Label-Free Platform for MicroRNA Detection Based on the

Subscriber access provided by READING UNIV

Article

A Novel and Label-free Platform for MicroRNA Detection Based on the Fluorescence Quenching of Positively Charged Gold Nanoparticles to Ag Nanoclusters Xiangmin Miao, Zhiyuan Cheng, Haiyan Ma, Zongbing Li, Ning Xue, and Po Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b01991 • Publication Date (Web): 04 Dec 2017 Downloaded from http://pubs.acs.org on December 4, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

A Novel and Label-free Platform for MicroRNA Detection Based on the Fluorescence Quenching of Positively Charged Gold Nanoparticles to Ag Nanoclusters Xiangmin Miao,† Zhiyuan Cheng,†,‡ Haiyan Ma,† Zongbing Li,† Ning Xue,† and Po Wang*,†,‡

†

School of Life Science, Jiangsu Normal University, Xuzhou 221116, China

‡

School of Chemistry and Materials Science, Jiangsu Normal University, Xuzhou

221116, China

Corresponding Author *Tel.: +86 516 83403170. Fax: +86 516 83536977. E-mail address: [email protected] (P. Wang).

1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT A novel strategy was developed for microRNA-155 (miRNA-155) detection based on the fluorescence quenching of positively charged gold nanoparticles ((+)AuNPs) to Ag nanoclusters (AgNCs). In the designed system, DNA-stabilized Ag nanoclusters (DNA/AgNCs) were introduced as fluorescent probes, and DNA-RNA heteroduplexes were formed upon the addition of target miRNA-155. Meanwhile, the (+)AuNPs could be electrostatically adsorbed on the negatively charged single-stranded DNA (ssDNA) or DNA-RNA heteroduplexes to quench the fluorescence signal. In the presence of duplex-specific nuclease (DSN), DNA-RNA heteroduplexes became a substrate for the enzymatic hydrolysis of DNA strand to yield a fluorescence signal due to the diffusion of AgNCs away from (+)AuNPs. Under the optimal conditions, (+)AuNPs displayed 95% of the quenching efficiency to AgNCs, which paved the way for ultrasensitive detection with a low detection limit of 33.4 fM. In particular, the present strategy demonstrated excellent specificity and selectivity toward the detection of target miRNA against control miRNAs, including mutated miRNA-155, miRNA-21, miRNA-141, let-7a, and miRNA-182. Moreover, the practical application value of the system was confirmed by the evaluation of the expression levels of miRNA-155 in clinical serum samples with satisfactory results, suggesting that the proposed sensing platform is promising for applications in disease diagnosis as well as the fundamental research of biochemistry.

2


Page 2 of 26

Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION MicroRNAs (miRNAs) play vital roles in many biological processes such as cell differentiation, cell apoptosis, and the development of cancer.1 The levels of miRNAs can be used as biomarkers for cellular events or early disease diagnosis.2 Thus, effective detection of miRNAs is of great significance for clinical diagnosis and the research of pathogenesis.3 Recently, various intriguing sensing methods have been developed for miRNAs detection based on electrochemical,4-9 colorimetric,10-13 electrochemiluminescent,14,15

fluorescent,16-20

and

chemiluminescent

imaging

detection platforms.21 Among which, fluorescence-based detection system has been extensively employed in bioanalysis, due to their advantages of high sensitivity and selectivity, fast analysis, cost-effectiveness, and ease of operation.22-24 Simple and sensitive detection platforms are urgently needed for the analysis of miRNAs because of their intrinsic characteristics, such as small size, sequence homology among family members, and low abundance.3 In recent years, a number of amplification

strategies

including

duplex-specific

nuclease

(DSN)

signal

amplification,25,26 real-time polymerase chain reaction (RT-PCR),27 rolling circle amplification (RCA),28-31 and hybridization chain reaction (HCR)12,32 have been proposed for miRNAs detection. Among these amplification methods, DSN paved a promising way for ultrasensitive and accurate quantitation of miRNAs due to the ability for the cleavage of DNA in DNA-RNA heteroduplex while keeping the RNA strand intact,33 and the intact RNA strand can be reused to form new heteroduplex for 3



