Article pubs.acs.org/JAFC
Intervention of Isomaltodextrin Mitigates Intestinal Inflammation in a Dextran Sodium Sulfate-Induced Mouse Model of Colitis via Inhibition of Toll-like Receptor‑4 Kaustav Majumder,†,∥ Toshihiko Fukuda,†,#,∥ Hua Zhang,† Takeo Sakurai,§ Yoshifumi Taniguchi,§ Hikaru Watanabe,§ Hitoshi Mitsuzumi,§ Toshiro Matsui,# and Yoshinori Mine*,†,Δ †
Department of Food Science, University of Guelph, Guelph, Ontario N1G 2W1, Canada R&D Center, Hayashibara Company, Ltd., 675-1 Fujisaki, Naka-ku, Okayama 702-8006, Japan # Division of Bioresources and Bioenvironmental Sciences, Faculty of Agriculture, Graduate School, Kyushu University, Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan §
ABSTRACT: Isomaltodextrin (IMD), a highly branched α-glucan, is a type of resistant starch. Earlier studies have indicated that polysaccharides could prevent inflammation and can be effective in reducing the complications of chronic gastrointestinal diseases such as inflammatory bowel disease (IBD). Therefore, the aim of the present study was to evaluate the anti-inflammatory effect of IMD in dextran sodium sulfate (DSS)-induced colitis in a mouse model. IMD (0.5, 1.0, 2.5, and 5.0% (w/v)) was given orally for 23 days to female Balb/c mice, and then 5% DSS was administered to induce colitis (from day 15 onward to the end of the trial). IMD could not prevent DSS-induced weight loss or colon shortening. However, IMD could reduce inflammatory cytokines, TNF-α and IL-6, in the colon. Gene expression indicated the tendency of IMD to suppress pro-inflammatory cytokines IL-1β, MCP-1, and IL-17 and to increase an anti-inflammatory cytokine, IL-10. Further study revealed that the antiinflammatory action of IMD mediates through inhibition of the expression of Toll-like receptor-4. KEYWORDS: isomaltodextrin, inflammatory bowel disease, dextran sodium sulfate (DSS)-induced colitis, inflammatory cytokine, Toll-like receptor-4
■
INTRODUCTION Inflammatory bowel diseases (IBD) including Crohn’s disease (CD) and ulcerative colitis (UC) result from chronic colon inflammation.1,2 They constitute one of the problems of the modern world affecting almost 1.6 million people in the United States.3 In the onset of IBD, increased inflammatory mediators activate immune systems and subsequently continue inflammatory reactions. Chronic IBD state causes diarrhea, rectal bleeding, abdominal pain, and weight loss. It was elucidated that IBD stems from several parameters including genetic, infective, and environmental factors.4−6 However, the exact source and cause of IBD are unsolved. From the aspect of reduction of inflammatory state, antitumor necrosis factor (TNF) antibodies have been applied for the treatment of IBD.7 Moreover, current pharmacological interventions often require lifelong adherence to therapy; yet many patients still have poorly controlled disease conditions and suffer with the complications associated with these diseases. Alternatively, some bioactive food ingredients could reduce IBD symptoms though exerting their anti-inflammatory potentials.8−14 Because food ingredients have low risk of adverse side effects, the application for IBD treatments through their anti-inflammatory potentials is expected. Additionally, food-derived bioactive compounds have shown various biological activities from antiinflammation to oxygen radical scavenging, and all of those activities are beneficial for different disease conditions.15−18 All of this evidence suggests that food-derived bioactive compounds could serve as potential alternatives for the prevention and management of complex chronic diseases such as IBD.19 © XXXX American Chemical Society
Recent studies reported that treatment with prebiotics, which are defined as nondigestible compounds, could moderate colitis animal model induced by dextran sodium sulfate (DSS) or trinitrobenzenesulfonate (TNBS).20 Oligosaccharides such as inulin21 and fructooligosaccharides22 have been reported to have prebiotic potential through altering the composition of intestinal flora. Isomaltodextrin (IMD) is a highly branched αglucan.23 IMD, which is produced by bacterial strain PP710, has low digestibility24 and is classified as resistant starch. Recent study has demonstrated that IMD improved colonic hydrogen production.25 These previous studies allowed us to consider that IMD may have potential for the treatment of inflammation. However, the preventative effects of IMD in chronic colon inflammation related diseases are still unclear. Therefore, the aim of the present study was to evaluate the effect of IMD on DSS-induced colitis mice and then delineate the underlying mechanism of action.
