decreased after treatment with hordenine. Reductions of 60 and 40% in lipase 790

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 8. Inhibitory effects of hordenine on virulence factor production. (A) Protease activity. (B) Lipase activity. (C) Prodigiosin levels. (D) Hemolysin levels. (E) EPS levels. (F and G) Swarming motility. Vanillic acid (VAN) served as the positive control, and DMSO served as the negative control. Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗∗∗) p < 0.001 versus the DMSO control.

Table 2. Identified Metabolites Involved in Membrane Composition, Antioxidation, Protein Synthesis, and Energy Metabolism

a

Multiplicity: (s) singlet, (d) doublet, (t) triplet, (q) quartets, and (m) multiplets. bColor coded according to the log2(fold). Red and blue represent the increased and decreased metabolites, respectively, in the hordenine-treated group. cp values were calculated on the basis of a parametric Student’s t test or a non-parametric Mann−Whitney test and were corrected by Benjamini−Hochberg (BH) methods. The number of asterisks denoted the extent of significance: (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001.

Intracellular Metabolites. 1H NMR-based metabolic analysis was used to investigate the metabolites involved in membrane composition, antioxidation, protein synthesis, and energy metabolism (Table 2). A significant decrease in ethanolamine and glutamate and a marked increase in isoleucine, leucine, valine, succinate, and fumarate were detected in the hordenine-treated group. Details on the

production of prodigiosin (Figure S3 of the Supporting Information). This result further confirmed the presence of C4-HSL and C6-HSL in the cultures of S. marcescens NJ01. In addition, treatment with hordenine combined with C4-HSL or C6-HSL significantly reduced the inhibitory effect of hordenine on prodigiosin production. This indicated that hordenine could compete with AHL for the binding receptor. 791

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

Figure 9. Effects of hordenine on ROS production and gene expression. (A) ROS and H2O2 production. (B) Expressions of genes involved in QS, biofilm, and antioxidation. Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001.

Figure 10. Efficiency of hordenine on tomato plant infections after 48 and 96 h. (A) Normal group treated with PBS only. (B) Inoculation with S. marcescens treated with DMSO. (C) Inoculation with S. marcescens treated with vanillic acid (VAN). (D, E, and F) Inoculation with S. marcescens treated with 25, 50, and 100 μg/mL hordenine, respectively. Images a, b, and c indicate 0, 48, and 96 h post-inoculation, respectively. (F) Quantification of leaf areas at 0, 48, and 96 h post-inoculation. Statistical differences were determined by ANOVA followed by the Tukey−Kramer test. (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001 versus the DMSO control.

the S. marcescens NJ01 strain underwent severe oxidative damage after hordenine treatment. QS and Biofilm-Related Gene Expressions. qRT-PCR was performed to assess the effects of hordenine on the transcriptional levels of QS-mediated genes f imA, f imC, f lhD, and bmsA, which are responsible for fimbriae production,

metabolites, including assignments, chemical shifts, and fold changes, are presented in Table 2. ROS and H2O2 Measurement. The effects of hordenine on ROS and H2O2 production were shown in Figure 9A. Treatment with hordenine at 100 μg/mL significantly enhanced the levels of ROS and H2O2. This indicated that 792