the next step of cleavage, resulting in target recycling signal amplification. In addition, DSN-based signal amplification can realize the rapid and sensitive detection of miRNAs in isothermal condition. It is vital that DSN can distinguish perfectly and imperfectly matched short duplexes since miRNAs exhibit a high degree of homology among family members.34,35 As a class of novel fluorescence quenching nanomaterial, gold nanoparticles (AuNPs) have attracted tremendous attentions in recent years owing to their captivating properties, such as large surface area to volume ratio, ease of surface functionalization, and strong local surface plasmon resonance (LSPR) absorption in the visible region,36,37 which can simultaneously quench several fluorophores while an organic quencher only works well for a specific fluorophore.38 However, almost all of these fluorescence-based detection schemes involve the use of negatively charged gold nanoparticles ((-)AuNPs),39-41 and their dispersion status was easily to be affected in complex systems containing salts, metal ions or other biomolecules, which greatly limited their applications in biological assays. Herein, to explore the application of a new class of AuNPs, named positively charged AuNPs ((+)AuNPs), an ultrasensitive and label-free system was firstly developed for miRNA-155 detection based on the fluorescence quenching of (+)AuNPs coupled with DSN-assisted target recycling signal amplification. As shown in Scheme 1, DNA-templated Ag nanoclusters (DNA/AgNCs) were introduced for the generation of fluorescence signal. After the addition of (+)AuNPs, they could be electrostatically adsorbed onto the negatively charged single-stranded DNA (ssDNA), 4


Page 4 of 26

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


leading to the vicinity of AgNCs to (+)AuNPs, which efficiently quenched the fluorescence signal (A). In the presence of miRNA-155, DNA-RNA heteroduplexes were formed as the substrate for DSN. DSN selectively hydrolyzed DNA strands in DNA-RNA heteroduplexes, resulting in the release of AgNCs and the recovery of fluorescence signal. Since miRNA-155 remained intact during the hydrolytic process, it could return to the solution, react with another DNA/AgNCs, and trigger the next round of DSN-based hydrolytic process. Such a cycle started anew, leading to the continuous cleavage of DNA-RNA heteroduplexes, which greatly amplified the fluorescence signal for miRNA-155 detection (B).

Scheme 1

EXPERIMENTAL SECTION Reagents and Chemicals. Cetyltrimethyl ammonium bromide (CTAB), silver nitrate (AgNO3), gold chloride trihydrate (HAuCl4·3H2O), and sodium borohydride (NaBH4) were purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Bovine serum

albumin

(BSA),

thrombin,

immunoglobulin

G,

hemoglobin,

and

carcinoembryonic antigen (CEA) were obtained from Sigma-Aldrich (USA). DSN was purchased from New England Biolabs Inc. (Beverly, MA, USA). All oligonucleotides were synthesized by Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China), and their sequences were displayed in Table 1.

Table 1 5



Apparatus. An F-4600 fluorescence spectrophotometer (Hitachi, Japan) was used to record the fluorescence spectra and measure the fluorescence intensity. UV-vis absorption spectra were measured on a UV-260 spectrometer (Thermo Fisher, USA). The size and particle distribution of the (+)AuNPs was observed by transmission electron microscope (TEM) and high-resolution TEM (HR-TEM, Tecnai F20, USA). The zeta potential and average size of (+)AuNPs were investigated using particle size analyzer (MS2000, England). Preparation of DNA/AgNCs. AgNCs were synthesized according to the literature method.42 Briefly, AgNO3 solution (300 µM, 60 µL) was initially added into c-DNA-155 solution (50 µM, 60 µL, pH 7.0) and stirred vigorously for 30 s, followed by the incubation in the dark at 4 °C for 15 min to form DNA-Ag+ complex. Subsequently, NaBH4 solution (300 µM, 60 µL) was added quickly and stirred vigorously for 30 s. Finally, the resulting solution was kept in the dark at 4 °C for at least 2 h, and the fluorescence intensity was determined at 530 nm with an excitation wavelength of 460 nm. Synthesis of (+)AuNPs. (+)AuNPs were prepared according to our previous work.43 In brief, 2 mL of NaBH4 (100 mM) was added into the mixed solution containing 15 mL of HAuCl4 (1.0 mM) and 2 mL of CTAB (10 mM), and the reaction system was stirred continuously until the color of the solution varied from pale yellow to orange red without changing within 15 min. The resulting solution was stored in brown glass bottle at 4 °C for future uses. Extraction of RNAs from Serum Samples. Prior to analysis, circulating RNAs 6