■
MATERIALS AND METHODS
Isomaltodextrin. IMD was provided from Hayashibara Co. (Okayama, Japan). IMD dissolved in water and soluble IMD were used in this study. Animals. Induction of DSS-induced colitis was performed as described in our previous studies.13 Female Balb/c mice (6−8 weeks Received: November 2, 2016 Revised: January 8, 2017 Accepted: January 8, 2017
A
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Table 1. Sequence of Mouse Primers Used for RT-PCR Analysis gene
forward primer (5′−3′)
reverse primer (5′−3′)
β-actin IL-1β IFN-γ IL-17A IL-10 MCP-1 MUC2
GAAATCGTGCGTGACATCAAAG GGATGAGGACATGAGCACCT GCTCTTCCTCATGGCTGTTT CCAGGGAGAGCTTCATCTGT GCCTTATCGGAAATGATCCA CCCAATGAGTAGGCTGGAGA CGACACCAGGGATTTCGCTTAAT
TGTAGTTCATGGATGCCACAG AGCTCATATGGGTCCGACAG GTCACCATCCTTTTGCCAGT AGGAAGTCCTTGGCCTCAGT AGGGGAGAAATCGATGACAG TCTGGACCCATTCCTTCTTG CACTTCCACCCTCCCGGCAAAC
old; Charles River Laboratories, Montreal, QC, Canada) were randomly divided into groups (n = 8/group), housed on a 12 h light/dark cycle, and allowed to access to standard food and water ad libitum. IMD was administered for 23 days via drinking water after dissolving at concentrations of 0.5, 1.0, 2.5, and 5.0% (w/v). On the 15th day of the study, DSS (5% (w/v), MW 36−50 kDa; MP Biomedical, Solon, OH, USA) was added to drinking water to induce acute colitis and continued for the next 8 days. The negative control group received water only, and the positive control group received water with DSS for only the next 8 days. A vehicle control group received IMD (2.5% (w/v)) only, without any DSS. After the experiment, mice were euthanized via inhalation of CO2, and colons were collected, sectioned longitudinally, and flash frozen by liquid nitrogen. Frozen colon samples were stored at −80 °C until use for further experiments. All animal experiments were approved by the University of Guelph Animal Care Committee and carried out in accordance with the Canadian Council of Animal Care Guide to the Care and Use of Experimental Animals (AUP no. 1536). Cytokine ELISAs. The proteins from colon were extracted according to a previous study.13 The excised colons were homogenized with a 5 times volume of phosphate-buffered saline (PBS) containing proteinase inhibitors (1 mM phenylmethanesulfonyl fluoride (PMSF), 0.1 mM ethylenediaminetetraacetic acid (EDTA), 10 μg/mL aprotinin, 10 μg/mL leupeptin, and 10 μg/mL pepstain A; SigmaAldrich, St. Louis, MO, USA) for 3 min using a homogenizer (Polytron PT 1200, Kinematica AG, Luzern, Switzerland) on ice. The supernatants were collected following centrifugation at 12000g for 15 min at 4 °C. The protein concentration was determined by DC protein assay (Bio-Rad Laboratories, Hercules, CA, USA) and bovine serum albumin (BSA) as a standard. TNF-α and interleukin (IL)-6 concentration were measured using mouse TNF-α and an IL-6 ELISA Ready-SET-Go! kit (eBioscience, San Diego, CA, USA), according to the manufacturer’s protocol; the reaction was stopped by 1 M H2SO4, and absorbance was read at 450 nm by a plate reader (iMark model 550, Bio-Rad). RNA Isolation and Real-Time RT-PCR. Extraction of total RNA from the colon was performed according to a previous study.13 Briefly, the colon was homogenized in TRIzol (Life Technologies, Carlsbad, CA, USA), and total RNA was extracted using an Aurum Total RNA Mini Kit (Bio-Rad) according to the manufacturer’s instructions. The extracted RNA quantity was determined using a Nano Drop ND-1000 (Thermo Scientific, Waltham, MA, USA). The cDNA was synthesized using a ReverAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific), according to the manufacturer’s instructions. Real-time quantitative PCR was performed using Maxima SYBR Green qPCR Master Mix (Thermo Scientific) on a MyiQ single-color real-time PCR detection system (Bio-Rad), using the following cycling conditions: denaturation for 15 s at 95 °C, annealing for 30 s at 60 °C, and extension for 30 s at 72 °C (40 cycles). Primers used for RT-PCR analysis were synthesized by the University of Guelph Laboratory Services Molecular Biology Section (Guelph, ON, Canada) and are listed in Table 1. Histological Analysis. Histological analysis was performed as described previously.13 A section of the distal colon was fixed in buffered formalin (10% (w/v), Fisher Scientific). Paraffin-embedded sections were stained with hematoxylin and eosin (H&E) (Animal Health Laboratory, University of Guelph, Guelph, ON, Canada). The stained samples were photographed using a Leica DMR microscope
(Leica Microsystems, Wetzlar, Germany). The samples were assessed by a pathologist double-blinded to treatment for injury and inflammation using the scoring system (Table 2) used in the previous study.13
Table 2. Histopathology Grading System for Colonic Sections feature graded inflammation
grade 0 1 2 3 4
epithelium
0 1 2 3 4
description normal minimal infiltration of lamina propria, focal to multifocal mild infiltration of lamina propria, multifocal, mild gland separation moderate to mixed infiltration, multifocal with minimal edema marked mixed infiltration into submucosa and lamina propria with extensive areas of gland separation, enlarged Peyer’s patches, edema normal minimal: focal mucosal hyperplasia mild: multifocal tufting of rafts of epithelial cells with increased numbers of goblet cells moderate: multifocal to locally extensive epithelial attenuation or erosion with goblet cell hyperplasia marked: locally extensive to subtotal erosion or ulceration
