Isolation of Jahanene and Jahanane, and Total Synthesis of the

Aug 13, 2018 - In addition, we achieved total syntheses of the jahanyne family and assessed their activities. The resulting growth-inhibitory activity...
0 downloads 0 Views 2MB Size
Download PDF
Article Cite This: J. Org. Chem. 2018, 83, 9592−9603

pubs.acs.org/joc

Isolation of Jahanene and Jahanane, and Total Synthesis of the Jahanyne Family Arihiro Iwasaki,† Haruka Fujimura,† Shinichiro Okamoto,† Takafumi Kudo,‡ Shizuka Hoshina,† Shimpei Sumimoto,† Toshiaki Teruya,*,‡ and Kiyotake Suenaga*,† †

J. Org. Chem. 2018.83:9592-9603. Downloaded from pubs.acs.org by UNIV OF SUNDERLAND on 09/08/18. For personal use only.

Department of Chemistry, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku, Yokohama, Kanagawa 223-8522, Japan ‡ Faculty of Education, University of the Ryukyus, 1 Senbaru, Nishihara, Okinawa 903-0213, Japan S Supporting Information *

ABSTRACT: Two new jahanyne analogues, jahanene and jahanane, highly N-methylated lipopeptides, were isolated from a marine cyanobacterium Okeania sp., and their structures were determined by NMR and MS. In addition, we achieved total syntheses of the jahanyne family and assessed their activities. The resulting growth-inhibitory activity of jahanyne was nearly one-tenth of the previously reported activity. Furthermore, we found that the degree of unsaturation at the terminus of the fatty acid moiety affected the growth-inhibitory activity against human cancer cells.

■

INTRODUCTION Jahanyne (1) is a lipopeptide that was isolated from a Lyngbya sp. marine cyanobacterium in 2015.1 Its highly N-methylated structure and biological activity have attracted the attention of not only synthetic chemists but also chemical biologists. Recently, the total synthesis of desmethyl jahanyne has been achieved by Chandrasekhar and co-workers.2 They carried out biological assessments of synthetic intermediates and elucidated that several jahanyne intermediates bound to BCL-2, an antiapoptotic protein. More recently, the first total synthesis of jahanyne (1) has been achieved by Brimble using a solid-phase synthesis strategy.3 Despite the efforts described above, the details of the biological activity of jahanyne (1) have been unclear. Against this background, we isolated two new analogues of 1, jahanene (2) and jahanane (3), from a marine cyanobacterium Okeania sp. and determined their structures. Furthermore, we achieved the total synthesis of the jahanyne family

(1−3) and clarified the structure−activity relationship regarding the terminal structure of the fatty acid chain.

■

RESULTS AND DISCUSSION The marine cyanobacterium Okeania sp. (268 g, wet weight) was collected at Bise, Okinawa Prefecture, Japan, and extracted with MeOH. The extract was filtered and concentrated, and the residue was partitioned between EtOAc and H2O. The residue obtained from the organic layer was further partitioned between 90% aqueous MeOH and n-hexane. The material obtained from the 90% aqueous MeOH portion was fractionated by octadecylsilyl (ODS) silica gel column chromatography and subjected to reversed-phase high-performance liquid chromatography (HPLC) to give jahanyne (1) (87.6 mg), jahanene (2) (46.5 mg), and jahanane (3) (11.9 mg). The molecular formula of jahanene (2) was found to be C 60 H 96 N 8 O 9 by ESIMS (m/z 1095.7230, calcd for C60H96N8O9Na 1095.7197), which was 2 mass units (H2) larger than that of jahanyne (1).1 In both normal and reversedphase chromatography, 2 was found to be less polar than 1. The 13 C NMR chemical shifts of 2 were similar to those of 1, except for the downfield shifts regarding C57 and C58 (Table 1). In addition, three vinyl proton signals were observed by 1H NMR. These results suggested that 2 should be the partially hydrogenated (at C57 and C58) derivative of 1. Received: February 2, 2018 Published: August 13, 2018

© 2018 American Chemical Society

9592

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry Table 1. 1H and 13C NMR Data for Jahanene and Jahanane (2 and 3) in CD3OD jahanane (3)g

jahanene (2) position Oep 1 2 3 4a 4b 5a 5b 6a 6b Pro-1 7 8

δC

a

26.8 208.2 66.7 28.7 25.81c 48.3

172.5 59.77d

9a 9b 10a 10b 11a 11b N-Me-Phe 12 13

29.3

14a 14b 15 16 17 18 19 20 21 N-Me-Val-1 22 23

35.1

25.77c 48.9

170.5 56.6

138.3 130.5 129.6 128.0 129.6 130.5 31.4 171.1 60.0

24 25

28.1 19.9

26

18.0

27

30.2

N-Me-Val-2 28 29

170.9 59.81d

30

28.2

δH (J in Hz) b

2.18, s 4.60, dd (8.8, 5.0) 2.27, m 1.88, m 2.06, m 1.96, m 3.84, m 3.63, m

4.72, dd (8.6, 3.8) 2.27, m 2.00, m 2.09, m 1.96, m 3.73, m 3.60, m

5.87, dd (11.5, 4.3) 3.11, m 3.04, m 7.23, m 7.30, m 7.28, m 7.30, m 7.23, m 2.96, s

5.03, d (10.7) 2.17, m 0.83, d (6.4) 0.65, d (6.8) 2.16, s

4.93, d (11.0) 2.32, m

δC

a

26.8 208.3 66.8 28.8 25.82e 48.3

172.5 59.79f 29.4 25.77e 48.9

170.6 56.7 35.2 138.3 130.4 129.6 128.0 129.6 130.4 31.5 171.2 60.1 28.1 19.9 18.1 30.3

171.0 59.83f 28.3

jahanane (3)g

jahanene (2)

δH (J in Hz) b

position

δCa

31

20.4

32

18.3

33 N-Me-Val-3 34 35

30.9

36 37

28.2 18.8

38

20.2

39 Pro-2 40 41

30.8

42a 42b 43a 43b 44a 44b N-Me-Ala 45 46

29.8

2.18, s 4.61, dd (8.8, 5.1) 2.27, m 1.89, m 2.06, m 1.96, m 3.84, m 3.62, m

4.72, dd (8.6, 3.9) 2.27, m 2.00, m 2.09, m 1.96, m 3.73, m 3.60, m

5.87, dd (11.6, 4.4) 3.12, m 3.03, m 7.24, m 7.30, m 7.28, m 7.30, m 7.24, m 2.96, s

5.06, d (11.0) 2.17, m 0.83, d (6.7) 0.65, d (6.8) 2.16, s

4.94, d (11.7) 2.30, m

172.1 60.0

174.5 58.8

25.77c 48.4

171.8 52.5

47

14.2

48 Fatty acid 49 50 51a 51b 52 53a 53b 54a 54b 55 56 57 58a 58b 59

31.3

17.7

60

20.1

179.3 34.8 42.5 31.8 38.0 27.5 30.3 34.8 140.0 114.8

δHb

(J in Hz)

0.87, d (6.7) 0.76, d (6.7) 2.93, s

5.06, d (11.0) 2.30, m 0.91, d (6.7) 0.83, d (6.4) 3.10, s

4.84, dd (8.6, 3.9) 2.26, m 1.72, m 2.04, m 1.97, m 3.61, m 3.55, m

5.30, q (6.8) 1.27, d (6.8) 3.02, s

2.94, m 1.50, m 1.34, m 1.42, m 1.32, m 1.14, m 1.35, m 1.29, m 1.37, m 2.05, m 5.81, m 4.93, m 4.95, m 1.07, d (6.7) 0.88, d (6.2)

δC

a

20.4 18.3 30.9 172.2 60.1 28.3 18.8 20.2 30.8 174.7 58.8 29.8 25.77e 48.7

171.9 52.5 14.2 31.3 179.4 34.9 42.6 31.9 38.3 28.1 30.6 33.0 23.7 14.4 17.7 20.1

δHb (J in Hz) 0.87, d (6.4) 0.76, d (6.8) 2.93, s

5.06, d (10.8) 2.90, m 0.91, d (6.0) 0.83, d (6.4) 3.10, s

4.72, dd (8.7, 4.0) 2.07, m 1.72, m 2.04, m 1.97, m 3.61, m 3.55, m

5.30, d (6.8) 1.27, d (6.8) 3.02, s

2.93, m 1.49, m 1.33, m 1.42, m 1.33, m 1.13, m 1.34, m 1.28, m 1.29, m 1.29, m 1.28, m 0.90, t (6.7) 1.07, d (6.7) 0.88, d (6.2)

a

Measured at 100 MHz. bMeasured at 400 MHz. cThese carbon signals are interchangeable. dThese carbon signals are interchangeable. eThese carbon signals are interchangeable. fThese carbon signals are interchangeable. gHydrogenated jahanyne (1) and hydrogenated jahanene (2) exhibited the same 1H and 13C NMR spectra as jahanane (3).

that of jahanene (2). The 13C NMR chemical shifts of 3 were similar to those of 2, except for the upfield shifts regarding C57 and C58 (Table 1). These results suggested that 3 should be the

The molecular formula of jahanane (3) was found to be C60H98N8O9 by ESIMS (m/z 1097.7332, calcd for C60H98 N8O9Na 1097.7354), which was 2 mass units (H2) larger than 9593

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry Scheme 1. Derivatization of Jahanyne (1) and Jahanene (2) to Jahanane (3)