Page 6 of 26

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


containing miRNA-155 were extracted from clinical serum samples according to reference work using miRNeasy RNA isolation kits.44 In a typical procedure, 200 µL of serum sample was firstly mixed with 1.0 mL of Qiazol solution, and the mixture was vortexed and incubated at 25 °C for 5 min for the dissociation of nucleoprotein complexes. Afterward, 200 µL of chloroform was added into the system, and the mixture was vortexed for 30 s and centrifuged at 12000 × g for 15 min at 4 °C. Then, purification of RNA in upper phase was completed, and the precipitation step was carried out based on the Qiagen’s instruction. Before use, the extracted miRNA samples were stored in a −80 °C freezer. Detection of miRNA-155. For miRNA-155 detection, 100 µL of the (+)AuNPs solution was firstly added into the prepared DNA/AgNCs and incubated for 30 min at room temperature. Then, different concentrations of miRNA-155 were added into the mixed solution separately, followed by the incubation at room temperature for 30 min. After that, 1×DSN enzyme master buffer (500 mM Tris-HCl, 100 mM MgCl2, 10 mM dithiothreitol, pH 6.6), 0.1 U of DSN (dissolved in 25 mM Tris-HCl, 50% glycerol, 10 µL) were added and incubated at 37 °C for 80 min. At last, 5 µL of 10 mM EDTA was introduced to inactive DSN at 60 °C for 5 min. For fluorescence measurements, the excitation wavelength and emission wavelength were set at 460 and 530 nm, respectively, the slit widths for both excitation and emission were set at 10 nm, and the samples were scanned from 500 to 750 nm.

RESULTS AND DISCUSSION 7



Characteristics of (+)AuNPs. TEM was employed to investigate the size and particle distribution of (+)AuNPs. As shown in Figure 1A, the (+)AuNPs exhibited well dispersion status and relatively uniform structure, and the average size of these nanoparticles was measured to be about 4 nm. Meanwhile, the microscopic property of the (+)AuNPs was further studied by HR-TEM in Figure 1B. It can be observed that the lattice fringe spacing of the (+)AuNPs was estimated to be 0.23 nm, which matched the d value for Au (111).45 However, the average size of the (+)AuNPs estimated from dynamic light scattering (DLS) analysis was about 10 nm (Figure 1C). The reason for the difference was attributed to the fact that DLS analysis evaluated the hydrodynamic radius, while TEM images provided a more precise measurement of the hard AuNP core.46 Besides, the zeta potential of such AuNPs monitored from DLS was obtained to be +33.8 mV, which confirmed that the AuNPs were positively charged. Moreover, UV-vis absorption spectrum was employed to prove the stability of (+)AuNPs. As shown in Figure 1D, compared with (+)AuNPs themselves (a), neither the absorption spectrum nor the color of (+)AuNPs was changed apparently after the addition of 50 mM of NaCl (b), BSA (c), metal ions of K+, Mg2+, Ca2+ and Al3+ (d), and the mixture of them (e), demonstrating the good stability of (+)AuNPs in complex sample matrix.

Figure 1

Characterization of the Sensing System. To verify the feasibility of the strategy for miRNA-155 detection, the fluorescence changes of DNA/AgNCs were 8


Page 8 of 26

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


investigated under different conditions. As shown in Figure 2, the DNA/AgNCs exhibited a strong fluorescence intensity (curve a). Then, after the adsorption of (+)AuNPs on DNA/AgNCs, the fluorescence intensity decreased sharply (curve b). Upon the addition of 500 pM miRNA-155 for the formation of DNA-RNA heteroduplexes, the change of the fluorescence signal was weak (curve c). The reason for the realization of fluorescence quenching was ascribed to the mechanism that (+)AuNPs could be electrostatically adsorbed on the negatively charged ssDNA or DNA-RNA heteroduplexes, leading to the vicinity of AgNCs to (+)AuNPs. However, after the addition of 0.1 U of DSN, the fluorescence intensity increased greatly (curve d), which indicated that DSN could selectively hydrolyze DNA strands in DNA-RNA heteroduplexes, resulting in the release of AgNCs and the recovery of fluorescence signal.