glands
0 1 2 3
normal minimal: rare gland dilatation mild: multifocal gland dilatation moderate: multifocal gland dilatation with abscessation and occasional loss of glands
depth of lesion
0 1 2 3
none mucosa mucosa and submucosa transmural
extent of section affected
0 1 2 3 4
none minimal: 50%
Cell Culture and Cytokine Analysis. Human intestinal epithelial cells (HT-29 cells; ATCC, Manassas, VA, USA) were cultured with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA)/DMEM (Life Technologies) supplied with 1 mM sodium pyruvate (Life Technologies) and 50 U/mL penicillin−streptomycin (Life Technologies). HT-29 cells were maintained at 37 °C in a humidified 5% CO2 incubator, and cells at passage number 10−15 were used in this study. B
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 1. Effect of IMD on DSS-induced mice colitis symptoms. Mice were given 0.5, 1.0, 2.5, or 5.0% (w/v) IMD for 23 days. On day 15, colitis was induced with 5% DSS water. (A) Mice were weighed, and changes in body weight are shown as percent change relative to day 8. (B) After 23 days, the extracted colons were measured from the end of the cecum to the anus. Data represent the mean ± SEM of n = 8 mice/group. Unless indicated, no significant difference was observed between groups. Values without a common letter are significantly different at P < 0.05. To evaluate the anti-inflammatory effect in cultured epithelial cells, IL-8 secretion was measured. HT-29 cells were first seeded (1 × 104 cells/mL) on a 48-well plate (Corning, Corning, NY, USA). After 48 h, when the cells become ∼80% confluent, monolayer cells were washed twice with PBS. Then the cells were pretreated with IMD (0.01, 0.05, 0.1, 0.5, or 1 mg/mL, dissolved in sterile medium) for 2 h and then stimulated by TNF-α (10 ng/mL) for the next 4 h and incubated at 37 °C. After treatment, cell supernatant was collected, and an ELISA experiment was performed for measurement of IL-8 concentration. IL-8 concentration was measured using a Human IL-8 ELISA Ready-SET-Go! kit (eBioscience), according to the manufacturer’s protocol. To evaluate the role of Toll-like receptor (TLR)-4 in the HT-29 cells after the treatment of IMD at the inflammatory condition, confluent cells were pretreated for 6 h with TLR-4 inhibitor: CLI-095 (Invitrogen, San Diego, CA, USA) followed by treatment with IMD (1 mg/L) for 2h and TNF-α (10 ng/mL) for 4 h, then cell supernatant were collected to measure the IL-8 concentration. Expression of Receptor Molecule. Expression of TLR-4 in colonic tissue was measured via Western blotting. Total colonic protein extract was mixed with an equal volume of sample loading buffer (20% glycerol, 4% SDS, 3% dithiothreitol, 0.002% bromophenol blue, and 0.125 M Tris-HCl, pH 6.8) and maintained at 100 °C for 10 min before analysis. An aliquot (20 μg protein/lane) was then run in a 9% SDS-PAGE, and the protein bands of interest were detected by specific antibodies. Bands for TLR-4 (rabbit polyclonal antibody (1:500 dilution) from Santa Cruz Biotechnologies, Santa Cruz, CA, USA) were normalized to β-actin (rabbit polyclonal antibody (1:1000 dilution) from Cell Signaling, Danvers, MA, USA). Then the blots were incubated with the HRP-conjugated anti-rabbit secondary antibody (Promega, Madison, WI, USA), at a dilution of 1:10000
(v/v), for 1 h at room temperature. The membrane was then detected using ECL Western Blotting Detection Reagent. Statistical Analysis. The results were expressed as the mean ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism version 5.0 (GraphPad, San Diego, CA, USA). Statistical differences were determined by one-way or two-way analysis of variance (ANOVA), followed by Tukey’s multiple-comparison or Bonferroni’s for post hoc analysis, respectively. P < 0.05 was considered statistically significant.
■
RESULT Effect of IMD on the Development of DSS-Induced Colitis in Mice. To investigate whether IMD could show anticolitis activity, we used a mouse model of DSS-induced colitis. Treatment of DSS induces typical colitis symptoms including mucosal inflammation and ulceration, neutrophil infiltration, colon shortening, and diarrhea.26 IMD was orally administered at four different doses (0.5, 1.0, 2.5, and 5% (w/v)) via drinking water. As shown in Figure 1A, the ratio of body weight change after DSS treatment was significantly decreased after 6 days (20th day of the experiment) of DSS treatment in the positive (DSS) group, compared with the negative control (water) group. IMD treatment groups also showed decreased body weight. The IMD 1.0% group lost significant body weight compared with the DSS group at days 20 and 22. However, the IMD vehicle group did not show weight decrement. Although the water intake in all groups was not changed through the trial period, the positive DSS group developed bloody severe diarrhea after 20 days, but the IMD-DSS group showed more C
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 2. Effect of IMD on inflammatory cytokine expression in the colon of DSS-treated mice. Protein expression of TNF-α (A) and IL-6 (B) was evaluated by ELISA. Results were expressed as picograms of cytokine relative to protein concentration of the colon protein. Data represent the mean ± SEM of n = 8 mice/group. Values without a common letter are significantly different at P < 0.05.