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

biofilm formation. Results showed a significant inhibition in biofilm formation after hordenine treatment. This result is consistent with that of Jayathilake et al.,33 who demonstrated that inhibition of QS can affect bacteria competition and biofilm formation for mixed bacteria strains. We next determined the expressions of biofilm-related genes. The expression of bsmB was prominently suppressed, which was well-correlated with the biofilm formation assay. Hordenine treatment led to a minor but non-significant reduction in the preformed biofilms. This result was similar to our previous study, in which hordenine exerted a weak inhibitory effect on the preformed biofilms of P. aeruginosa PAO1.16 These results thus reveal a sophisticated relationship between QS and biofilms. It is worth noting that, after hordenine treatment, biofilms were scattered and flat and resembled the biofilms formed by QS-deficient mutants.34 We therefore speculated that the architecture of the preformed biofilms was destroyed. Because QS-regulated EPS are an important ingredient in biofilms and act as a barrier to the entry of antimicrobial agents into cells,33,35 we investigated the efficiency of hordenine on EPS synthesis. Our findings revealed that a 100 μg/mL dose of hordenine resulted in a nearly 70% reduction in EPS, which was much more effective than petroselinic acid in reducing EPS of S. marcescens.8 Our results are similar to those of Jayathilake et al.,33 who demonstrated by computational modeling that inhibition of QS can affect EPS production. Ethanolamine is a vital component of cellular membranes and is involved in maintaining membrane permeability.36 The decreased level of ethanolamine in the present study indicated that membrane permeability was significantly affected (Table 2). Given the capacity of hordenine to destroy the architecture of biofilms by reducing EPS production, the effectiveness or susceptibility of antibiotics might be enhanced. Therefore, we examined the inhibitory effect of hordenine in combination with ciprofloxacin against the preformed biofilms of S. marcescens. Results indicated that hordenine remarkably increased the susceptibility of ciprofloxacin against S. marcescens biofilms. The changed biofilm architecture and membrane permeability facilitated the penetration of ciprofloxacin into the treated biofilms and, thus, the killing of cells, as evidenced by the dominant red fluorescence in the combination groups. The enhanced effect of hordenine and ciprofloxacin in combination is similar to that of phenol, 2,4bis(1,1-dimethylethyl), which shows significantly increased susceptibility of S. marcescens toward gentamicin.9 The combination of QS inhibitor and a conventional antibiotic is a promising approach for eradicating preformed biofilms and curbing the infection magnitude.37 Pan and co-workers suggested that the QS inhibitor BF8 reverts the antibiotic tolerance of P. aeruginosa persister cells.38 Persisters might be one of the main causes for therapeutic failure and recurrent infections. The capacity of hordenine to sensitize persisters could enhance antibiotic efficacy, reduce antibiotic dosage, and attenuate the risk of antibiotic resistance. S. marcescens produces a range of QS-mediated virulence factors, including protease, lipase, prodigiosin, hemolysis, and swarming motility for invasion and infection dissemination. Therefore, interfering with the production of virulence factors could be an efficient approach in attenuating the pathogenicity of S. marcescens.39 Protease possesses the capacity to induce inflammatory and immune responses, whereas lipase is involved in cytolytic activity.13,40 Labbate et al.32 showed

adherence, motility, and biofilm formation, respectively (Figure 9B). Results indicated that hordenine treatment resulted in a notable downregulation in the expressions of f imA (∼1.3-fold), f imC (∼0.7-fold), f lhD (∼2.3-fold), and bmsA (∼1.8-fold). Similarly, the expressions of pigA and pigB, two genes involved in the biosynthesis of prodigiosin, were also clearly reduced after exposure to hordenine. In addition, we investigated the expressions of genes involved in detoxifying enzymes. Results indicated that the expressions of sodB and zwf encoding superoxide dismutase (SOD) and NADPH-generating glucose-6-phosphate dehydrogenase (GPD), respectively were significantly inhibited (Figure 9B). Pathogenicity Inhibition Assays in Tomato. We determined the efficiency of hordenine in vivo and investigated its physiological relevance with respect to bacterial pathogenesis in vegetable plants. QS inhibitors have been shown to markedly attenuate the virulence of Pectobacterium carotovora in bean and potato rot.30 In this study, we focused on assessing the efficiency of hordenine on tomato plant infection. As presented in Figure 10, hordenine treatment at 25, 50, and 100 μg/mL did not show an increase in chlorosis, stunting, or cell death compared to the PBS control and, thus, had no inhibitory effect on plant growth. After 48 h of inoculation with the untreated S. marcescens cultures, leaves derived from tomato plants wilted and withered (image b of Figure 10B). Some leaves were chlorotic; the whole plant ultimately withered; and growth was significantly suppressed at 96 h post-infection (image c of Figure 10B). However, leaves inoculated with vanillic-acid- and hordenine-treated bacteria showed a significant reduction in virulence (panels C−F of Figure 10). Leaf area analysis indicated that hordenine treatment resulted in a marked reduction in leaf loss in comparison to the DMSO- and vanillic-acid-treated groups (Figure 10G). Therefore, these results indicate that hordenine can significantly attenuate the pathogenicity of S. marcescens in vegetable plants.