Figure 2

Optimization of the Experimental Conditions. The amount and incubation time of DSN play important roles in the detection performance of the system. In order to realize complete reaction, the excess DSN of 0.1 U was used in this work. It was reported that the expression of miRNA-155 was around pM level in cell lysates, including cervical cancer cell line (HeLa), human renal cubularepithelial cell line (HK-2), and normal hepatocyte cell line (L02).14 To simulate the concentration level of real biological samples, 1.0 pM miRNA-155 was used for the optimization of incubation time. It was demonstrated that the increase in DSN incubation time from 0 9



to 80 min directly resulted in the increase in fluorescence signal. After 80 min, the signal intensity reached a plateau, which illustrated that DNA-RNA heteroduplexes could be sufficiently hydrolyzed within 80 min. Therefore, the incubation time of 80 min was selected for the experiments.

Quantitative Detection of miRNA-155. Under optimal conditions, the analytical performance of the system for quantitative detection of miRNA-155 was shown in Figure 3A. It was found that the fluorescence intensity increased dramatically along with the increase in miRNA-155 concentration from 100 fM to 1.0 nM (curves a-i). The linear range was obtained between 100 fM to 1.0 pM with a detection limit of 33.4 fM (S/N =3) (Figure 3B). In contrast to the detection performances of current fluorescent methods based on negatively charged AuNPs,38,41,47 the present strategy realized the sensitive detection of miRNA-155 without the need for the modification of DNA onto AuNPs or the separation of modified AuNPs from unmodified DNA, which markedly improved the detection efficiency.

Figure 3

Specificity and Selectivity of the System. In order to explore the specificity and selectivity of the strategy for target detection, control experiments were performed under the same conditions using mutated miRNA-155 sequences and other miRNAs including miRNA-21, miRNA-141, let-7a, and miRNA-182. As demonstrated in Figure 4A, in contrast to the fluorescence signal of blank solution without miRNA (a), an apparent increase in signal intensity was observed for single-base mutated miRNA 10


Page 10 of 26

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(b), and the fluorescence signals for two bases and three bases mutated sequences (c and d) were a little larger than that of the blank sample. However, when the proposed system was incubated with target miRNA-155, the fluorescence intensity increased remarkably (e). Besides, the coexistence of miRNA-155 with the control sequences (f) did not cause a distinct signal change compared with that of miRNA-155 alone, indicating high specificity of the system for miRNA-155 analysis. Moreover, the influences of other miRNAs on miRNA-155 detection were described in Figure 4B. It was found that no significant signal change was obtained for miRNA-21 (b), miRNA-141 (c), let-7a (d), and miRNA-182 (e) in comparison with that of blank solution (a), and the consequent interferences were negligible for miRNA-155 analysis (f and g). Such excellent selectivity of the system was attributed to the fact that only the target miRNA-155 was capable of triggering the DSN-assisted signal amplification reaction, which resulted in the continuous digestion of the DNA probe together with the recovery of fluorescence signal. In addition, the effects of other interferents on the detection performance of the system were evaluated by adding various foreign species into 1.0 pM miRNA-155 for fluorescence detection. It was revealed that common metal ions displayed almost no interference in a 1000-fold concentration (signal change < 1%), such as K+, Ca2+, Zn2+, Mg2+, Fe2+, Cu2+, Ba2+, and Mn2+. Moreover, the influences of some protein molecules which may exist in clinical samples were examined, such as BSA, thrombin, immunoglobulin G, hemoglobin, and carcinoembryonic antigen (CEA). The results exhibited that the signal changes for fluorescence detection were less than 11



5% of the original signal after the addition of the above substances in a 500-fold content.

Figure 4

Comparison of the Detection Performance. The detection performance of the present work was compared with literatures based on the assessment of sensitivity and specificity, and the results were listed in Table 2. Taking advantage of DSN-assisted target cycling, the detection of miRNA-155 was realized at femtomolar level with a detection limit of 33.4 fM, which was comparable with most reference works.4,10,16,21,48-56 Furthermore, the target miRNA-155 could be clearly discriminated from mutated sequences and other miRNAs without obvious interference from common metal ions and protein molecules, illustrating acceptable specificity of the strategy in contrast to reference methods. Therefore, the proposed system is promising for sensing applications.