Figure 3. Effect of IMD on inflammatory cytokine gene expression in the colon of DSS-treated mice. Relative mRNA expressions of IL-1β, IFN-γ, MCP-1, IL-17A, IL-10, and MUC2 were measured by real-time PCR. Results are expressed as relative expression to the water group. Data represent the mean ± SEM of n = 8 mice/group. Values without a common letter are significantly different at P < 0.05.
mild diarrhea incidence. The negative and IMD vehicle groups had no diarrhea symptoms (data not shown). The DSS-induced colon shortening was confirmed as an indicator of the severity of DSS-induced colitis in mice.26 The DSS group showed significant colon shortening compared with the water group (Figure 1B; water group, 6.0 ± 0.1 cm; DSS group, 3.8 ± 0.2 cm). Also, all IMD treatment groups could not prevent colon shortening (IMD 0.5% + DSS, 3.6 ± 0.2 cm; IMD 1.0% + DSS, 4.0 ± 0.4 cm; IMD 2.5% + DSS, 3.5 ± 0.1 cm; IMD 5.0% + DSS, 4.6 ± 0.2 cm), whereas the IMD vehicle group (IMD 2.5% + water, 6.7 ± 0.2 cm) did not show colon shortening.
These results indicate that IMD could not improve the clinical symptoms of colitis. Effects of IMD on the Expression of Inflammatory Cytokines in DSS-Treated Mice. TNF-α and IL-6 play important roles in the initiation and amplification of inflammatory responses that lead to intestinal injury.27 To investigate the inflammatory cytokines in the colon, TNF-α and IL-6 protein levels were measured. As shown in Figure 2, expression of TNF-α and IL-6 protein was significantly increased in the DSS group compared with the water group. IMD treatments (0.5, 2.5, and 5.0% (w/v)) significantly reduced TNF-α protein expression (water group, 13.5 ± 7.0 D
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry pg/mg protein; DSS group, 132.3 ± 58.5 pg/mg protein; IMD 0.5% + DSS, 17.6 ± 2.4 pg/mg protein; IMD 1.0% + DSS, 49.1 ± 15.5 pg/mg protein; IMD 2.5% + DSS, 29.0 ± 6.6 pg/mg protein; IMD 5.0% + DSS, 13.0 ± 2.3 pg/mg protein; IMD 2.5% + water, 11.6 ± 2.4 pg/mg protein) (Figure 2A). In addition, IMD (0.5, 1.0, and 5.0% (w/v)) significantly inhibited IL-6 protein expression (water group, 115.2 ± 18.9 pg/mg protein; DSS group, 444.7 ± 96.5 pg/mg protein; IMD 0.5% + DSS, 211.3 ± 25.8 pg/mg protein; IMD 1.0% + DSS, 226.2 ± 59.5 pg/mg protein; IMD 2.5% + DSS, 249.0 ± 23.0 pg/mg protein; IMD 5.0% + DSS, 147.4 ± 28.8 pg/mg protein; IMD 2.5% + water, 150.0 ± 20.9 pg/mg protein) (Figure 2B). These results indicated that IMD could reduce TNF-α and IL-6 expression, which are the critical biomarkers of intestinal injury. Next, the mRNA expression level of colitis-related proinflammatory mediators28,29 (IL-1β, IL-10, IFN-γ, MCP-1, and IL-17A) was evaluated. As 5% DSS treatment showed significant reduction in cytokine expression, the rest of the analyses were done with only the 5% DSS treated group and compared with the negative (water) and positive (DSS) control groups. As shown Figure 3, IMD 5% group showed a tendency to reduce gene expression compared with the DSS group. MUC2, the structural component of the colonic mucus layer, is reported as critical for IBD protection.30 A similar trend was observed in IL-1β, MCP-1, and IL17A expressions. However, unexpectedly, there are no statistically significant differences between all groups due to huge standard error. Effect of IMD on Histological and Morphological Damage in DSS-Treated Mice. Histological colon inflammation is confirmed with severe lesions in the mucosa, alteration of epithelial structure, increase in neutrophil population and lymphocyte infiltration into the mucosal and submucosal areas, and loss of crypts.31 Colon histological analysis was evaluated for the water, DSS, and IMD 5% + DSS groups. As shown in Figure 4, the DSS group clearly showed severe epithelial damage, depletion of the goblet cells, thickening of the mucosa, cellular infiltration into the submucosa and lamina propria, and destruction of the architecture compared with the water group. The IMD group could not moderate loss of epithelial cells and less depletion of
the goblet cells. This result indicates that IMD treatment could not improve histological colonic inflammation. Effect of IMD on Epithelial Cells and Expression of Toll-like Receptor in Mice Colonic Tissue. Human epithelial (HT-29) cells were used as a model system to evaluate the molecular mechanism of IMD and its antiinflammatory actions. The results showed that IMD significantly attenuates TNF-α induced IL-8 expression (Figure 5A).