Scheme 2. Retrosynthetic Analysis

N-Boc-L-proline afforded amide 21. To prevent undesirable side reactions, the ketone group in 21 was protected as a dithioacetal group. Dithioacetal 22 was converted into dipeptide 23 by condensation with N-Boc-N-Me-L-phenylalanine. Next, we sequentially introduced three contiguous N-Me-L-valine residues. The first N-Me-L-valine residue was connected smoothly, and tripeptide 24 was obtained in good yield (82%) by using the powerful condensation reagent HATU.8 However, introduction of the second and third N-Me-L-valine residues resulted in moderate yields, 55% for 25 and 31% for 26, even with HATU. In both cases, we could recover the starting materials, and the yields based on the recovered starting material were good: 98% for 25 and 76% for 26.9 Pentapeptide 26 was further condensed with N-Boc-L-proline and N-Boc-N-Me-L-alanine in sequence to provide heptapeptide 28 containing all residues. Finally, cleavage of dithioacetal by iodine provided the desired modified heptapeptide 5. Having completed the synthesis of two units, 4a−c and 5, we carried out the final step of the total synthesis of the jahanyne family (1−3) (Scheme 5). After deprotection of 5, the resulting secondary amine was condensed with 4a to provide jahanyne (1) in 58% overall yield for two steps. Similarly, jahanene (2) and jahanane (3) were synthesized by the reaction with fatty acid 4b or 4c. All of the spectroscopic data of the synthetic jahanyne family matched the corresponding value of the natural compounds. Thus, we achieved the total synthesis of the jahanyne family (1−3). Then, we evaluated the growth-inhibitory activities of the natural and synthetic jahanyne family (1−3) against human cancer cells by the MTT assay (Table 2). To our surprise, the cell growth-inhibitory activity of synthetic jahanyne (1) was nearly one-tenth of the reported activity.1 To check the validity, we re-evaluated the activity of natural jahanyne (1) isolated in this study. The cell growth-inhibitory activity of natural jahanyne (1) isolated in this study was comparable to that of synthetic jahanyne (1), which proved that the value of the previous report was inadequate. In addition, we established a preliminary structure−activity relationship of the jahanyne family (1−3) on the basis of a comparison of the IC50 values. A low degree of unsaturation of the terminus of the fatty acid moiety increases

hydrogenated derivative (at C57 and C58) of 2, containing a fully saturated fatty acid terminal. To confirm the gross structure of 2 and 3 and clarify their absolute stereochemistry, jahanyne (1) and 2 were reduced to 3 by catalytic hydrogenation (Scheme 1). The NMR spectra and optical rotation of natural 3 were found to be identical to those of jahanane (3) derived from 1 and 2. Thus, the absolute stereochemistries of jahanene and jahanane were determined to be 2 and 3, respectively. To confirm the assigned structures of jahanene (2) and jahanane (3) and to investigate the biological activity of the jahanyne family, we sought to achieve the total synthesis of 2 and 3 along with 1. Our retrosynthetic analysis of the jahanyne family (1−3) is outlined in Scheme 2. The jahanyne family (1−3) could be synthesized by condensation between fatty acid 4a−4c and modified heptapeptide 5, respectively. Three fatty acids with different degrees of unsaturation 4a−c could be prepared from common known alcohol 6 derived from (S)Roche ester in 7 steps.4 Meanwhile, modified heptapeptide 5 could be derived from several amino acids and ketone 7. Our synthesis began with the preparation of fatty acids 4a−c (Scheme 3). Dess-Martin oxidation of known alcohol 64 followed by a Horner−Wadsworth−Emmons reaction afforded α,β-unsaturated ester 9. Hydride reduction of 9 gave primary alcohol 10, which was converted into iodide 11 by an SN2 reaction. Two carbon homologation with lithium acetylide provided terminal alkyne 12, and removal of a TBDPS group followed by oxidation gave fatty acid 4a possessing a terminal alkyne.6 Fatty acid 4b was prepared from aldehyde 8. Four carbon elongation by the Horner−Wadsworth−Emmons reaction followed by reduction of ester and conjugated olefins afforded primary alcohol 16. A terminal alkene was introduced by Nishizawa−Grieco elimination,7 and subsequent deprotection and oxidation provided fatty acid 4b. Finally, saturated fatty acid 4c was synthesized from alkyne 12. Catalytic hydrogenation of 12 afforded silyl ether 19, and deprotection and oxidation as described above gave fatty acid 4c. Next, we synthesized modified heptapeptide 5 as follows (Scheme 4). The condensation of known methyl ketone 75 with 9594

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry Scheme 3. Synthesis of Fatty Acids 4a−c

δH 3.31. 13C NMR chemical shifts are referenced to CDCl3 observed at δC 77.1 and CD3OD observed at δC 49.0. 1H NMR chemical shifts were assigned using a combination of data from COSY and HMQC experiments. Similarly, 13C NMR chemical shifts were assigned based on HMBC and HMQC experiments. HR-ESITOF mass spectra were obtained on an LCT premier EX spectrometer (Waters). The reaction progress was checked on by thin layer chromatography (TLC). TLC was carried out using precoated sheets (E. Merck silica gel 60F254 (Art. 5715)) which, after development, were visualized under UV light at 254 nm and staining in phosphomolybdic acid solution. Silica gel column chromatography was performed using the indicated solvents on Fuji Silysia Chemical Ltd. silica gel (BW-820MH) and Wako Pure Chemical Industries, Ltd. silica gel (Wakogel 60N). All nonaqueous reactions were performed under an atmosphere of nitrogen using ovendried glassware and standard syringe in septa techniques. Commercially available reagents were used without further purification. Isolation and Derivatization Procedures. Samples of the marine cyanobacterium, Okeania sp., were collected by hand from the coast of Bise, Okinawa Prefecture, Japan, in October 2016. The cyanobacterium was identified by 16S rRNA sequence analysis. Approximately 268 g (wet weight) of the samples were extracted with MeOH (1.6 L). The extract was filtered, and the filtrate was concentrated. The residue was partitioned between H2O (100 mL) and EtOAc (100 mL × 3). The material obtained from the organic layer was further partitioned between 90% aqueous MeOH (50 mL) and n-hexane (50 mL × 3). The aqueous MeOH fraction (385 mg) was separated by column

the growth-inhibitory activity, especially against HeLa cells. According to the previous study by Chandrasekhar and coworkers, the fatty acid moiety of 1 may occupy the P2 binding groove on BCL-2.2 The presence of a terminal alkyne group might interfere with the interaction between the fatty acid chain of the jahanyne family and the P2 binding groove on BCL-2, thus decreasing the growth-inhibitory activity. In conclusion, we isolated two new jahanyne analogues, jahanene (2) and jahanane (3), along with jahanyne (1) from a marine cyanobacterium and determined their structures. We achieved total syntheses of the jahanyne family (1−3) and assessed their activities to inhibit cancer cell growth. The growthinhibitory activity of 1 was found to be nearly one-tenth of the previously reported activity.1 Furthermore, we found that the degree of unsaturation at the terminal of the fatty acid moiety affected the growth-inhibitory activity against human cancer cells.

■

EXPERIMENTAL SECTION

General Information. Optical rotations were measured with a JASCO DIP-1000 polarimeter. IR spectra were recorded on a JASCO RT/IR-4200 instrument. 1H NMR and 13C NMR spectra were recorded in CDCl3 or CD3OD on a JEOL JNM-ECX400 (400 MHz) and JNM-A400 (400 MHz), respectively. 1H NMR chemical shifts are referenced to CHCl3 observed at δH 7.26 and CHD2OD observed at 9595

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry Scheme 4. Synthesis of Modified Heptapeptide 5

Scheme 5. Synthesis of the Jahanyne Family 1−3

(ESI-TOF) m/z: [M + Na]+ Calcd for C60H98N8O9Na 1097.7354; found, 1097.7332. Catalytic Hydrogenation of Jahanyne (1). Jahanyne (1, 8.7 mg, 8.1 μmol) and 5% Pd/C (0.2 mg) were dissolved in MeOH (500 μL), and the vessel was purged with hydrogen. After being stirred at room temperature for 18 h, the catalyst was removed by filtration, and the filtrate was concentrated. The concentrate was subjected to HPLC [Cosmosil 5C18-AR-II (ϕ10 × 250 mm); flow rate, 4.0 mL/min; detection, UV 215 nm; solvent MeOH/H2O (85/15)] to give hydrogenated jahanyne (7.0 mg, tR = 18 min). Hydrogenated Jahanyne. Colorless oil; [α]24D −224 (c 0.67, CH3OH); for 1H NMR data, see Table 1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H98N8O9Na 1097.7354; found, 1097.7427.

chromatography on ODS (4.2 g) using 50% aqueous MeOH, 80% aqueous MeOH, and MeOH. The fraction (199 mg) eluted with 80% aqueous MeOH was subjected to reversed-phase HPLC [Cosmosil 5C18-AR-II (ϕ20 mm × 250 mm), 85% aqueous MeOH at 5.0 mL/min, and UV detection at 215 nm] to give jahanyne (1, 87.6 mg, tR = 27.0 min), jahanene (2, 46.5 mg, tR = 41.0 min), and jahanane (3, 11.9 mg, tR = 60.0 min). Jahanene (2). Colorless oil; [α]25D −255 (c 3.59, CH3OH); for 1H NMR, 13C NMR, COSY, HSQC, and HMBC data, see Table 1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H96N8O9Na 1095.7197; found, 1095.7230. Jahanane (3). Colorless oil; [α]25D −249 (c 1.19, CH3OH); for 1H NMR, 13C NMR, COSY, HSQC, and HMBC data, see Table 1. HRMS 9596