Table 2

Real Sample Assays. The practical application performance of the sensing platform was verified by evaluating the expression levels of miRNA-155 in clinical serum samples, which were collected from healthy donors, lung cancer patients, and breast cancer patients in Xuzhou central hospital in Jiangsu Province, China. Prior to analysis, miRNA-155 was extracted from serum samples following the Qiagen’s instructions.44 The pretreated miRNA samples were detected three times in parallel, 12


Page 12 of 26

Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and the resulting fluorescence signals were presented in Figure 5. It was observed that the signal intensities of serum samples from two healthy donors (b and c) were similar to that of the control solution without miRNA-155 (a), revealing very low expression level of miRNA-155 in the serums of healthy donors. However, the fluorescence signals corresponding to lung cancer patients (d and e) and breast cancer patients (f and g) increased apparently compared with those of healthy donors, which suggested up regulated expression of miRNA-155 in the serums of cancer patients. The results were in good agreement with literature reports detected by nanosensor and qRT-PCR method,3,44 indicating that the proposed system provided an effective tool for the assay of endogenous miRNA in real biological samples.

Figure 5

CONCLUSIONS In conclusion, a promising sensing platform was developed for sensitive detection of miRNA-155 based on the fluorescence quenching of (+)AuNPs to AgNCs. Taking advantage of DSN-assisted target recycling signal amplification coupled with the quenching efficiency of (+)AuNPs, the detection limit of miRNA-155 was obtained to be 33.4 fM, which was relatively lower than other fluorescence-based methods reported in references. The proposed system exhibited high specificity toward target miRNA against control miRNAs, including miRNA-21, miRNA-141, let-7a, miRNA-182, and mutated miRNA-155 sequences. In addition, interference studies demonstrated that the miRNA-155 could be detected without apparent interference 13



from common metal ions and protein molecules, suggesting reliable detection in complex sample matrix. The present work implemented the evaluation of the expression levels of miRNA-155 in clinical serum samples from cancer patients and healthy donors with acceptable results. We anticipate that this work could benefit researches on biosensing and clinical assay in terms of its excellent detection performances.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (No. 21305053, 21675067), the Qing Lan project of Jiangsu Province for outstanding teachers, and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

14


Page 14 of 26

Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Lu, J.; Getz, G.; Miska, E. A.; Alvarez-Saavedra, E.; Lamb, J.; Peck, D.; Sweet-Cordero, A.; Ebert, B. L.; Mak, R. H.; Ferrando, A. A.; Downing, J. R.; Jacks, T.; Horvitz, H. R.; Golub, T. R. Nature 2005, 435, 834–838. (2) Lewis, B. P.; Shih, I.; Jones-Rhoades, M. W.; Bartel, D. P.; Burge, C. B. Cell 2003, 115, 787–798. (3) Wang, Y.; Zheng, D.; Tan, Q.; Wang, M. X.; Gu, L. Q. Nat. Nanotechnol. 2011, 6, 668–674. (4) Kong, D.; Bi, S.; Wang, Z.; Xia, J.; Zhang, F. Anal. Chem. 2016, 88, 10667–10674. (5) Yu, Y.; Chen, Z.; Shi, L.; Yang, F.; Pan, J.; Zhang, B.; Sun, D. Anal. Chem. 2014, 86, 8200–8205. (6) Ren, Y.; Deng, H.; Shen, W.; Gao, Z. Anal. Chem. 2013, 85, 4784–4789. (7) Ge, Z.; Lin, M.; Wang, P.; Pei, H.; Yan, J.; Shi, J.; Huang, Q.; He, D.; Fan, C.; Zuo, X. Anal. Chem. 2014, 86, 2124–2130. (8) Roy, S.; Soh, J. H.; Ying, J. Y. Biosens. Bioelectron. 2016, 75, 238–246. (9) Miao, P.; Wang, B.; Yu, Z.; Zhao, J.; Tang, Y. Biosens. Bioelectron. 2015, 63, 365–370. (10) Guo, Q.; Bian, F.; Liu, Y.; Qu, X.; Hu, X.; Sun, Q. Chem. Commun. 2017, 53, 4954–4957. (11) Wang, X. P.; Yin, B. C.; Wang, P.; Ye, B. C. Biosens. Bioelectron. 2013, 42, 131–135. (12) Wu, H.; Liu, Y.; Wang, H.; Wu, J.; Zhu, F.; Zou, P. Biosens. Bioelectron. 2016, 81, 303–308. (13) Wang, S.; Fu, B.; Wang, J.; Long, Y.; Zhang, X.; Peng, S.; Guo, P.; Tian, T.; Zhou, X.