Figure 5. Effect of IMD on human epithelial cells, cytokine expression. Protein expression of IL-8 (A, B) was evaluated by ELISA. Results were expressed as picograms of cytokine. (A) IL-8 expression was significantly reduced after IMD treatment in HT-29 cells. (B) Inhibition of IL-8 expression wsa enhanced in the presence of TLR4 inhibitor CLI-095 along with the IMD treatment. Data represent the mean ± SEM of n = 4. Values without a common letter are significantly different at P < 0.05.
This evidence proves that IMD has anti-inflammatory properties, and the changes in cytokine expression that have been observed in mouse colonic tissue are due to the same properties. Recent studies have shown that resistant starches can differentially stimulate the Toll-like receptors and thus attenuate the functions of pro-inflammatory cytokines.32,33 To access the involvement of TLR-4 and IMD in human epithelial cells, the confluent monolayer, was treated with TLR-4 inhibitor CLI-095 before IMD pretreatment. The results showed that the presence of TLR-4 inhibitor suppressed
Figure 4. Effect of IMD on colon histology. (A) Representative H&Estained colon sections. (B) Colon sections were scored as described under Materials and Methods. Data represent the mean ± SEM of n = 8 mice/group. Values without a common letter are significantly different at P < 0.05. E
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
intestinal inflammation.1,2 TNF-α and IL-6 are the critical cytokines, which activate macrophages, neutrophils, and T cells.27 The present study demonstrated that IMD treatment significantly reduces the expression of TNF-α and IL-6 (Figure 2). This result was consistent with the previous study that showed that administration of resistant starch inhibited TNF-α and IL-6 expression.35 IMD treatment could not ameliorate any colitis symptoms as is evident from the pathologic observations (Figures 1 and 4); however, the IMD vehicle group did not show any adverse symptoms such as weight loss or colon shortening, suggesting that the intervention of IMD itself does not deteriorate colitis or its associated conditions. Therefore, the initial results indicate that although IMD treatment does not drastically change the clinical symptoms of colitis, it does help in reducing pro-inflammatory cytokine expression and decreases inflammation in the mouse colonic tissue. This may be because 2 weeks of IMD pretreatment is not sufficient to prevent DSS-induced colonic tissue damage and a longer intervention is needed. Food-derived bioactive compounds, from peptides to resistant starch, of every component that our laboratory has studied before in the DSS-induced mouse model of colitis have shown unique molecular mechanisms of action.13,14,36−38 Peptides derived from food proteins, such as soy peptides, exerted inhibitory effects on the innate, Th1, and Th17 pro-inflammatory pathways in the colon and ileum.37 Similarly, γ-glutamylcysteine and γ-glutamylvaline peptides ameliorated the colitis condition by allosteric activation of the calcium-sensing receptor (CASR),14 but oligosaccharides such as MNB showed a different molecular mechanism through the modulation of Toll-like receptors. Some previous studies have also demonstrated the critical role of Toll-like receptors after the intervention of the various resistant starches.32,33 Therefore, to investigate further, IMD was tested on human epithelial cells (HT-29), and the results showed that IMD treatment attenuates TNF-α induced overexpression of IL-8. Analyzing all of the data obtained from the animal and cell culture study, it was apparent that IMD treatment was exhibiting antiinflammatory effects. The present study further explores the critical role of the Toll-like receptors, especially TLR-4, after the intervention of IMD in inflammatory conditions. Epithelial cells were first treated with a TLR-4 inhibitor, and then inflammation was induced using TNF-α. To our surprise, it was observed that the addition of the TLR-4 inhibitor further suppressed the pro-inflammatory action of TNF-α and reduced the expression of pro-inflammatory IL-8. These results indicate that IMD might be attenuating the TNF-α-induced inflammatory responses by inhibiting or reducing the up-regulation of TLR-4. Furthermore, this particular thought strengthened when we observed that the expression of TLR-4 has also reduced in mouse colonic tissue after IMD treatment when compared with the DSS treatment only. DSS treatment increased the expression of TLR-4 in colonic tissue, but after the treatment with IMD, TLR-4 expression reduced significantly. TLR-4 is well-known as a receptor of pro-inflammatory molecules such as lipopolysaccharides.39 Therefore, inhibition of TLR-4 could be a potential pathway to reduce inflammatory responses. Thus, this study indicates that IMD may exhibit the anti-inflammatory mechanism by reducing the expression of TLR-4. However, further studies are required to understand the other key molecules involved in the whole IMD-induced altered signaling pathway in inflammatory conditions. Additionally, the intestinal flora plays a vital role in maintaining intestinal homeostasis.40 It has been reported
further the expression of IL-8 after TNF-α stimulation (Figure 5B). After this particular observation, TLR-4 expression was quantified in mouse colonic tissue; the IMD 5% + DSS group significantly reduced the expression of the TLR-4 receptors (Figure 6) in mouse colonic tissue compared to the animals treated with DSS only. These results indicate that IMD treatment suppresses the expression of the TLR-4 receptors in mouse colon.
Figure 6. Involvement of Toll-like receptor-4 (TLR-4) after IMD intervention in mouse colonic tissue. Expression of TLR-4 downregulates significantly after IMD treatment, compared to treatment with DSS only. Data represent the mean ± SEM of n = 8 mice/group. * represents significant difference at P < 0.05.