■

DISCUSSION Many plants and microorganisms produce QS inhibitors for self-protection and competition with invading organisms.14 Recently, greater attention has been paid to QS inhibitors from edible sources as a result of their non-toxic nature and multiple functions in attenuating pathogenicity.31 In this study, hordenine, a phenolic phytochemical from sprouting barley, was evaluated for its potential to inhibit QS-regulated virulence in the phytopathogen S. marcescens NJ01. Hordenine showed potent QS-inhibitory effects against S. marcescens NJ01, as evidenced through a notable decrease in AHL levels, reduction in virulence factors, inhibition of biofilms, and downregulation of QS- and biofilm-related gene expressions. Previous research has shown that S. marcescens uses AHL as QS signals to mediate the expressions of a battery of genes involved in a variety of physiological activities, including virulence production and biofilm formation.19 QS mutants of S. marcescens exhibit deficiencies in biofilm formation as well as prodigiosin and extracellular enzyme production.11,12,32 As a result of the importance of QS in pathogenicity, we first determined the effects of hordenine on AHL secretion. Our results confirmed the presence of C4-HSL and C6-HSL in S. marcescens NJ01 cultures4 and showed a significant reduction in AHL levels, thus revealing a potent inhibitory potential of hordenine against the QS system of S. marcescens. In addition, we investigated the impact of hordenine on S. marcescens NJ01 793

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry that bsmB is responsible for the production of protease and lipase. In this study, the reduced productions of protease and lipase were in accordance with the suppressed expression of bsmB. Prodigiosin and hemolysin are well-depicted virulence factors of S. marcescens and play vital roles in host invasion and pathogenicity.29 Because the biosynthesis of prodigiosin is mediated by the pig gene cluster,41 the expressions of prodigiosin-related genes were investigated. The downregulation of pig genes was well-correlated with the notable reduction of prodigiosin. Attachment is the first step of biofilm formation and is closely related to fimbriae production and swarming motility. Fimbriae is mediated by f imA and f imC and plays vital roles in surface attachment and colonization.22 In S. marcescens, the QS system is governed by swrI and swrR.32 The autoinducer C4-HSL is synthesized by SwrI and then binds to SwrR to induce the expression of a range of proteins involved in biofilm maturation and swarming motility.42 In addition, flagella-controlled swarming motility is governed by f lhD and contributes to biofilm formation by enhancing cell surface attachment.43 Here, the inhibition of swarming motility and biofilm formation were well-correlated with the significant reduction in C4-HSL and QS-related gene expressions, further revealing the reduced pathogenicity of S. marcescens. As a precursor of the major natural antioxidant glutathione, which combats oxidative injury, the marked decrease in glutamate could be attributed to the synthesis of glutathione and counteraction of the deleterious effects of oxidative stress (Table 2).44 QS was reported to enhance the expressions of SOD and NADPH-generating glucose-6-phosphate dehydrogenase to counteract ROS.45 The inhibited expressions of sodB and zwf reflected a severely impacted QS of S. marcescens after dosing with hordenine. Branched chain amino acids (BCAAs) isoleucine, leucine, and valine are essential amino acids and substrates and play crucial roles in protein synthesis. The increase in BCAAs indicated a breakdown of normal protein as a result of dysfunctional QS and enhanced oxidative damage after dosing with hordenine.24 Furthermore, the dramatic increase in succinate and fumarate suggested the disturbance of energy metabolism because they are intermediates of the tricarboxylic acid (TCA) cycle. As the most vital metabolic pathway providing energy for organisms, disruption of the TCA cycle can result in energy metabolism disorder, leading to bacterial pathogenicity dysfunction.24 We also investigated host−pathogen relationships between vegetable plants and pathogenic bacterium S. marcescens as a pattern for assessing the capacity of hordenine to affect QSmediated pathogenicity. Results indicated that hordenine was an effective QS inhibitor for attenuating the infection and pathogenicity of S. marcescens on tomato plants. Similar results have been reported by Mandabi et al., who demonstrated that karrikin treatment significantly reduces leaf loss in Arabidopsis thaliana and attenuates soft rot symptoms in lettuce midriffs upon infection with P. aeruginosa.46 The present study indicated that hordenine could act as a potential antivirulence agent in crop disease control.

■

■

hordenine on S. marcescens BJ02 and FS14 virulence factors (Figure S2), and competitive binding assay of hordenine and AHL on prodigiosin production (Figure S3) (PDF)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *Telephone/Fax: +86 25 84303216. E-mail: aiqunj302@njust. edu.cn. ORCID

Jun-Song Wang: 0000-0002-8935-4969 Ai-Qun Jia: 0000-0002-8089-6200 Author Contributions †

Jin-Wei Zhou, Ling-Yu Ruan, and Hong-Juan Chen contributed equally to this work. Funding