15



Anal. Chem. 2014, 86, 2925–2930. (14) Zhang, P.; Wu, X.; Yuan, R.; Chai, Y. Anal. Chem. 2015, 87, 3202–3207. (15) Yu, Y. Q.; Wang, J. P.; Zhao, M.; Hong, L. R.; Chai, Y. Q.; Yuan, R.; Zhuo, Y. Biosens. Bioelectron. 2016, 77, 442–450. (16) Zhang, H.; Wang, Y.; Zhao, D.; Zeng, D.; Xia, J.; Aldalbahi, A.; Wang, C.; San, L.; Fan, C.; Zuo, X.; Mi, X. ACS Appl. Mater. Interfaces 2015, 7, 16152–16156. (17) Ge, J.; Zhang, L. L.; Liu, S. J.; Yu, R. Q.; Chu, X. Anal. Chem. 2014, 86, 1808–1815. (18) Hong, C. Y.; Chen, X.; Li, J.; Chen, J. H.; Chen, G.; Yang, H. H. Chem. Commun. 2014, 50, 3292–3295. (19) Wang, W.; Kong, T.; Zhang, D.; Zhang, J.; Cheng, G. Anal. Chem. 2015, 87, 10822–10829. (20) Jin, Z.; Geissler, D.; Qiu, X.; Wegner, K. D.; Hildebrandt, N. Angew. Chem. Int. Ed. 2015, 54, 10024–10029. (21) Yue, S.; Zhao, T.; Bi, S.; Zhang, Z. Biosens. Bioelectron. 2017, 98, 234–239. (22) Pu, F.; Huang, Z. Z.; Ren, J. S.; Qu, X. G. Anal. Chem. 2010, 82, 8211–8216. (23) Ju, E. G.; Yang, X. J.; Lin, Y. H.; Pu, F.; Ren, J. S.; Qu, X. G. Chem. Commun. 2012, 48, 11662–11664. (24) Ran, X.; Wang, Z. Z.; Zhang, Z. J.; Pu, F.; Ren, J. S.; Qu, X. G. Chem. Commun. 2016, 52, 557–560. (25) Xi, Q.; Zhou, D. M.; Kan, Y. Y.; Ge, J.; Wu, Z. K.; Yu, R. Q.; Jiang, J. H. Anal. Chem. 2014, 86, 1361–1365. (26) Yin, B. C.; Liu, Y. Q.; Ye, B. C. J. Am. Chem. Soc. 2012, 134, 5064–5067. (27) Kulcheski, F. R.; Marcelino-Guimaraes, F. C.; Nepomuceno, A. L.; Abdelnoor, R. V.;

16


Page 16 of 26

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Margis, R. Anal. Biochem. 2010, 406, 185–192. (28) Russell, C.; Welch, K.; Jarvius, J.; Cai, Y.; Brucas, R.; Nikolajeff, F.; Svedlindh, P.; Nilsson, M. ACS. Nano. 2014, 8, 1147–1153. (29) Liu, H.; Li, L.; Duan, L.; Wang, X.; Xie, Y.; Tong, L.; Wang, Q.; Tang, B. Anal. Chem. 2013, 85, 7941–7947. (30) Gao, A.; Zou, N.; Dai, P.; Lu, N.; Li, T.; Wang, Y.; Zhao, J.; Mao, H. Nano. Lett. 2013, 13, 4123–4130. (31) Tian, Q.; Wang, Y.; Deng, R.; Lin, L.; Liu, Y.; Li, J. Nanoscale 2015, 7, 987–993. (32) Yin, F.; Liu, H.; Li, Q.; Gao, X.; Yin, Y.; Liu, D. Anal. Chem. 2016, 88, 4600–4604. (33) Qiu, X.; Zhang, H.; Yu, H.; Jiang, T.; Luo, Y. Trends. Biotechnol. 2015, 33, 180–188. (34) Zhang, J.; Wu, D. Z.; Cai, S. X.; Chen, M.; Xia, Y. K.; Wu, F.; Chen, J. H. Biosens. Bioelectron. 2016, 75, 452–457. (35) Tian, B.; Ma, J.; Qiu, Z.; Zardan Gomez de la Torre, T.; Donolato, M.; Hansen, M. F.; Svedlindh, P.; Stromberg, M. ACS. Nano. 2017, 11, 1798–1806. (36) Degliangeli, F.; Kshirsagar, P.; Brunetti, V.; Pompa, P. P.; Fiammengo, R. J. Am. Chem. Soc. 2014, 136, 2264–2267. (37) Li, H.; Rothberg, L. J. Anal. Chem. 2004, 76, 5414–5417. (38) Shi, J.; Chan, C.; Pang, Y.; Ye, W.; Tian, F.; Lyu, J.; Zhang, Y.; Yang, M. Biosens. Bioelectron. 2015, 67, 595–600. (39) Xue, J.; Shan, L.; Chen, H.; Li, Y.; Zhu, H.; Deng, D.; Qian, Z.; Achilefu, S.; Gu, Y. Biosens. Bioelectron. 2013, 41, 71–77. (40) Ao, L.; Gao, F.; Pan, B.; He, R.; Cui, D. Anal. Chem. 2006, 78, 1104–1106. (41) Tu, Y.; Wu, P.; Zhang, H.; Cai, C. Chem. Commun. 2012, 48, 10718–10720.