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry

Total Synthesis Procedures. (3R,5R)-6-((tert-Butyldiphenylsilyl)oxy)-3,5-dimethylhexanal (8). To a solution of known alcohol 64 (42 mg, 109 μmol) in CH2Cl2 (1 mL) at room temperature was added DMP (85.2 mg, 201 μmol). The reaction mixture was stirred at the same temperature for 20 min, then diluted with saturated aqueous Na2S2O3 (10 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 5 mL). The combined organic extracts were washed with brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:10 v/v) to afford aldehyde 8 (37.0 mg, 96.7 μmol, 89%) as a colorless oil: [α]D23 +22.8 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 9.70 (t, J = 2.4 Hz, 1H), 7.75−7.60 (m, 4H), 7.48−7.31 (m, 6H), 3.47 (dd, J = 7.8, 3.9 Hz, 1H), 3.43 (dd, J = 7.8, 4.4 Hz, 1H), 2.31 (m, 1H), 2.21 (m, 1H), 2.11 (m, 1H), 1.72 (m, 1H), 1.33 (m, 2H), 1.05 (s, 9H), 0.92 (d, J = 1.5 Hz, 3H), 0.90 (d, J = 1.5 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 203.1, 135.8, 134.0, 129.7, 127.7, 69.3, 51.9, 40.7, 33.3, 27.0, 25.6, 19.8, 19.4, 16.7; IR (neat) 2953, 2857, 1725, 1111, 824 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C24H35O2Si 383.2406; found, 383.2409. Ethyl (5S,7R,E)-8-((tert-Butyldiphenylsilyl)oxy)-5,7-dimethyloct-2enoate (9). To a solution of triethylphosphonoacetate (32.3 mg, 144 μmol) in THF (0.6 mL) at 0 °C was added NaH 60% oil suspension (5.8 mg, 146 μmol). The reaction mixture was stirred at room temperature for 30 min, then a solution of aldehyde 8 (37.3 mg, 97.5 μmol) in THF (2 × 0.2 mL) was added, and the mixture was stirred for 1.5 h. The reaction mixture was diluted with saturated aqueous NH4Cl (3 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 3 mL). The combined organic extracts were washed with saturated aqueous NaHCO3 (10 mL) and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:10 v/v) to afford ethyl ester 9 (40.2 mg, 88.8 μmol, 91%) as a colorless oil: [α]D23 +15.8 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.75− 7.55 (m, 4H), 7.50−7.36 (m, 6H), 6.90 (dt, J = 15.6, 7.2 Hz, 1H), 5.78 (d, J = 15.6 Hz, 1H), 4.19 (q, J = 6.8 Hz, 2H), 3,46 (dd, J = 9.8, 6.3 Hz, 1H), 3.43 (dd, J = 9.8, 6.3 Hz, 1H), 2.13 (m, 1H), 2.02 (m, 1H), 1.76− 1.62 (m, 2H), 1.29 (t, J = 6.8 Hz, 3H), 1.28−1.17 (m, 2H), 1.05 (s, 9H), 0.88 (d, J = 6.3 Hz, 3H), 0.85 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 166.8, 148.3, 135.8, 134.2, 129.7, 127.7, 122.6, 69.5, 60.3, 40.6, 40.5, 33.3, 29.9, 27.0, 19.4, 16.7 14.4. In the 13C NMR spectrum, the signal corresponding to a quaternary carbon of a tBu group in TBDPS overlapped with other signals; IR (neat) 2963, 2930, 2860, 1720, 1640, 1111, 701 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C28H40O3SiNa 475.2629; found, 475.2635. (5S,7R)-8-((tert-Butyldiphenylsilyl)oxy)-5,7-dimethyloctan-1-ol (10). To a solution of ethyl ester 9 (40.2 mg, 88.9 μmol) in THF (1 mL) at 0 °C was added LiBH4 (13.4 mg, 615 μmol). The reaction mixture was stirred at room temperature for 17 h, then diluted with saturated aqueous NH4Cl (3 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 5 mL). The combined organic extracts were washed with saturated aqueous NaHCO3 (10 mL) and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:10 to 1:5 v/v) to afford alcohol 10 (29.8 mg, 72.2 μmol, 81%) as a colorless oil: [α]D23 +12.8 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.69−7.63 (m, 4H), 7.45−7.34 (m, 6H), 3.63 (t, J = 6.8 Hz, 2H), 3.48 (dd, J = 9.8, 6.3 Hz, 1H), 3.40 (dd, J = 9.8, 6.3 Hz, 1H), 1.72 (m, 1H), 1.51−1.10 (m, 9H), 1.05 (s, 9H), 0.88 (d, J = 6.3 Hz, 3H), 0.81 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 135.8, 134.2, 129.6, 127.9, 69.7, 63.3, 40.8, 37.8, 33.4, 33.2, 30.1, 27.0, 23.3, 19.6, 19.5, 16.8; IR (neat) 2955, 2929, 2359, 1111, 701 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C26H40O2SiNa 435.2708; found, 435.2707. tert-Butyl(((2R,4S)-8-iodo-2,4-dimethyloctyl)oxy)diphenylsilane (11). To a solution of alcohol 10 (28.8 mg, 75.2 μmol) in CH2Cl2 (1 mL) at 0 °C were added DMAP (1.4 mg, 11.6 μmol), Et3N (0.04 mL, 295 μmol), and MsCl (0.02 mL 258 μmol). The reaction mixture was stirred at the same temperature for 1 h, then diluted with saturated aqueous NH4Cl (10 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 10 mL). The combined

Table 2. Cell Growth-Inhibitory Activity of the Jahanyne Family (1−3) growth-inhibitory activity IC50 (μM) compounds

HeLa cells

HL60 cells

natural jahanyne (1, reported in ref 1) natural jahanyne (1, isolated in this study) natural jahanene (2) natural jahanane (3) synthetic jahanyne (1) synthetic jahanene (2) synthetic jahanane (3)

1.8 22 ± 2 13 ± 1 3.0 ± 0.2 21 ± 2 13 ± 1 4.7 ± 0.6

0.63 4.6 ± 1.2 2.7 ± 0.5 2.7 ± 0.3 8.3 ± 2.3 2.6 ± 0.3 3.0 ± 0.4

Catalytic Hydrogenation of Jahanene (2). Jahanene (2, 9.6 mg, 9.0 μmol) and 5% Pd/C (0.2 mg) were dissolved in MeOH (500 μL), and the vessel was purged with hydrogen. After being stirred at room temperature for 18 h, the catalyst was removed by filtration, and the filtrate was concentrated. The concentrate was subjected to HPLC [Cosmosil 5C18-AR-II (ϕ10 × 250 mm); flow rate, 4.0 mL/min; detection, UV 215 nm; solvent MeOH/H2O (85/15)] to give hydrogenated jahanyne (8.6 mg, tR = 18 min). Hydrogenated Jahanene. Colorless oil; [α]24D −240 (c 0.87, CH3OH); for 1H NMR data, see Table 1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H98N8O9Na 1097.7354; found, 1097.7422. 16S rDNA Sequence Analysis. A cyanobacterial filament was isolated under a microscope and crushed with three freeze−thaw cycles. The 16S rRNA genes were PCR-amplified from isolated DNA using primer CYA106F10 (cyanobacterial-specific) and 16S1541R11 (universal). The PCR reaction contained DNA derived from a filament of cyanobacteria, 0.5 μL of KOD-Multi & Epi (TOYOBO), and 0.25 μL of each primer (0.5 pmol/μL as a final concentration), CYA106F (CGGACGGGTGAGTAACGCGTGA) and 16S1541R (AAGGAGGTGATCCAGCC). The PCR reaction was performed as follows: initial denaturation for 10 min at 94 °C, amplification by 40 cycles of 10 s at 98 °C, 10 s at 58 °C, and 1 min at 68 °C. PCR products were analyzed on agarose gel (1%) in TBE buffer, visualized with ethidium bromide staining. Sequences (accession no. LC367330) were determined with CYA106F and 16S1541R primers by a commercial firm (Macrogen Japan Corp). Phylogenetic Analysis. The phylogenetic analysis was carried out according to a previous paper.12 The nucleotide sequence of the 16S rRNA gene obtained in this study was used for phylogenetic analysis with the sequences of related cyanobacterial 16S rRNA genes.13 All sequences were aligned by the SINA web service (version 1.2.11)14 with default settings. The poorly aligned positions and divergent regions were removed by Gblocks Server (version 0.91b),15 implementing the options for a less stringent selection, including the ‘Allow smaller final blocks’, ‘Allow gap positions within the final blocks’ and ‘Allow less strict flanking positions’ options. The obtained 682 nucleotide positions have been used for phylogenetic analysis. JModeltest (version 2.1.7)16 with default settings was used to select the best model of DNA substitution for the maximum likelihood (ML) analysis and Bayesian analysis according to the Akaike information criterion (AIC). The ML analysis was conducted by PhyML (version 20131016),16b using the GTR+I+G model with a gamma shape parameter of 0.4770, a proportion of invariant sites of 0.5080, and nucleotide frequencies of F(A) = 0.2471, F(C) = 0.2322, F(G) = 0.3105, and F(T) = 0.2102. Bootstrap resampling was performed on 1,000 replicates. The ML tree was visualized with Njplot (version 2.3).17 Bayesian analysis was conducted by MrBayes (version 3.2.5)18 using the GTR+I+G model. The Markov chain Monte Carlo process was set at 2 chains, and 1,000,000 generations were conducted. Sampling frequency was assigned at every 500 generations. After analysis, the first 100,000 trees were deleted as burn-in, and the consensus tree was constructed. The Bayesian tree was visualized with FigTree (version 1.4.0, http:// tree.bio.ed.ac.uk/software/figtree). As a result, the cyanobacterium (accession no. LC367330) formed a clade with Okeania. Therefore, the cyanobacterium was classified into the genus Okeania. 9597

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry

Ethyl (2E,4E,7S,9R)-10-((tert-Butyldiphenylsilyl)oxy)-7,9-dimethyldeca-2,4-dienoate (14). To a solution of triethyl 4-phosphonocrotonate (77.3 mg, 308 μmol) in THF (0.6 mL) at 0 °C was added 60% NaH oil suspension (12.8 mg, 32 μmol). The reaction mixture was stirred at room temperature for 30 min, then the solution of aldehyde 8 (37 mg, 96.7 μmol) in THF (2 × 0.2 mL) was added, and the mixture was stirred for 2 h. The reaction mixture was diluted with saturated aqueous NH4Cl (3 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 3 mL). The combined organic extracts were washed with saturated aqueous NaHCO3 (10 mL) and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (hexane to EtOAc/hexane 1:20 v/v) to afford ethyl ester 14 (25.0 mg, 52.2 μmol, 54%, 14E/14Z = 5:1) as a colorless oil: [α]D26 +8.3 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.72−7.52 (m, 4H), 7.44−7.35 (m, 6H), 7.22 (s, 1H), 6.16−6.02 (m, 2H), 5.86 (d, J = 15.1 Hz, 0.17H), 5.77 (d, J = 15.6 Hz, 0.83H), 4.23−4.17 (m, 2H), 3.47 (dd, J = 9.8, 6.3 Hz, 1H), 3.41 (dd, J = 9.8, 6.3 Hz, 1H), 2.19−1.95 (m, 2H), 1.72 (m, 1H), 1.66 (m, 1H), 1.44−1.17 (m, 2H), 1.29 (t, J = 6.8 Hz, 3H), 1.05 (s, 9H), 0.88 (d, J = 6.8 Hz, 3H), 0.83 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 167.5, 145.1, 143.5, 135.8, 134.2, 129.71, 129.65, 127.7, 119.4, 69.5, 68.3, 60.3, 41.4, 40.5, 38.9, 36.4, 33.3, 30.4, 27.0, 19.4, 16.8, 14.5, 11.1; IR (neat) 2958, 2930, 2857, 1715, 1643, 1111, 702 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C30H43O3Si 479.2981; found, 479.2969. (2E,4E,7S,9R)-10-((tert-Butyldiphenylsilyl)oxy)-7,9-dimethyldeca2,4-dien-1-ol (15). To a solution of ethyl ester 14 (25.0 mg, 52.2 μmol) in THF (0.25 mL) at 0 °C was added 1 M LiAlH4 solution in THF (0.1 mL, 100 μmol). The reaction mixture was stirred at room temperature for 12 h, then diluted with saturated aqueous potassium sodium tartrate (5 mL). The organic layer was separated, and the aqueous phase was extracted with Et2O (3 × 5 mL). The combined organic extracts were washed with brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:2 v/v) to afford alcohol 15 (16.4 mg, 37.6 μmol, 72%) as a colorless oil: [α]D23 +5.4 (c 0.82, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.67−7.64 (m, 4H), 7.43−7.35 (m, 6H), 6.21 (dd, J = 15.1, 10.2 Hz, 1H), 6.01 (dd, J = 14.6, 10.2 Hz, 1H), 5.75− 5.61 (m, 2H), 4.16 (d, J = 6.3 Hz, 2H), 3.47 (dd, J = 9.2, 5.9 Hz, 1H), 3.41 (dd, J = 9.2, 6.3 Hz, 1H), 2.02 (m, 1H), 1.92 (m, 1H), 1.75−1.70 (m, 2H), 1.30−1.15 (m, 2H), 1.05 (s, 9H), 0.88 (d, J = 6.3 Hz, 3H), 0.81 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 135.8, 134.5, 134.3, 132.3, 130.8, 129.6, 129.5, 127.7, 69.7, 63.7, 41.1, 40.4, 33.4, 30.6, 27.1, 19.5, 19.4 16.8; IR (neat) 3339, 2957, 2929, 2857, 1111, 701 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C28H41O2Si 437.2875; found, 437.2871. (7S,9R)-10-((tert-Butyldiphenylsilyl)oxy)-7,9-dimethyldecan-1-ol (16). To a solution of alcohol 15 (6.5 mg, 15 μmol) in EtOH (1 mL) at room temperature under H2 atmosphere was added 5% Pd/C (6.3 mg). The reaction mixture was stirred at the same temperature for 4 h. After completion of the reaction, the mixture was filtered with EtOH (100 mL) and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:4 v/v) to afford alcohol 16 (6.5 mg, 15 μmol, quant) as a colorless oil: [α]23D +6.9 (c 0.52, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.67−7.65 (m, 4H), 7.43− 7.35 (m, 6H), 3.64 (t, J = 6.8 Hz, 2H), 3.48 (dd, J = 10.7, 6.3 Hz, 1H), 3.40 (dd, J = 10.7, 7.3 Hz, 1H), 1.71 (m, 1H), 1.57−1.09 (m, 13H), 1.05 (s, 9H), 0.88 (d, J = 6.8 Hz, 3H), 0.80 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 135.8, 134.31, 134.28, 129.6, 127.7, 69.7, 63.2, 40.9, 38.0, 33.4, 32.9, 30.1, 29.9, 27.1, 27.0, 25.9, 19.6, 19.5, 16.9; IR (neat) 3342, 2942, 2844, 1111, 739 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C28H45O2Si 441.3188; found, 441.3176. tert-Butyl(((2R,4S)-2,4-dimethyldec-9-en-1-yl)oxy)diphenylsilane (17). To a solution of alcohol 16 (7.2 mg, 16 μmol) in THF (0.2 mL) at 0 °C were added 2-nitrophenyl selenocyanate (18.9 mg, 83.2 μmol) and n Bu3P (0.02 mL, 80 μmol). The reaction mixture was stirred at room temperature for 2 h, then NaHCO3 (30.3 mg, 361 μmol) and 30% H2O2 aq. (0.05 mL) were added at 0 °C. The resulting mixture was stirred at room temperature for 2 h. The reaction mixture was diluted with saturated aqueous NH4Cl (5 mL). The organic layer was separated, and