This work was supported by grants from the National Key Research and Development Program of China (2017YFD0201401), the National Natural Science Foundation of China (41766606), the Six Talent Peaks Project in Jiangsu Province, and the Fundamental Research Funds for the Central Universities (30916011307). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Prasanna, R.; Chaudhary, V.; Gupta, V.; Babu, S.; Kumar, A.; Singh, R.; Shivay, Y. S.; Nain, L. Cyanobacteria mediated plant growth promotion and bioprotection against Fusarium wilt in tomato. Eur. J. Plant Pathol. 2013, 136, 337−353. (2) Vos, C. M.; Yang, Y.; De Coninck, B.; Cammue, B. P. A. Fungal (-like) biocontrol organisms in tomato disease control. Biol. Control 2014, 74, 65−81. (3) Jan, P. S.; Huang, H. Y.; Chen, H. M. Expression of a synthesized gene encoding cationic peptide cecropin B in transgenic tomato plants protects against bacterial diseases. Appl. Environ. Microbiol. 2010, 76, 769−775. (4) Morohoshi, T.; Shiono, T.; Takidouchi, K.; Kato, M.; Kato, N.; Kato, J.; Ikeda, T. Inhibition of quorum sensing in Serratia marcescens AS-1 by synthetic analogs of N-acylhomoserine lactone. Appl. Environ. Microbiol. 2007, 73, 6339−6344. (5) Bruton, B. D.; Mitchell, F.; Fletcher, J.; Pair, S. D.; Wayadande, A.; Melcher, U.; Brady, J.; Bextine, B.; Popham, T. W. Serratia marcescens, a phloem-colonizing, squash bug-transmitted bacterium: Causal agent of cucurbit yellow vine disease. Plant Dis. 2003, 87, 937−944. (6) Soylu, E. M.; Kurt, S.; Soylu, S. In vitro and in vivo antifungal activities of the essential oils of various plants against tomato grey mould disease agent Botrytis cinerea. Int. J. Food Microbiol. 2010, 143, 183−189. (7) Zhou, J.; Bi, S.; Chen, H.; Chen, T.; Yang, R.; Li, M.; Fu, Y.; Jia, A. Q. Anti-biofilm and antivirulence activities of metabolites from Plectosphaerella cucumerina against Pseudomonas aeruginosa. Front. Microbiol. 2017, 8, 769. (8) Ramanathan, S.; Ravindran, D.; Arunachalam, K.; Arumugam, V. R. Inhibition of quorum sensing-dependent biofilm and virulence genes expression in environmental pathogen Serratia marcescens by petroselinic acid. Antonie van Leeuwenhoek 2018, 111, 501−515. (9) Padmavathi, A. R.; Abinaya, B.; Pandian, S. K. Phenol, 2,4bis(1,1-dimethylethyl) of marine bacterial origin inhibits quorum sensing mediated biofilm formation in the uropathogen Serratia marcescens. Biofouling 2014, 30, 1111−1122. (10) Bakkiyaraj, D.; Sivasankar, C.; Pandian, S. K. Inhibition of quorum sensing regulated biofilm formation in Serratia marcescens

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.8b05922. Inhibitory effects of hordenine on S. marcescens BJ02 and FS14 biofilm formation (Figure S1), inhibitory effects of 794