■
DISCUSSION In the present study, we have elucidated the effect of highly branched resistant starch, IMD, in a DSS-induced mouse model of colitis. Oligosaccharides such as inulin and fructooligosaccharides are well-known for their prebiotic effects.20 Our previous in vivo and in vitro studies demonstrated that β-1,4mannobiose (MNB) possessed prebiotic effects and modulated local intestinal and systemic immune responses.34 Furthermore, in endotoxemic mice, MNB inhibited the expression of proinflammatory cytokines and reduced LPS-induced weight loss.34 In the present study, we observed that intervention of IMD could not improve typical colitis symptoms, but IMD treatment could significantly reduce the expression of proinflammatory cytokines in animal experiments as well as in in vitro cell culture experiments. These results suggest that the intervention of IMD can exhibit anti-inflammatory activity. However, the mechanism of action is still not clear, although our study reveals that IMD intervention reduces the expression of TLR-4 in mouse colon tissue. Therefore, it could be possible that the anti-inflammatory activities of IMD may act through modulation of the TLR-4 receptor. During IBD, the mucosal immune response excessively occurs, and the mucosal barrier is also destroyed, resulting in F
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
(8) Zhang, H.; Kodera, T.; Eto, Y.; Mine, Y. γ-Glutamyl valine supplementation induced mitigation of gut inflammation in a porcine model of colitis. J. Funct. Foods 2016, 24, 558−567. (9) Fukuda, T.; Majumder, K.; Zhang, H.; Turner, P. V.; Matsui, T.; Mine, Y. Adenine inhibits TNF-α signaling in intestinal epithelial cells and reduces mucosal inflammation in a dextran sodium sulfate-induced colitis mouse model. J. Agric. Food Chem. 2016, 64 (21), 4227−4234. (10) Mine, Y.; Zhang, H. Calcium-sensing receptor (CaSR)-mediated anti-inflammatory effects of L-amino acids in intestinal epithelial cells. J. Agric. Food Chem. 2015, 63 (45), 9987−9995. (11) Kobayashi, Y.; Kovacs-Nolan, J.; Matsui, T.; Mine, Y. The antiatherosclerotic dipeptide, Trp-His, reduces intestinal inflammation through the blockade of L-type Ca2+ channels. J. Agric. Food Chem. 2015, 63, 6041−6050. (12) Mine, Y.; Zhang, H. Anti-inflammatory effects of poly-L-lysine in intestinal mucosal system mediated by calcium-sensing receptor activation. J. Agric. Food Chem. 2015, 63 (48), 10437−10447. (13) Kobayashi, Y.; Rupa, P.; Kovacs-Nolan, J.; Turner, P. V.; Matsui, T.; Mine, Y. Oral administration of hen egg white ovotransferrin attenuates the development of colitis induced by dextran sodium sulfate in mice. J. Agric. Food Chem. 2015, 63 (5), 1532−1539. (14) Zhang, H.; Kovacs-Nolan, J.; Kodera, T.; Eto, Y.; Mine, Y. γGlutamyl cysteine and γ-glutamyl valine inhibit TNF-α signaling in intestinal epithelial cells and reduce inflammation in a mouse model of colitis via allosteric activation of the calcium-sensing receptor. Biochim. Biophys. Acta, Mol. Basis Dis. 2015, 1852 (5), 792−804. (15) Lee, M.; Kovacs-Nolan, J.; Archbold, T.; Fan, M. Z.; Juneja, L. R.; Okubo, T.; Mine, Y. Therapeutic potential of hen egg white peptides for the treatment of intestinal inflammation. J. Funct. Foods 2009, 1 (2), 161−169. (16) Majumder, K.; Chakrabarti, S.; Morton, J. S.; Panahi, S.; Kaufman, S.; Davidge, S. T.; Wu, J. Egg-derived ACE-inhibitory peptides IQW and LKP reduce blood pressure in spontaneously hypertensive rats. J. Funct. Foods 2015, 13, 50−60. (17) Zhang, H.; Hu, C.-A. A.; Kovacs-Nolan, J.; Mine, Y. Bioactive dietary peptides and amino acids in inflammatory bowel disease. Amino Acids 2015, 47, 2127−2141. (18) Zhang, H.; Wu, M.-Y.; Guo, D.-J.; Wan, C.-W.; Lau, C.-C.; Chan, C.-O.; Mok, D. K.-W.; Chan, S.-W. Gui-Ling-Gao (turtle jelly), a traditional Chinese functional food, exerts anti-inflammatory effects by inhibiting iNOS and pro-inflammatory cytokine expressions in splenocytes isolated from BALB/c mice. J. Funct. Foods 2013, 5 (2), 625−632. (19) Zielińska, M.; Lewandowska, U.; Podsędek, A.; Cygankiewicz, A. I.; Jacenik, D.; Sałaga, M.; Kordek, R.; Krajewska, W. M.; Fichna, J. Orally available extract from Brassica oleracea var. capitata rubra attenuates experimental colitis in mouse models of inflammatory bowel diseases. J. Funct. Foods 2015, 17, 587−599. (20) Looijer-van Langen, M. A. C.; Dieleman, L. A. Prebiotics in chronic intestinal inflammation. Inflammatory Bowel Dis. 2009, 15 (3), 454−462. (21) Videla, S.; Vilaseca, J.; Antolín, M.; García-Lafuente, A.; Guarner, F.; Crespo, E.; Casalots, J.; Salas, A.; Malagelada, J. R. Dietary inulin improves distal colitis induced by dextran sodium sulfate in the rat. Am. J. Gastroenterol. 