organic extracts were washed with brine (20 mL), dried over anhydrous Na2SO4, and concentrated to afford crude product (48.4 mg) as a yellow oil. This compound was used in the next reaction without purification. To a solution of the crude product (48.4 mg) in THF (1 mL) at room temperature was added NaI (55.6 mg 371 μmol). The reaction mixture was stirred at 50 °C for 14 h, then diluted with saturated aqueous NH4Cl (10 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 5 mL). The combined organic extracts were washed with saturated aqueous Na2S2O3 (20 mL), saturated aqueous NaHCO3 (20 mL) and brine (20 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (hexane to EtOAc/hexane 1:100 to 1:50 v/v) to afford iodide 11 (36.8 mg, 70.1 μmol, 93%) as a colorless oil: [α]D23 +7.4 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.71−7.61 (m, 4H), 7.50−7.26 (m, 6H), 3.48 (dd, J = 9.8, 6.3 Hz, 1H), 3.41 (dd, J = 9.8, 6.3 Hz, 1H), 3.18 (t, J = 7.3 Hz, 2H), 1.82−1.67 (m, 3H), 1.51−1.11 (m, 7H), 1.05 (s, 9H), 0.88 (d, J = 6.3 Hz, 3H), 0.81 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 135.8, 134.3, 129.6, 127.7, 69.7, 40.8, 36.8, 33.9, 33.3, 29.9, 28.1, 27.0, 19.6, 19.5, 16.8, 7.5. IR (neat) 2957, 2929, 1427, 1269, 1111, 773, 700 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C26H40IOSi 523.1893; found, 523.1886. tert-Butyl(((2R,4S)-2,4-dimethyldec-9-yn-1-yl)oxy)diphenylsilane (12). To a solution of iodide 11 (36.8 mg, 70.1 μmol) in THF/DMSO (1:1 v/v, 0.5 mL) at room temperature was added a lithium acetylide ethylene diamine complex (20.8 mg, 226 μmol). The reaction mixture was stirred at the same temperature for 5 h, then diluted with saturated aqueous NH4Cl (10 mL). The organic layer was separated, and the aqueous phase was extracted with EtOAc (3 × 5 mL). The combined organic extracts were washed with saturated aqueous NaHCO3 (20 mL) and brine (20 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:50, 1:20 to 1:10 v/v) to afford alkyne 12 (20.1 mg, 47.8 μmol, 68%) as a colorless oil: [α]D23 +12.1 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.69−7.63 (m, 4H), 7.45− 7.35 (m, 6H), 3.48 (dd, J = 9.3, 6.3 Hz, 1H), 3.41 (dd, J = 9.3, 6.3 Hz, 1H), 2.17 (dt, J = 2.4, 7.3 Hz, 2H), 1.93 (t, J = 2.4 Hz, 1H), 1.72 (m, 1H), 1.51−1.08 (m, 9H), 1.05 (s, 9H), 0.88 (d, J = 6.8 Hz, 3H), 0.81 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 135.8, 134.3, 129.6, 127.7, 84.9, 69.7, 68.2, 40.8, 37.4, 33.4, 30.0, 28.9, 27.0, 26.3, 19.6, 19.5, 18.6, 16.8; IR (neat) 2956, 2930, 2857, 2359, 2341, 2116, 1428, 1112, 1091, 772, 701 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C28H41OSi 421.2927; found, 421.2937. (2R,4S)-2,4-Dimethyldec-9-yn-1-ol (13). To a solution of alkyne 12 (20.1 mg, 47.5 μmol) in THF (0.5 mL) at room temperature was added 1 M TBAF solution in THF (0.1 mL 100 μmol). The reaction mixture was stirred at the same temperature for 11 h, then diluted with H2O (5 mL). The aqueous phase was extracted with EtOAc (3 × 5 mL), and the combined organic extracts were washed with brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (200 × 100 × 0.5 mm, EtOAc/hexane 1:5 v/v) to afford alcohol 13 (6.7 mg 37 μmol, 77%) as a colorless oil: [α]D23 +22.8 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 3.56−3.39 (m, 2 H), 2.19 (dt J = 6.8, 2.4 Hz, 2H), 1.94 (t, J = 2.4 Hz, 1H), 1.81−1.66 (m, 2H), 1.52−1.37 (m, 4H), 1.27 (m, 1H), 1.20−1.04 (m, 3H),, 0.89 (d, J = 6.8 Hz, 3H), 0.85 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 77.5, 69.3, 68.3, 40.7, 37.5, 33.4, 30.0, 28.9, 26.3, 19.4, 18.6, 16.4; IR (neat) 3311, 2929, 2869, 2117, 1462, 1378, 1036, 629 cm−1. HRMS (ESITOF) m/z: [M + H]+ Calcd for C12H23O 183.1749; found, 183.1750. (2R,4S)-2,4-Dimethyldec-9-ynoic Acid (4a). To a solution of alcohol 13 (6.7 mg, 36.8 μmol) in MeCN (0.1 mL) and H2O (0.1 mL) at 0 °C were added dropwise phosphate buffer (0.1 mL) at pH 7, TEMPO (1.2 mg 7.7 μmol), 30% aqueous NaClO (0.1 mL), and 1 M aqueous NaClO2 (0.3 mL). The reaction mixture was stirred at the same temperature for 2.5 h, then quenched by saturated aqueous NaHCO3 (1 mL). The aqueous phase was extracted with EtOAc (2 × 3 mL), and the combined organic extracts were washed with brine (5 mL), dried over anhydrous Na2SO4, and concentrated to afford crude 4a (6.1 mg) as a colorless oil. This product was used in the next reaction without purification. 9598