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795

Article

Journal of Agricultural and Food Chemistry

biofilm formation in Erwinia carotovora, Yersinia enterocolitica, and Aeromonas hydrophila. J. Agric. Food Chem. 2009, 57, 11186−11193. (29) Liu, G. Y.; Nizet, V. Color me bad: Microbial pigments as virulence factors. Trends Microbiol. 2009, 17, 406−413. (30) Palmer, A. G.; Streng, E.; Blackwell, H. E. Attenuation of virulence in pathogenic bacteria using synthetic quorum-sensing modulators under native conditions on plant hosts. ACS Chem. Biol. 2011, 6, 1348−1356. (31) Givskov, M. Beyond nutrition: Health-promoting foods by quorum-sensing inhibition. Future Microbiol. 2012, 7, 1025−1028. (32) Labbate, M.; Zhu, H.; Thung, L.; Bandara, R.; Larsen, M. R.; Willcox, M. D. P.; Givskov, M.; Rice, S. A.; Kjelleberg, S. Quorumsensing regulation of adhesion in Serratia marcescens MG1 is surface dependent. J. Bacteriol. 2007, 189, 2702−2711. (33) Jayathilake, P. G.; Jana, S.; Rushton, S.; Swailes, D.; Bridgens, B.; Curtis, T.; Chen, J. Extracellular polymeric substance production and aggregated bacteria colonization influence the competition of microbes in biofilms. Front. Microbiol. 2017, 8, 1865. (34) Hentzer, M.; Riedel, K.; Rasmussen, T. B.; Heydorn, A.; Andersen, J. B.; Parsek, M. R.; Rice, S. A.; Eberl, L.; Molin, S.; Hoiby, N.; Kjelleberg, S.; Givskov, M. Inhibition of quorum sensing in Pseudomonas aeruginosa biofilm bacteria by a halogenated furanone compound. Microbiology 2002, 148, 87−102. (35) Fux, C. A.; Costerton, J. W.; Stewart, P. S.; Stoodley, P. Survival strategies of infectious biofilms. Trends Microbiol. 2005, 13, 34−40. (36) Schmidley, J. W. Free radicals in central nervous system ischemia. Stroke 1990, 21, 1086−1090. (37) Rogers, S. A.; Huigens, R. W.; Cavanagh, J.; Melander, C. Synergistic effects between conventional antibiotics and 2-aminoimidazole-derived antibiofilm agents. Antimicrob. Agents Chemother. 2010, 54, 2112−2118. (38) Pan, J. C.; Ren, D. C. Structural effects on persister control by brominated furanones. Bioorg. Med. Chem. Lett. 2013, 23, 6559−6562. (39) Rice, S. A.; Koh, K. S.; Queck, S. Y.; Labbate, M.; Lam, K. W.; Kjelleberg, S. Biofilm formation and sloughing in Serratia marcescens are controlled by quorum sensing and nutrient cues. J. Bacteriol. 2005, 187, 3477−3485. (40) Kida, Y.; Inoue, H.; Shimizu, T.; Kuwano, K. Serratia marcescens serralysin induces inflammatory responses through protease-activated receptor 2. Infect. Immun. 2007, 75, 164−174. (41) Harris, A. K. P.; Williamson, N. R.; Slater, H.; Cox, A.; Abbasi, S.; Foulds, I.; Simonsen, H. T.; Leeper, F. J.; Salmond, G. P. C. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species-and strain-dependent genome context variation. Microbiology 2004, 150, 3547−3560. (42) Givskov, M.; Ostling, J.; Eberl, L.; Lindum, P. W.; Christensen, A. B.; Christiansen, G.; Molin, S.; Kjelleberg, S. Two separate regulatory systems participate in control of swarming motility of Serratia liquefaciens MG1. J. Bacteriol. 1998, 180, 742−745. (43) Van Houdt, R.; Givskov, M.; Michiels, C. W. Quorum sensing in Serratia. FEMS Microbiol. Rev. 2007, 31, 407−424. (44) Guo, P. P.; Wei, D. D.; Wang, J. S.; Dong, G.; Zhang, Q.; Yang, M. H.; Kong, L. Y. Chronic toxicity of crude ricinine in rats assessed by 1H NMR metabolomics analysis. RSC Adv. 2015, 5, 27018−27028. (45) Hassett, D. J.; Ma, J. F.; Elkins, J. G.; McDermott, T. R.; Ochsner, U. A.; West, S. E.; Huang, C. T.; Fredericks, J.; Burnett, S.; Stewart, P. S.; McFeters, G.; Passador, L.; Iglewski, B. H. Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediates biofilm susceptibility to hydrogen peroxide. Mol. Microbiol. 1999, 34, 1082−1093. (46) Mandabi, A.; Ganin, H.; Krief, P.; Rayo, J.; Meijler, M. M. Karrikins from plant smoke modulate bacterial quorum sensing. Chem. Commun. 2014, 50, 5322−5325.