2001, 96 (5), 1486−1493. (22) Cherbut, C.; Michel, C.; Lecannu, G. The prebiotic characteristics of fructooligosaccharides are necessary for reduction of TNBSinduced colitis in rats. J. Nutr. 2003, 133 (1), 21−27. (23) Tsusaki, K.; Watanabe, H.; Nishimoto, T.; Yamamoto, T.; Kubota, M.; Chaen, H.; Fukuda, S. Structure of a novel highly branched alpha-glucan enzymatically produced from maltodextrin. Carbohydr. Res. 2009, 344 (16), 2151−2156. (24) Tsusaki, K.; Watanabe, H.; Yamamoto, T.; Nishimoto, T.; Chaen, H.; Fukuda, S. Purification and characterization of highly branched α-glucan-producing enzymes from Paenibacillus sp. PP710. Biosci., Biotechnol., Biochem. 2012, 76 (4), 721−731. (25) Nishimura, N.; Tanabe, H.; Yamamoto, T. Isomaltodextrin, a highly branched α-glucan, increases rat colonic H2 production as well
that prebiotics could assist the growth of intestinal flora, which improves the intestinal barrier function to protect against intestinal inflammation.41 It was reported that ingestion of oat β-glucan improves intestinal functions through promoting the growth of beneficial microorganisms, acidifying the intestinal tract, and decreasing harmful intestinal metabolites.42 Recent studies reported that IMD could alter the Firmicutes/ Bacteroidetes ratio in the intestine,25 which has a crucial role in the progression of obesity.43 After consideration of all of these factors, it is possible that IMD might exhibit antiinflammatory action through altering the composition of intestinal flora. In the current DSS model used in this study, mice were subjected for 7 days to drinking water supplemented with DSS, which seems to be directly toxic to colonic epithelial cells of the basal crypts. The chemically induced model of intestinal inflammation is not suitable for microbiota versus colitis study; a more long-term chronic IMD model is needed.44 Further study is required to elucidate the effect of IMD on intestinal microflora and its role in modulating intestinal inflammation with a different model.
■
AUTHOR INFORMATION
Corresponding Author
*(Y.M.) Phone: (519) 824-4120. Fax: (519) 824-6631. E-mail:
[email protected]. ORCID
Yoshinori Mine: 0000-0002-3567-5556 Present Address Δ
Department of Food Science and Technology, University of NebraskaLincoln, 263 Food Innovation Center, Lincoln, NE 68588-6205, USA. Author Contributions ∥
K.M. and T.F. made equal contributions.
Funding
This study was supported in part by the Japan Society for the Promotion of Science Research Fellowship for Young Scientists to T.F. (No. 14J03039). We also acknowledge funding support from the Advanced Foods and Materials Network (AFMNet). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Podolsky, D. K. Inflammatory bowel disease. N. Engl. J. Med. 2002, 347 (6), 417−429. (2) Lichtenstein, G. R.; Abreu, M. T.; Cohen, R.; Tremaine, W. American Gastroenterological Association Institute Technical Review on Corticosteroids, immunomodulators, and infliximab in inflammatory bowel disease. Gastroenterology 2006, 130 (3), 940−987. (3) Kaplan, G. G. The global burden of IBD: from 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12 (12), 720−727. (4) Graham, D. B.; Xavier, R. J. From genetics of inflammatory bowel disease towards mechanistic insights. Trends Immunol. 2013, 34 (8), 371−378. (5) Ng, S. C.; Bernstein, C. N.; Vatn, M. H.; Lakatos, P. L.; Loftus, E. V.; Tysk, C.; O’Morain, C.; Moum, B.; Colombel, J.-F. Geographical variability and environmental risk factors in inflammatory bowel disease. Gut 2013, 62 (4), 630−649. (6) Cader, M. Z.; Kaser, A. Recent advances in inflammatory bowel disease: mucosal immune cells in intestinal inflammation. Gut 2013, 62 (11), 1653−1664. (7) Peyrin-Biroulet, L. Anti-TNF therapy in inflammatory bowel diseases: a huge review. Minerva Gastroenterol. Dietol. 2010, 56 (2), 233−243. G