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry the aqueous phase was extracted with CH2Cl2 (3 × 5 mL). The combined organic extracts were washed with brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:10, 1:2 v/v) to afford alkene 17 (5.4 mg, 12.8 μmol, 78%) as a colorless oil: [α]D23 +11.7 (c 0.21, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.67−7.65 (m, 4H), 7.43−7.35 (m, 6H), 5.81 (m, 1H), 5.00 (d, J = 18.0 Hz, 1H), 4.92 (d, J = 10.2 Hz, 1H), 3.48 (dd, J = 9.8, 5.9 Hz,1H), 3.40 (dd, J = 9.8, 6.8 Hz, 1H), 2.01 (dd, J = 11.1, 7.3 Hz, 2H),1.71 (m, 1H), 1.41 (m, 1H), 1.34−1.09 (m, 8H), 1.05 (s, 9H), 0.88 (d, J = 6.8 Hz, 3H), 0.80 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 139.4, 135.8, 134.32, 134.29, 129.6, 127.7, 114.2, 69.8, 40.9, 37.8, 34.0, 33.4, 30.0, 29.4, 27.0, 26.7, 19.6, 19.5, 16.9; IR (neat) 2957, 2930, 2856, 1640, 1462, 1428, 1111, 738, 700 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C28H43OSi 423.3083; found, 423.3075. (2R,4S)-2,4-Dimethyldec-9-en-1-ol (18). To a solution of alkene 17 (6.5 mg, 15 μmol) in THF (0.15 mL) at room temperature was added 1 M TBAF solution in THF (0.05 mL, 50 μmol). The reaction mixture was stirred at room temperature for 15 h, then diluted with H2O (5 mL). The aqueous phase was extracted with EtOAc (3 × 3 mL), and the combined organic extracts were washed with brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (200 × 100 × 0.5 mm, EtOAc/hexane 1:5 v/v) to afford alcohol 18 (2.2 mg, 12 μmol, 77%) as a colorless oil: [α]23D +32.5 (c 0.06, CHCl3); 1H NMR (400 MHz, CDCl3) δ 5.81 (m, 1H), 4.99 (d, J = 17.0 Hz, 1H), 4.93 (d, J = 10.2 Hz, 1H), 3.48 (dd, J = 10.7, 6.3 Hz, 1H), 3.40 (dd, J = 10.7, 6.3 Hz, 1H), 2.07−2.01 (m, 2H), 1.70 (m, 1H), 1.36−1.25 (m, 6H), 1.18−1.03 (m, 3H), 0.88 (d, J = 6.8 Hz, 3H), 0.83 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 114.3, 110.1, 69.3, 51.1, 40.7, 34.0, 33.4, 30.0, 29.4, 26.7, 19.5, 16.5; IR (neat) 2923, 2852, 1648, 1462, 1035 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C12H25O 185.1905; found, 185.1902. (2R,4S)-2,4-Dimethyldec-9-enoic Acid (4b). To a solution of alcohol 18 (2.2 mg, 11.9 μmol) in MeCN (0.05 mL) and H2O (0.05 mL) at 0 °C were added dropwise phosphate buffer (0.03 mL) at pH 7, TEMPO (1.1 mg 7.0 μmol), 30% aqueous NaClO (0.02 mL), and 1 M aqueous NaClO2 (0.03 mL). The reaction mixture was stirred at the same temperature for 3.5 h, then quenched by saturated aqueous NaHCO3 (0.5 mL). The aqueous phase was extracted with EtOAc (2 × 3 mL), and the combined organic extracts were washed with brine (5 mL), dried over anhydrous Na2SO4, and concentrated to afford crude 4b (2.4 mg) as a colorless oil. This product was used in the next reaction without purification. tert-Butyl(((2R,4S)-2,4-dimethyldecyl)oxy)diphenylsilane (19). To a solution of alkyne 12 (7.6 mg, 18 μmol) in EtOH (1 mL) at room temperature under H2 atmosphere was added 5% Pd/C (4.1 mg). The reaction mixture was stirred at the same temperature for 4 h. After completion of the reaction, the mixture was filtered with EtOH (100 mL) and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:10 v/v) to afford alkane 19 (7.7 mg, 18 μmol, quant) as a colorless oil: [α]D23 +10.2 (c 0.39, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.67−7.59 (m, 4H), 7.43− 7.33 (m, 6H), 3.47 (dd, J = 9.8, 5.8 Hz, 1H), 3.40 (dd, J = 9.8, 6.3 Hz, 1H), 1.71 (m, 1H), 1.42 (m, 1H), 1.29−1.12 (m, 12H), 1.05 (s, 9H), 1.02 (t, J = 2.9 Hz, 3H), 0.88 (d, J = 6.8 Hz, 3H), 0.80 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 136.1, 135.8, 134.3, 129.6, 129.0, 127.7, 69.8, 40.9, 38.1, 33.4, 32.1, 30.1, 29.8, 28.1, 27.1, 22.8, 19.7, 19.5, 16.9, 14.3; IR (neat) 2957, 2927, 2857, 1427, 1376, 1110, 700 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C28H45OSi 425.3239; found, 425.3235. (2R,4S)-2,4-Dimethyldecan-1-ol (20). To a solution of alkane 19 (6.6 mg, 16 μmol) in THF (0.15 mL) at room temperature was added 1 M TBAF solution in THF (0.05 mL, 50 μmol). The reaction mixture was stirred at room temperature for 15 h, then diluted with H2O (5 mL). The aqueous phase was extracted with EtOAc (3 × 3 mL), and the combined organic extracts were washed with brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (200 × 100 × 0.5 mm, EtOAc/hexane 1:4 v/v) to afford alcohol 20 (1.7 mg, 9.1 μmol, 59%) as a colorless oil: [α]D23 +16.2 (c 0.09, CHCl3); 1H NMR (400 MHz, CDCl3) δ 3.48 (dd, J = 10.2, 5.3 Hz,

1H), 3.40 (dd, J = 10.2, 6.8 Hz, 1H), 1.70 (m, 1H), 1.30−1.18 (m, 9H), 1.16−1.03 (m, 4H), 0.89 (d, J = 6.3 Hz, 3H), 0.88 (t, J = 6.8 Hz, 3H), 0.83 (d, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 69.3, 40.8, 38.1, 33.4, 32.1, 30.0, 29.8, 27.2, 22.8, 19.6, 16.5, 14.3; IR (neat) 2924, 2855, 1464, 1377, 1037 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C12H26ONa 209.1881; found, 209.1877. (2R,4S)-2,4-Dimethyldecanoic Acid (4c). To a solution of alcohol 20 (1.7 mg, 9.1 μmol) in MeCN (0.04 mL) and H2O (0.04 mL) at 0 °C were added dropwise phosphate buffer (0.03 mL) at pH 7, TEMPO (2.1 mg 13.4 μmol), 30% aqueous NaClO (0.02 mL), and 1 M aqueous NaClO2 (0.03 mL). The reaction mixture was stirred at the same temperature for 2.5 h, then quenched by saturated aqueous NaHCO3 (0.5 mL). The aqueous phase was extracted with EtOAc (2 × 3 mL), and the combined organic extracts were washed with brine (5 mL), dried over dry anhydrous Na2SO4, and concentrated to afford crude 4c (2.2 mg) as a colorless oil. This product was used in the next reaction without purification. tert-Butyl (S)-2-((S)-2-Acetylpyrrolidine-1-carbonyl)pyrrolidine-1carboxylate (21). To a stirred solution of methyl ketone 75 (520 mg, 2.44 mmol) in CH2Cl2 (5 mL) was added TFA (2 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (5 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 7 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 7 and N-Boc-N-L-Pro (674 mg, 2.91 mmol) in DMF (15 mL) at room temperature were added HATU (1.13 g, 2.97 mmol) and DIPEA (1.27 mL, 7.29 mmol). The reaction mixture was stirred at the same temperature for 2 h, then diluted with EtOAc (50 mL), washed with 10% aqueous citric acid (50 mL), saturated aqueous NaHCO3 (50 mL), and brine (50 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (CHCl3/MeOH 50:1 v/v) to afford compound 21 (723 mg, 2.34 mmol, 96% in 2 steps) as a pale yellow oil. The ratio of major and minor rotamers is 2:1: [α]D23 −92.6 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) for the major rotamer δ 4.68 (dd, J = 8.5, 4.4 Hz, 1H), 4.50 (dd, J = 8.1, 3.2 Hz, 1H), 3.80 (m, 1H), 3.69−3.43 (m, 2H), 3.39 (m, 1H), 2.19 (s, 3H), 2.18−1.94 (m, 4H), 1.90−1.74 (m, 4H), 1.44 (s, 9H); those for the minor rotamer δ 4.64 (dd, J = 8.8, 4.6 Hz, 1H), 4.39 (dd, J = 8.8, 3.9 Hz, 1H), 2.21 (s, 3H), 1.39 (s, 9H); 13C NMR (100 MHz, CDCl3) for the major rotamer δ 207.0, 171.2, 154.7, 79.6, 64.8, 57.7, 47.0, 46.84, 30.2, 29.3, 28.6, 27.7, 24.2, 23.7; those for the minor rotamer δ 206.7, 171.2, 153.8, 79.5, 46.77, 28.5, 27.4, 25.1; IR (neat) 3568, 2974, 2877, 1695, 1654, 1396, 1163, 1122, 755 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C16H26N2O4Na 333.1790; found, 333.1780. tert-Butyl Methyl((S)-1-((S)-2-((S)-2-(2-methyl-1,3-dithian-2-yl)pyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1-oxo-3-phenylpropan-2yl)carbamate (23). To a solution of compound 21 (80.2 mg 258 μmol) and 1,3-propanedithiol (0.1 mL 1.04 mmol) in CH2Cl2 (0.7 mL) at 0 °C was added dropwise BF3·Et2O (0.1 mL, 796 μmol). The reaction mixture was stirred at the same temperature for 2.5 h and then diluted with 5% aqueous NaOH (10 mL). The organic layer was separated, and the aqueous phase was extracted with CH2Cl2 (3 × 10 mL). The combined organic layers were washed with 5% aqueous NaOH (20 mL) and brine (20 mL), dried over anhydrous Na2SO4, and concentrated to afford crude 22 (110 mg), which was used in the next reaction without purification. To a solution of crude 22 and N-Boc-NMe-L-Phe (108 mg, 387 μmol) in DMF (0.4 mL) at room temperature were added HATU (108 mg, 284 μmol) and DIPEA (0.20 mL, 572 μmol). The reaction mixture was stirred at the same temperature for 12 h, then diluted with EtOAc (20 mL), washed with 10% aqueous citric acid (20 mL), saturated aqueous NaHCO3 (20 mL), and brine (20 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 3:2 v/v) to afford compound 23 (132 mg, 237 μmol, 92% in 2 steps) as a yellow oil. The ratio of major and minor rotamers is 7:3: [α]D23 −81.9 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) for the major rotamer δ 7.24−7.10 (m, 5H), 5.05 (m, 1H), 4.98 (dd, J = 9.8, 3.9 Hz, 1H), 9599