causing nosocomial infections. Bioorg. Med. Chem. Lett. 2012, 22, 3089−3094. (11) Horng, Y. T.; Deng, S. C.; Daykin, M.; Soo, P. C.; Wei, J. R.; Luh, K. T.; Ho, S. W.; Swift, S.; Lai, H. C.; Williams, P. The LuxR family protein SpnR functions as a negative regulator of Nacylhomoserine lactone-dependent quorum sensing in Serratia marcescens. Mol. Microbiol. 2002, 45, 1655−1671. (12) Thomson, N. R.; Crow, M. A.; McGowan, S. J.; Cox, A.; Salmond, G. P. C. Biosynthesis of carbapenem antibiotic and prodigiosin pigment in Serratia is under quorum sensing control. Mol. Microbiol. 2000, 36, 539−556. (13) Salini, R.; Pandian, S. K. Interference of quorum sensing in urinary pathogen Serratia marcescens by Anethum graveolens. Pathog. Dis. 2015, 73, ftv038. (14) Sethupathy, S.; Ananthi, S.; Selvaraj, A.; Shanmuganathan, B.; Vigneshwari, L.; Balamurugan, K.; Mahalingam, S.; Pandian, S. K. Vanillic acid from Actinidia deliciosa impedes virulence in Serratia marcescens by affecting S-layer, flagellin and fatty acid biosynthesis proteins. Sci. Rep. 2017, 7, 16328. (15) Hapke, H. J.; Strathmann, W. Pharmacological effects of hordenine. Dtsch. Tierarztl Wochenschr. 1995, 102, 228−232. (16) Zhou, J. W.; Luo, H. Z.; Jiang, H.; Jian, T. K.; Chen, Z. Q.; Jia, A. Q. Hordenine: A novel quorum sensing inhibitor and antibiofilm agent against Pseudomonas aeruginosa. J. Agric. Food Chem. 2018, 66, 1620−1628. (17) Pomini, A. M.; Paccola-Meirelles, L. D.; Marsaioli, A. J. Acylhomoserine lactones produced by Pantoea sp. isolated from the ″maize white spot″ foliar disease. J. Agric. Food Chem. 2007, 55, 1200−1204. (18) Starkey, M.; Rahme, L. G. Modeling Pseudomonas aeruginosa pathogenesis in plant hosts. Nat. Protoc. 2009, 4, 117−124. (19) Truchado, P.; Gimenez-Bastida, J. A.; Larrosa, M.; CastroIbanez, I.; Espin, J. C.; Tomas-Barberan, F. A.; Garcia-Conesa, M. T.; Allende, A. Inhibition of quorum sensing (QS) in Yersinia enterocolitica by an orange extract rich in glycosylated flavanones. J. Agric. Food Chem. 2012, 60, 8885−8894. (20) Brackman, G.; Cos, P.; Maes, L.; Nelis, H. J.; Coenye, T. Quorum sensing inhibitors increase the susceptibility of bacterial biofilms to antibiotics in vitro and in vivo. Antimicrob. Agents Chemother. 2011, 55, 2655−2661. (21) Yuan, B.; Wang, X.; Tang, C.; Li, X.; Yu, G. In situ observation of the growth of biofouling layer in osmotic membrane bioreactors by multiple fluorescence labeling and confocal laser scanning microscopy. Water Res. 2015, 75, 188−200. (22) Srinivasan, R.; Devi, K. R.; Kannappan, A.; Pandian, S. K.; Ravi, A. V. Piper betle and its bioactive metabolite phytol mitigates quorum sensing mediated virulence factors and biofilm of nosocomial pathogen Serratia marcescens in vitro. J. Ethnopharmacol. 2016, 193, 592−603. (23) Kalpana, B. J.; Aarthy, S.; Pandian, S. K. Antibiofilm activity of alpha-amylase from Bacillus subtilis S8−18 against biofilm forming human bacterial pathogens. Appl. Biochem. Biotechnol. 2012, 167, 1778−1794. (24) Chen, T.; Sheng, J.; Fu, Y.; Li, M.; Wang, J.; Jia, A. Q. 1H NMR-based global metabolic studies of Pseudomonas aeruginosa upon exposure of the quorum sensing inhibitor resveratrol. J. Proteome Res. 2017, 16, 824−830. (25) Min, L.; He, S.; Chen, Q.; Peng, F.; Peng, H.; Xie, M. Comparative proteomic analysis of cellular response of human airway epithelial cells (A549) to benzo(a)pyrene. Toxicol. Mech. Methods 2011, 21, 374−382. (26) Gonzalez-Flecha, B.; Demple, B. Homeostatic regulation of intracellular hydrogen peroxide concentration in aerobically growing Escherichia coli. J. Bacteriol. 1997, 179, 382−388. (27) Wang, F. M.; Huang, J. F.; Tang, Y. L.; Wang, X. Z. New vegetation index and its application in estimating leaf area index of rice. Rice Sci. 2007, 14, 195−203. (28) Truchado, P.; Gil-Izquierdo, A.; Tomas-Barberan, F.; Allende, A. Inhibition by chestnut honey of N-Acyl-L-homoserine lactones and 795

DOI: 10.1021/acs.jafc.8b05922 J. Agric. Food Chem. 2019, 67, 784−795