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry as indigestible dextrin. Biosci., Biotechnol., Biochem. 2016, 80 (3), 554− 563. (26) Okayasu, I.; Hatakeyama, S.; Yamada, M.; Ohkusa, T.; Inagaki, Y.; Nakaya, R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990, 98 (3), 694−702. (27) Beck, P. L.; Wallace, J. L. Cytokines in inflammatory bowel disease. Mediators Inflammation 1997, 6 (2), 95−103. (28) Rogler, G.; Andus, T. Cytokines in inflammatory bowel disease. World J. Surg. 1998, 22 (4), 382−389. (29) Banks, C.; Bateman, A.; Payne, R.; Johnson, P.; Sheron, N. Chemokine expression in IBD. Mucosal chemokine expression is unselectively increased in both ulcerative colitis and Crohn’s disease. J. Pathol. 2003, 199 (1), 28−35. (30) Van der Sluis, M.; De Koning, B. a. E.; De Bruijn, A. C. J. M.; Velcich, A.; Meijerink, J. P. P.; Van Goudoever, J. B.; Büller, H. a.; Dekker, J.; Van Seuningen, I.; Renes, I. B. Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 2006, 131 (1), 117−129. (31) Mazzucchelli, L.; Hauser, C.; Zgraggen, K.; Wagner, H.; Hess, M.; Laissue, J. A.; Mueller, C. Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological grade of active inflammation. Am. J. Pathol. 1994, 144 (5), 997−1007. (32) Haenen, D.; Souza da Silva, C.; Zhang, J.; Koopmans, S. J.; Bosch, G.; Vervoort, J.; Gerrits, W. J. J.; Kemp, B.; Smidt, H.; Muller, M. Resistant starch induces catabolic but suppresses immune and cell division pathways and changes the microbiome in the proximal colon of male pigs. J. Nutr. 2013, 143 (12), 1889−1898. (33) Bermudez-Brito, M.; Rösch, C.; Schols, H. A.; Faas, M. M.; de Vos, P. Resistant starches differentially stimulate Toll-like receptors and attenuate proinflammatory cytokines in dendritic cells by modulation of intestinal epithelial cells. Mol. Nutr. Food Res. 2015, 59 (9), 1814−1826. (34) Kovacs-Nolan, J.; Kanatani, H.; Nakamura, A.; Ibuki, M.; Mine, Y. β-1, 4-mannobiose stimulates innate immune responses and induces TLR4-dependent activation of mouse macrophages but reduces severity of inflammation during endotoxemia in mice. J. Nutr. 2013, 143 (3), 384−391. (35) Qian, Y.; Zhao, X.; Song, J.-L.; Zhu, K.; Sun, P.; Li, G.-J.; Wang, R.; Kan, J.-Q. Inhibitory effects of resistant starch (RS3) as a carrier for stachyose on dextran sulfate sodium-induced ulcerative colitis in C57BL/6 mice. Exp. Ther. Med. 2013, 6 (5), 1312−1316. (36) Kovacs-Nolan, J.; Zhang, H.; Ibuki, M.; Nakamori, T.; Yoshiura, K.; Turner, P. V.; Matsui, T.; Mine, Y. The PepT1-transportable soy tripeptide VPY reduces intestinal inflammation. Biochim. Biophys. Acta, Gen. Subj. 2012, 1820 (11), 1753−1763. (37) Young, D.; Ibuki, M.; Nakamori, T.; Fan, M.; Mine, Y. Soyderived di-and tripeptides alleviate colon and ileum inflammation in pigs with dextran sodium sulfate-induced colitis. J. Nutr. 2012, 142 (2), 363−368. (38) Lee, M.; Kovacs-Nolan, J.; Yang, C.; Archbold, T.; Fan, M. Z.; Mine, Y. Hen egg lysozyme attenuates inflammation and modulates local gene expression in a porcine model of dextran sodium sulfate (DSS)-induced colitis. J. Agric. Food Chem. 2009, 57 (6), 2233−2240. (39) Guijarro-Muñoz, I.; Compte, M.; Á lvarez-Cienfuegos, A.; Á lvarez-Vallina, L.; Sanz, L. Lipopolysaccharide activates Toll-like receptor 4 (TLR4)-mediated NF-κB signaling pathway and proinflammatory response in human pericytes. J. Biol. Chem. 2014, 289 (4), 2457−2468. (40) O’Hara, A. M.; Shanahan, F. The gut flora as a forgotten organ. EMBO Rep. 2006, 7 (7), 688−693. (41) Scaldaferri, F.; Gerardi, V.; Lopetuso, L. R.; Del Zompo, F.; Mangiola, F.; Boškoski, I.; Bruno, G.; Petito, V.; Laterza, L.; Cammarota, G.; et al. Gut microbial flora, prebiotics, and probiotics in IBD: their current usage and utility. BioMed Res. Int. 2013, 2013, 435268. (42) Shen, R.-L.; Dang, X.-Y.; Dong, J.-L.; Hu, X.-Z. Effects of oat βglucan and barley β-glucan on fecal characteristics, intestinal
microflora, and intestinal bacterial metabolites in rats. J. Agric. Food Chem. 2012, 60 (45), 11301−11308. (43) Turnbaugh, P. J.; Ley, R. E.; Mahowald, M. A.; Magrini, V.; Mardis, E. R.; Gordon, J. I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444 (7122), 1027− 1031. (44) Wirtz, S.; Neufert, C.; Weigmann, B.; Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat. Protoc. 2007, 2 (3), 541−546.
H
DOI: 10.1021/acs.jafc.6b04903 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