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry

rotamer δ 7.25−7.09 (m, 5H), 5.92 (dd, J = 11.3, 4.9 Hz, 1H), 5.03 (d, J = 10.7 Hz, 1H), 5.00 (d, J = 10.2, 1H), 4.75 (dd, J = 6.3, 4.8 Hz, 1H), 4.11 (m, 1H), 3.82 (m, 1H), 3.62−3.47 (m, 3H), 3.36 (m, 1H), 3.20− 3.03 (m, 3H), 2.96 (s, 3H), 2.77−2.60 (m, 2H), 2.67 (s, 3H), 2.36− 1.80 (m, 12 H), 2.22 (s, 3H), 1.49 (s, 3H), 1.42 (s, 9H), 0.84 (d, J = 6.3 Hz, 3H), 0.82 (d, J = 6.3 Hz, 3H), 0.76 (d, J = 6.3 Hz, 3H), 0.63 (d, J = 6.3 Hz, 3H); for the minor rotamer δ 5.97 (dd, J = 11.7, 4.9 Hz, 1H), 4.45 (d, J = 10.7 Hz, 1H), 2.95 (s, 3H), 2.66 (s, 3H), 2.09 (s, 3H), 1.48 (s, 9H), 0.80 (d, J = 6.3 Hz, 3H), 0.65 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) for the major rotamer δ 173.2, 170.5, 169.9, 169.0, 156.2, 136.9, 129.2, 128.5, 127.0, 80.5, 79.9, 60.1, 59.6, 58.6, 54.9, 54.5, 48.7, 47.5, 34.5, 30.6, 29.5, 28.4, 27.6, 27.0, 26.5, 26.4, 25.5, 25.2, 24.9, 24.8, 20.2, 19.9, 18.2, 18.1, 17.8, 17.4; for the minor rotamer δ 169.8, 168.8, 156.8, 137.3, 129.6, 128.3, 126.6, 60.2, 59.1, 58.5, 54.3, 47.6, 34.5, 30.5, 29.4, 28.5, 27.1, 26.9, 20.1; IR (neat) 2966, 2930, 2874, 1690, 1639, 1307, 1218, 771 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C41H66N5O6S2 788.4455; found, 788.4431. tert-Butyl Methyl((S)-3-methyl-1-(methyl((S)-3-methyl-1(methyl((S)-3-methyl-1-(methyl((S)-1-((S)-2-((S)-2-(2-methyl-1,3-dithian-2-yl)pyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1-oxo-3-phenylpropan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)carbamate (26). To a stirred solution of compound 25 (149 mg, 189 μmol) in CH2Cl2 (2 mL) was added TFA (1 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (5 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 25 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 25 and N-Boc-N-Me-L-Val (66.5 mg, 287 μmol) in CH2Cl2-DMF (1:1 v/v, 0.5 mL) at room temperature were added HATU (108 mg, 284 μmol) and DIPEA (0.13 mL, 746 μmol). The reaction mixture was stirred at the same temperature for 16 h, then diluted with EtOAc (20 mL), washed with 10% aqueous citric acid (20 mL), saturated aqueous NaHCO3 (20 mL), and brine (20 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane = 1:2, 1:1.5, 1:1 to 1.5:1 v/v) to afford compound 26 (53.0 mg, 58.8 μmol, 31% in 2 steps) as a pale yellow oil (with recovery of deprotected amine 25, 76.9 mg, 59%). The ratio of major and minor rotamers is 2:1: [α]D23 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) those for the major rotamer δ 7.25−7.21 (m, 3H), 7.17−7.12 (m, 2H), 5.92 (dd, J = 7.3, 4.4 Hz, 1H), 5.02 (m, 1H), 5.00 (d, J = 10.2 Hz, 1H), 4.92 (d, J = 10.2 Hz, 1H), 4.75 (dd, J = 7.8, 4.9 Hz, 1H), 4.60 (d, J = 10.7 Hz, 1H), 4.11 (m, 1H), 3.80 (m, 1H), 3.63−3.47 (m, 3H), 3.35 (m, 1H), 3.22− 3.03 (m, 2H), 2.99−2.90 (m, 2H), 2.96 (s, 3H), 2.94 (s, 3H), 2.73 (s, 3H), 2.16 (s, 3H), 2.36−1.80 (m, 13H), 1.49 (s, 3H), 1.44 (s, 9H), 0.85−0.74 (m, 15H), 0.59 (d, J = 6.8 Hz, 3H); those for the minor rotamer δ 5.02 (d, J = 10.2 Hz, 1H), 4.74 (dd, J = 4.9, 7.8 Hz, 1H), 4.34 (d, J = 10.7, 1H), 2.93 (s, 3H), 2.19 (s, 3H), 1.45 (s, 3H), 0.61 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) those for the major rotamer δ 173.2, 170.9, 170.0, 169.8, 169.0, 156.3, 137.6, 129.3, 128.6, 127.0, 80.6, 80.2, 60.2, 60.1, 59.1, 58.6, 58.1, 54.5, 48.7, 47.6, 34.6, 30.6, 29.5, 28.4, 27.6, 27.14, 27.11, 27.0, 26.53, 26.50, 26.0, 25.49, 25.48, 25.2, 24.9, 24.8, 20.1, 20.0, 19.7, 18.1, 17.9, 17.4; IR (neat) 2966, 2932, 2874, 1687, 1638, 1444, 1405, 754 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C47H76N6O7S2Na 923.5115; found, 923.5100. tert-Butyl (S)-2-(Methyl((S)-3-methyl-1-(methyl((S)-3-methyl-1(methyl((S)-3-methyl-1-(methyl((S)-1-((S)-2-((S)-2-(2-methyl-1,3-dithian-2-yl)pyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1-oxo-3-phenylpropan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)carbamoyl)pyrrolidine-1-carboxylate (27). To a stirred solution of compound 26 (78.4 mg, 86.9 μmol) in CH2Cl2 (1 mL) was added TFA (0.5 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (1 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 26 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 26 and N-Boc-L-Pro (33.4 mg, 144 μmol) in CH2Cl2-DMF (1:1 v/v, 0.3 mL) at room

4.75 (m, 1H), 4.13 (m, 1H), 3.72 (m, 1H), 3.53 (m, 1H), 3.37 (m, 2H), 3.15−2.87 (m, 3H), 2.79 (s, 2H), 2.78 (s, 1H), 2.77−2.66 (m, 2H), 2.30−1.80 (m, 10H), 1.49 (s, 3H), 1.10 (s, 9H); those for the minor rotamer δ 5.32 (dd, J = 10.3, 5.4 Hz, 1H), 2.78 (s, 3H), 1.26 (s, 9H); 13C NMR (100 MHz, CDCl3) for the major rotamer δ 173.4, 169.0, 155.0, 138.3, 129.6, 128.5, 126.5, 80.1, 79.8, 60.0, 59.3, 54.7, 48.7, 46.7, 34.5, 30.1, 29.4, 28.0, 27.7, 26.5, 25.5, 25.1, 24.9, 24.8; those for the minor rotamer δ 169.9, 155.8, 137.6, 129.3, 128.2, 126.4, 59.0, 47.2, 29.6, 29.2, 28.3, 27.6; IR (neat) 2973, 2892, 1692, 1644, 1387, 1314, 1166, 752 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C29H44N3O4S2 562.2773; found, 562.2773. tert-Butyl Methyl((S)-3-methyl-1-(methyl((S)-1-((S)-2-((S)-2-(2methyl-1,3-dithian-2-yl)pyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1oxo-3-phenylpropan-2-yl)amino)-1-oxobutan-2-yl)carbamate (24). To a stirred solution of compound 23 (29.4 mg, 52.3 μmol) in CH2Cl2 (0.5 mL) was added TFA (2 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (1 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 23 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 23 and N-Boc-N-Me-LVal (22.6 mg, 97.7 μmol) in CH2Cl2-DMF (10:1 v/v, 0.1 mL) at room temperature were added HATU (37.8 mg, 102 μmol) and DIPEA (0.03 mL, 222 μmol). The reaction mixture was stirred at the same temperature for 18 h, then diluted with EtOAc (10 mL), washed with 10% aqueous citric acid (10 mL), saturated aqueous NaHCO3 (10 mL), and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/CH2Cl2 1:5, 1:3 to 1:2 v/v) to afford compound 24 (28.6 mg, 42.9 μmol, 82% in 2 steps) as a colorless oil. The ratio of major and minor rotamers is 2:1: [α]D23 −166 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) for the major rotamer δ 7.26−7.20 (m, 2H), 7.20− 7.13 (m, 3H), 5.85 (dd, J = 11.2, 4.9 Hz, 1H), 5.03 (m, 1H), 4.75 (m, 1H), 4.54 (d, J = 10.7 Hz, 1H), 4.11 (m, 1H), 3.79 (m, 1H), 3.72− 2.88 (m, 6H), 3.04 (s, 3H), 2.77−2.65 (m, 2H), 2.25−1.86 (m, 11H), 1.99 (s, 3H), 1.49 (s, 3H), 1.43 (s. 9H), 0.80 (d, J = 6.3 Hz, 3H), 0.74 (d, J = 6.8 Hz, 3H); those for the minor rotamer δ 4.29 (d, J = 10.7 Hz, 1H), 3.05 (s, 3H), 2.05 (s, 3H), 1.50 (s, 3H), 1.44 (s, 9H), 0.81 (d, J = 6.3 Hz, 3H), 0.76 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) for the major rotamer δ 173.3, 170.6, 169.1, 155.9, 137.3, 129.3, 128.5, 126.5, 79.7, 60.1, 59.9, 59.0, 54.8, 48.7, 47.6, 34.7, 30.8, 29.6, 28.5, 27.6, 27.0, 26.5, 25.5, 25.2, 24.9, 24.8, 19.9, 18.3, 17.9; those for the minor rotamer δ 170.3, 129.0, 128.7, 126.9, 58.9, 55.0, 54.9, 34.6, 30.7, 27.5, 26.4, 25.2, 20.3; IR (neat) 2972, 2931, 1685, 1642, 1444, 1305, 1261, 1152, 753 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C35H54N4O5S2Na 697.3433; found, 697.3430. tert-Butyl Methyl((S)-3-methyl-1-(methyl((S)-3-methyl-1(methyl((S)-1-((S)-2-((S)-2-(2-methyl-1,3-dithian-2-yl)pyrrolidine-1carbonyl)pyrrolidin-1-yl)-1-oxo-3-phenylpropan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)carbamate (25). To a stirred solution of compound 24 (41.9 mg, 62.1 μmol) in CH2Cl2 (0.5 mL) was added TFA (2 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (1 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 24 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 24 and N-Boc-N-Me-L-Val (29.5 mg, 128 μmol) in CH2Cl2-DMF (1:1 v/v, 0.1 mL) at room temperature were added HATU (38.4 mg, 101 μmol) and DIPEA (0.06 mL, 325 μmol). The reaction mixture was stirred for 16 h, then diluted with EtOAc (10 mL), washed with 10% aqueous citric acid (10 mL), saturated aqueous NaHCO3 (10 mL), and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (EtOAc/hexane 1:1.5, 1:1, 1.5:1 to 2:1 v/v) to afford compound 25 (86.3 mg, 110 μmol, 55%, in 2 steps) as a pale yellow oil (with recovery of deprotected amine 24, 50.6 mg, 44%). The ratio of major and minor rotamers is 1.5:1: [α]D23 −227 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) for the major 9600

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry temperature were added HATU (51.1 mg 132 μmol) and DIPEA (0.1 mL, 574 μmol). The reaction mixture was stirred at the same temperature for 22 h, then diluted with EtOAc (5 mL), washed with 10% aqueous citric acid (5 mL), saturated aqueous NaHCO3 (5 mL), and brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (CH2Cl2/EtOAc 4:1 to EtOAc/hexane 1:1, 1.5:1, 2:1 v/v) to afford compound 27 (56.2 mg, 56.3 μmol, 65% in 2 steps) as a pale yellow oil. The ratio of the main major and minor rotamers is 5:4: [α]D23 −263 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) for the major rotamer δ 7.25−7.22 (m, 3H), 7.17−7.10 (m, 2H), 5.56 (dd, J = 10.7, 3.9 Hz, 1H), 5.10 (d, J = 10.7 Hz, 1H), 5.01 (m, 1H), 5.00 (d, J = 10.2 Hz, 1H), 4.92 (d, J = 10.2 Hz, 1H), 4.75 (m, 1H), 4.65 (dd, J = 8.3, 2.9 Hz, 1H), 4.11 (m, 1H), 3.80 (m, 1H), 3.67−3.21 (m, 8H), 3.20−3.09 (m, 2H), 3.04 (s, 3H), 2.97 (s, 3H), 2.90 (s, 3H), 2.78−2.66 (m, 2H), 2.32−1.94 (m, 12H), 2.18 (s, 3H), 1.93−1.80 (m, 3H), 1.49 (s, 3H), 1.43 (s, 9H), 0.89 (d, J = 6.8 Hz, 3H), 0.84−0.76 (m, 9H), 0.72 (d, J = 6.8 Hz, 3H), 0.60 (d, J = 6.3 Hz, 3H); those for the minor rotamer δ 5.11 (d, J = 10.2 Hz, 1H), 4.59 (dd, J = 8.3, 2.9 Hz, 1H), 3.00 (s, 3H), 2.94 (s, 3H), 2.20 (s, 3H), 1.40 (s, 9H), 0.89 (d, J = 6.3 Hz, 3H), 0.60 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) for the major rotamer δ 173.6, 173.2, 170.8, 169.7, 169.51, 169.0, 153.9, 136.9, 129.2, 128.5, 127.0, 79.8, 60.2, 59.0, 58.6, 58.4, 58.0, 56.7, 54.9, 54.4, 48.7, 47.6, 46.8, 38.7, 34.5, 30.6, 30.2 29.52, 29.45, 28.5, 27.6, 27.04, 26.99, 26.52, 26.48, 25.5, 25.2, 24.9, 24.8, 24.3, 20.1, 19.9, 19.8, 19.6, 18.9, 17.7, 17.35; those for the minor rotamer δ 172.9, 169.54, 147.0, 79.6, 46.7, 30.4, 22.8, 19.87, 19.4, 18.9, 17.8, 17.42; IR (neat) 2963, 2935, 2879, 1698, 1639, 1446, 1400, 749 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C52H83N7O8S2Na 1020.5642; found, 1020.5669. tert-Butyl Methyl((S)-1-((S)-2-(methyl((S)-3-methyl-1-(methyl((S)3-methyl-1-(methyl((S)-3-methyl-1-(methyl((S)-1-((S)-2-((S)-2-(2methyl-1,3-dithian-2-yl)pyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1oxo-3-phenylpropan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)amino)-1-oxobutan-2-yl)carbamoyl)pyrrolidin-1-yl)-1oxopropan-2-yl)carbamate (28). To a stirred solution of compound 27 (56.2 mg, 56.3 μmol) in CH2Cl2 (1 mL) was added TFA (0.5 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, the reaction mixture was diluted with benzene (1 mL) and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 27 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 27 and N-Boc-N-Me-L-Ala (17.6 mg, 86.5 μmol) in CH2Cl2-DMF (1:1 v/v, 0.1 mL) at room temperature were added HATU (32.5 mg 85.5 μmol) and DIPEA (0.05 mL, 287 μmol). The reaction mixture was stirred at the same temperature for 22 h, then diluted with EtOAc (5 mL), washed with 10% aqueous citric acid (5 mL), saturated aqueous NaHCO3 (5 mL), and brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by column chromatography on silica gel (CH2Cl2/EtOAc 3:1 to EtOAc/ hexane 1:1 to CHCl3/MeOH 50:1, 20:1 v/v) to afford compound 28 (48.0 mg, 44.3 μmol, 79% in 2 steps) as a pale yellow oil. The ratio of major and minor rotamers is 5:4: [α]D23 −229 (c 0.70, CHCl3); 1H NMR (400 MHz, CDCl3) for the major rotamer δ 7.24−7.22 (m, 3H), 7.15−7.12 (m, 2H), 5.92 (dd, J = 11.7, 4.9 Hz, 1H), 5.06 (d, J = 10.7 Hz, 1H), 5.02 (m, 1H), 4.99 (d, J = 10.2 Hz, 1H), 4.92 (d, J = 10.7 Hz, 1H), 4.83−4.72 (m, 3H), 4.09 (m, 1H), 3.80 (m, 1H), 3.70 (m, 1H), 3.65− 3.54 (m, 2H), 3.53−3.46 (m, 2H), 3.35 (m, 1H), 3.20−3.12 (m, 2H), 3.10−3.06 (m, 2H), 3.07 (s, 3H), 2.96 (s, 3H), 2.90 (s, 3H), 2.79 (s, 3H), 2.25−2.22 (m, 5H), 2.16 (s, 3H), 2.09−2.02 (m, 7H), 1.99− 1.82 (m, 4H), 1.72 (m, 1H), 1.49 (s, 3H), 1.45 (s, 9H), 1.25 (d, J = 6.8 Hz, 3H), 0.89 (d, J = 6.8 Hz, 3H), 0.83−0.75 (m, 9H), 0.71 (d, J = 6.8 Hz, 3H), 0.59 (d, J = 6.8 Hz, 3H); those for the minor rotamer δ 5.02 (m, 1H), 2.74 (s, 3H), 1.44 (s, 9H), 1.27 (d, J = 6.8 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 173.2, 172.8, 170.8, 169.7, 169.54, 169.46, 169.0, 155.8, 137.0, 129.3, 128.6, 127.0, 80.4, 80.0, 60.2, 59.1, 58.6, 58.5, 58.0, 54.9, 54.5, 48.7, 48.6, 47.6, 47.0, 34.5, 30.6, 30.3, 29.53, 29.47, 28.8, 28.6, 28.5, 27.6, 27.1, 26.53, 26.50, 25.5, 25.2, 25.0, 24.9, 24.8, 20.1, 20.0, 19.9, 19.5, 18.6, 18.5, 18.4, 17.7, 17.4, 14.4; IR (neat) 2966, 2933, 2874, 1688, 1639, 1444, 1403, 751 cm−1. HRMS (ESI-TOF) m/z: [M + H]+ Calcd for C56H91N8O9S2 1083.6350; found, 1083.6368.

tert-Butyl ((S)-1-((S)-2-(((S)-1-(((S)-1-(((S)-1-(((S)-1-((S)-2-((S)-2Acetylpyrrolidine-1-carbonyl)pyrrolidin-1-yl)-1-oxo-3-phenylpropan-2-yl)(methyl)amino)-3-methyl-1-oxobutan-2-yl)(methyl)amino)-3-methyl-1-oxobutan-2-yl)(methyl)amino)-3-methyl-1-oxobutan-2-yl)(methyl)carbamoyl)pyrrolidin-1-yl)-1-oxopropan-2yl)(methyl)carbamate(5). To a stirred solution of compound 28 (17.4 mg, 16.1 μmol) in MeCN (0.2 mL) and saturated aqueous NaHCO3 (0.1 mL) at 0 °C was added I2 (18.6 mg, 78.2 μmol). The reaction mixture was stirred at the same temperature for 1 h, then quenched with saturated aqueous Na2S2O3 (1 mL). The aqueous phase was extracted with EtOAc (3 × 2 mL). The combined organic layer was washed with saturated aqueous NaHCO3 (10 mL) and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (200 × 100 × 0.5 mm, CHCl3/MeOH 10:1 v/v) to afford 5 (14.0 mg 14.7 μmol, 91%) as a yellow oil: [α]D23 −273 (c 1.00, CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.25−7.19 (m, 3H), 7.16−7.11 (m, 2H), 5.88 (dd, J = 11.7, 4.4 Hz, 1H), 5.07 (d, J = 10.7 Hz, 1H), 5.01 (d, J = 10.7 Hz, 1H), 4.93 (d, J = 10.7 Hz, 1H), 4.79 (m, 1H), 4.72−4.63 (m, 3H), 3.84−3.61 (m, 6H), 3.16−3.02 (m, 2H), 3.07 (s, 3H), 2.98 (s, 3H), 2.91 (s, 3H), 2.79 (s, 3H), 2.74 (s, 3H), 2.37−2.27 (m, 3H), 2.20 (s, 3H), 2.18−1.94 (m, 8H), 1.87− 1.78 (m, 2H), 1.77−1.56 (m, 2H), 1.45 (s, 9H), 1.26 (d, J = 7.8 Hz, 3H), 0.89 (d, J = 7.3 Hz, 3H), 0.81 (d, J = 7.3 Hz, 3H), 0.79 (d, J = 7.3 Hz, 3H), 0.77 (d, J = 6.8 Hz, 3H), 0.71 (d, J = 6.8 Hz, 3H), 0.59 (d, J = 7.3 Hz, 3H); 13 C NMR (100 MHz, CDCl3) δ 206.6, 172.8, 170.9, 170.3, 169.9, 169.6, 169.1, 155.8, 136.9, 129.1, 128.6, 127.0, 126.7, 80.0, 64.9, 58.6, 58.5, 58.2, 58.0, 56.9, 54.5, 51.6, 47.6, 47.5, 47.0, 34.5, 30.7, 30.3, 29.8, 29.7, 29.5, 28.6, 28.5, 28.43, 28.38, 27.64, 27.56, 27.1, 25.0, 24.9, 20.0, 19.9, 19.5, 18.6, 18.5, 18.4, 17.7, 17.4, 14.3; IR (neat) 2966, 2933, 2874, 1723, 1688, 1639, 1440, 1403, 1158, 752 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C53H84N8O10Na 1015.6208; found, 1015.6208. Jahanyne (1). To a stirred solution of compound 5 (14.1 mg, 14.7 μmol) in CH2Cl2 (0.5 mL) was added TFA (0.2 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, benzene (1 mL) was added to the reaction mixture and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 5 was afforded and used in the next reaction without purification. To a stirred solution of the trifluoroacetate salt of deprotected amine 5 and carboxylic acid 4a (6.1 mg) in DMF at room temperature were added HATU (10.4 mg 27.3 μmol) and DIPEA (0.01 mL, 287 μmol). The reaction mixture was stirred for 2 h, then diluted with EtOAc (5 mL), washed with 10% aqueous citric acid (5 mL), saturated aqueous NaHCO3 (5 mL), and brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (EtOAc/CH2Cl2 1:1 v/v) to afford jahanyne (1) (8.8 mg, 8.2 μmol, 58% in 2 steps): [α]D23 −273 (c 0.44, CH3OH); 1H NMR (400 MHz, CD3 OD) δ 7.40−7.26 (m, 3H), 7.25−7.21 (m, 2H), 5.88 (dd, J = 11.7, 4.6 Hz, 1H), 5.30 (q, J = 7.0 Hz, 1H), 5.06 (d, J = 11.0 Hz, 1H), 5.02 (d, J = 10.8 Hz, 1H), 4.93 (d, J = 11.0 Hz, 1H), 4.84 (dd, J = 9.2, 4.3 Hz, 1H), 4.72 (dd, J = 9.2, 3.6 Hz, 1H), 4.61 (dd, J = 8.8, 4.7 Hz, 1H), 3.84 (m, 1H), 3.74 (m, 1H), 3.68−3.53 (m, 4H), 3.15−3.07 (m, 2H), 3.10 (s, 3H), 3.03 (s, 3H), 2.96 (s, 3H), 2.95 (m, 1H), 2.93 (s, 3H), 2.37− 2.22 (m, 6H), 2.18 (s, 3H), 2.14 (s, 3H), 2.10−1.86 (m, 10H), 1.73 (m, 1H), 1.54−1.30 (m, 10H), 1.27 (d, J = 7.4 Hz, 3H), 1.07 (d, J = 7.4 Hz, 3H), 0.92−0.87 (m, 9H), 0.86−0.81 (m, 6H), 0.76 (d, J = 7.0 Hz, 3H), 0.65 (d, J = 7.2 Hz, 3H); 13C NMR (100 MHz, CD3OD) δ 208.3, 179.3, 174.8, 172.5, 172.1, 171.9, 171.1, 170.9, 170.5, 138.3, 130.5, 129.6, 128.1, 85.3, 69.5, 66.8, 60.0, 59.9, 59.8, 58.8, 56.7, 52.5, 48.9, 48.4, 48.3, 42.5, 37.5, 35.1, 34.8, 31.8, 31.4, 31.3, 30.9, 30.8, 30.2, 29.9, 29.4, 28.7, 28.2, 28.1, 27.1, 27.0, 26.8, 25.82, 25.79, 20.4, 20.2, 20.1, 19.9, 19.0, 18.9, 18.3, 18.0, 17.8, 14.2. The five signals of 13C NMR overlapped with other signals; IR (neat) 2964, 2935, 2874, 2116, 1725, 1634, 1443, 1403, 1117, 1098, 753, 699 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H94N8O9Na 1093.7041; found, 1093.7036. Jahanene (2). To a stirred solution of compound 5 (2.3 mg, 2.31 μmol) in CH2Cl2 (0.2 mL) was added TFA (0.1 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, benzene (1 mL) was added to the reaction mixture and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 5 9601

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry was afforded and used in the next reaction without purification. To a stirred solution of trifluoroacetate salt of deprotected amine 5 and carboxylic acid 4b (2.4 mg) in DMF at room temperature were added HATU (6.3 mg, 16.6 μmol) and DIPEA (0.01 mL, 287 μmol). The reaction mixture was stirred for 3 h, then diluted with EtOAc (5 mL), washed with 10% aqueous citric acid (5 mL), saturated aqueous NaHCO3 (5 mL), and brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (MeOH/CHCl3 1:10 v/v) to afford jahanene (2) (1.4 mg, 1.3 μmol, 38% in 2 steps): [α]D25 −240 (c 0.16, CH3OH); for 1H NMR, see Table 1; for 13C NMR, see Table 1; IR (neat) 3082, 2963, 2929, 2873, 1725, 1638, 1443, 1404, 1118, 1098, 908, 753 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H96N8O9Na 1095.7197; found, 1095.7181. Jahanane (3). To a stirred solution of compound 5 (4.4 mg, 4.4 μmol) in CH2Cl2 (0.2 mL) was added TFA (0.1 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min and at room temperature for 30 min. After completion of the reaction, benzene (1 mL) was added to the reaction mixture and concentrated. After repetition of this operation five times, the trifluoroacetate salt of deprotected amine 5 was afforded and used in the next reaction without purification. To a stirred solution of trifluoroacetate salt of deprotected amine 5 and carboxylic acid 4c (2.2 mg) in DMF at room temperature were added HATU (5.8 mg, 15.2 μmol) and DIPEA (0.01 mL, 287 μmol). The reaction mixture was stirred for 3 h, then diluted with EtOAc (5 mL), washed with 10% aqueous citric acid (5 mL), saturated aqueous NaHCO3 (5 mL), and brine (5 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by PTLC (MeOH/CHCl3 1:10 v/v) to afford jahanane (3) (1.8 mg, 1.7 μmol, 38% in 2 steps): [α]D25 −256 (c 0.19, CH3OH); for 1H NMR, see Table 1; for 13C NMR, see Table 1; IR (neat) 2963, 2929, 2873, 1724, 1638, 1444, 1404, 1119, 1098, 753 cm−1. HRMS (ESI-TOF) m/z: [M + Na]+ Calcd for C60H98N8O9Na 1097.7354; found, 1097.7349. Cell Growth Analysis. HeLa cells were cultured at 37 °C with 5% CO2 in DMEM (Nissui, Japan) supplemented with 10% heat-inactivated FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, 0.25 μg/mL amphotericin, 300 μg/mL L-glutamine, and 2.25 mg/mL NaHCO3. HL60 cells were cultured at 37 °C with 5% CO2 in RPMI (Nissui, Japan) supplemented with 10% heat-inactivated FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, 0.25 μg/mL amphotericin, 300 μg/mL Lglutamine, and 2.25 mg/mL NaHCO3. HeLa cells were seeded at 5 × 103 cells/well in 96-well plates (Iwaki, Japan) and cultured overnight. HL60 cells were seeded at 2 × 104 cells/well in 96-well plates. Various concentrations of compounds were then added, and cells were incubated for 72 h. Cell proliferation was measured by the MTT assay.19 The assays were performed in triplicate, and the experiments were repeated three times.

■

of Japan (16H03285, 15K01803, and 15H06584) and Keio Leading-Edge Laboratory of Science, and Technology (KLL)Specified Research Projects. We thank Kaneka Corporation for their gift of (S)-Roche ester.

■

(1) Iwasaki, A.; Ohno, O.; Sumimoto, S.; Ogawa, H.; Nguyen, K. A.; Suenaga, K. Jahanyne, an Apoptosis-Inducing Lipopeptide from the Marine Cyanobacterium Lyngbya sp. Org. Lett. 2015, 17, 652−655. (2) Kallepu, S.; Kavitha, M.; Yeeravalli, R.; Manupati, K.; Jadav, S. S.; Das, A.; Mainkar, P. S.; Chandrasekhar, S. Total Synthesis of Desmethyl Jahanyne and Its Lipo-Tetrapeptide Conjugates Derived from Parent Skeleton as BCL-2-Mediated Apoptosis-Inducing Agents. ACS Omega 2018, 3, 63−75. (3) Siow, A.; Opiyo, G.; Kavianinia, I.; Li, F. F.; Furkert, D. P.; Harris, P. W. R.; Brimble, M. A. Total Synthesis of the Highly N-Methylated Acetylene-Containing Anticancer Peptide Jahanyne. Org. Lett. 2018, 20, 788−791. (4) Yokokawa, F.; Asano, T.; Okino, T.; Gerwick, W. H.; Shioiri, T. An expeditious total synthesis of kalkitoxins: determination of the absolute stereostructure of natural kalkitoxin. Tetrahedron 2004, 60, 6859− 6880. (5) Gao, X. G.; Lin, Y. Q.; Kwong, S. Q.; Xu, Z.; Ye, T. Total Synthesis and Stereochemical Reassignment of Bisebromoamide. Org. Lett. 2010, 12, 3018−3021. (6) (a) Lindgren, B. O.; Nilsson, T.; et al. Preparation of Carboxylic Acids from Aldehydes (Including Hydroxylated Benzaldehydes) by Oxidation with Chlorite. Acta Chem. Scand. 1973, 27, 888−890. (b) Kraus, G. A.; Roth, B. Synthetic studies toward verrucarol. 2. Synthesis of the AB ring system. J. Org. Chem. 1980, 45, 4825. (7) Grieco, P. A.; Gilman, S.; Nishizawa, M. Organoselenium chemistry. A facile one-step synthesis of alkyl aryl selenides from alcohols. J. Org. Chem. 1976, 41, 1485−1486. (8) (a) Carpino, L. A.; El-Faham, A.; Albericio, F. Racemization studies during solid-phase peptide synthesis using azabenzotriazolebased coupling reagents. Tetrahedron Lett. 1994, 35, 2279−2282. (b) Carpino, L. A.; El-Faham, A. Effect of Tertiary Bases on OBenzotriazolyluronium Salt-Induced Peptide Segment Coupling. J. Org. Chem. 1994, 59, 695−698. (c) El-Faham, A.; Albericio, F. Peptide Coupling Reagents, More than a Letter Soup. Chem. Rev. 2011, 111, 6557−6602. (9) At this stage, we checked the possibility of epimerization of the products, 25 and 26. As shown in Figure S54, we could not detect any notable amount of epimers by HPLC analysis. (10) Nübel, U.; Garcia-Pichel, F.; Muyzer, G. PCR primers to amplify 16S rRNA genes from cyanobacteria. Appl. Environ. Microbiol. 1997, 63, 3327−3332. (11) Embley, T. M. The linear PCR reaction: a simple and robust method for sequencing amplified rRNA genes. Lett. Appl. Microbiol. 1991, 13, 171−174. (12) Sumimoto, S.; Iwasaki, A.; Ohno, O.; Sueyoshi, K.; Teruya, T.; Suenaga, K. Kanamienamide, an Enamide with an Enol Ether from the Marine Cyanobacterium Moorea bouillonii. Org. Lett. 2016, 18, 4884− 4887. (13) Engene, N.; Paul, V. J.; Byrum, T.; Gerwick, W. H.; Thor, A.; Ellisman, M. H. Five chemically rich species of tropical marine cyanobacteria of the genus Okeania gen. nov. (Oscillatoriales, Cyanoprokaryota). J. Phycol. 2013, 49, 1095−1106. (14) Pruesse, E.; Peplies, J.; Glöckner, F. O. SINA: accurate highthroughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics 2012, 28, 1823−1829. (15) (a) Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564−577. (b) Castresana, J. Selection of Conserved Blocks from Multiple Alignments for Their Use in Phylogenetic Analysis. J. Mol. Biol. Evol. 2000, 17, 540−552. (16) (a) Darriba, D.; Taboada, G. L.; Doallo, R.; Posada, D. jModelTest 2: more models, new heuristics and parallel computing.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.joc.8b00310. Phylogenetic tree and NMR spectra for all new compounds (PDF)

■

REFERENCES

AUTHOR INFORMATION

Corresponding Authors

*(T.T.) E-mail: [email protected]. *K.S.) E-mail: [email protected]. ORCID

Arihiro Iwasaki: 0000-0002-3775-5066 Kiyotake Suenaga: 0000-0001-5343-5890 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported in part by Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology 9602

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603

Article

The Journal of Organic Chemistry Nat. Methods 2012, 9, 772. (b) Guindon, S.; Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696−704. (17) Perrière, G.; Gouy, M. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 1996, 78, 364−369. (18) Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D. L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M. A.; Huelsenbeck, J. P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539−542. (19) Mosmann, T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55−63.

9603

DOI: 10.1021/acs.joc.8b00310 J. Org. Chem. 2018, 83, 9592−9603