17



(42) Lee, C. Y.; Park, K. S.; Jung, Y. K.; Park, H. G. Biosens. Bioelectron. 2017, 93, 293–297. (43) Miao, X.; Ning, X.; Li, Z.; Cheng, Z. Sci. Rep. 2016, 6, 32358. (44) Zeng, D.; Wang, Z.; Meng, Z.; Wang, P.; San, L.; Wang, W.; Aldalbahi, A.; Li, L.; Shen, J.; Mi, X. ACS Appl. Mater. Interfaces 2017, 9, 24118–24125. (45) Wen, T.; Zhang, D. X.; Liu, J.; Zhang, H. X.; Zhang, J. Chem. Commun. 2015, 51, 1353–355. (46) Sikkema, F. D.; Comellas-Aragones, M.; Fokkink, R. G.; Verduin, B. J.; Cornelissen, J. J.; Nolte, R. J. Org. Biomol. Chem. 2007, 5, 54–57. (47) Wang, B.; Chen, Y.; Wu, Y.; Weng, B.; Liu, Y.; Lu, Z.; Li, C. M.; Yu, C. Biosens. Bioelectron. 2016, 78, 23–30. (48) Azimzadeh, M.; Rahaie, M.; Nasirizadeh, N.; Naderi-Manesh, H. Anal. Methods 2015, 7, 9495–9503. (49) Wang, C.; Zhang, H.; Zeng, D.; Sun, W.; Zhang, H.; Aldalbahi, A.; Wang, Y.; San, L.; Fan, C.; Zuo, X.; Mi, X. Nanoscale 2015, 7, 15822–15829. (50) Peng, L.; Zhang, P.; Chai, Y.; Yuan, R. Anal. Chem. 2017, 89, 5036–5042. (51) Borghei, Y. S.; Hosseini, M.; Ganjali, M. R. Microchim. Acta 2017, 184, 2671–2677. (52) Wu, X.; Chai, Y.; Yuan, R.; Su, H.; Han, J. Analyst 2013, 138, 1060–1066. (53) He, Y.; Yang, X.; Yuan, R.; Chai, Y. Anal. Chem. 2017, 89, 8538–8544. (54) Hosseini, M.; Akbari, A.; Ganjali, M. R.; Dadmehr, M.; Rezayan, A. H. J. Fluoresc. 2015, 25, 925–929. (55) Zeng, K.; Li, H.; Peng, Y. Microchim. Acta 2017, 184, 2637–2644. (56) Chen, S.; Chu, L. T.; Yeung, P. P.; Zhao, Z.; Bao, Y.; Chan, M. S.; Lo, P. K.; Chen, T. H. ACS Appl. Mater. Interfaces 2015, 7, 22821–22830.

18


Page 18 of 26

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FIGURE CAPTIONS Scheme 1. (A) The formation of DNA/AgNCs and the adsorption of (+)AuNPs on DNA/AgNCs for fluorescence quenching. (B) Schematic representation for the fluorescent detection of miRNA-155 based on DSN-assisted target recycling signal amplification. Figure 1. (A) TEM image of the (+)AuNPs. (B) HR-TEM image of the (+)AuNPs. (C) DLS analysis result of the size of (+)AuNPs. (D) UV-vis absorption spectra of the (+)AuNPs (a) and the (+)AuNPs added with 50 mM NaCl (b), BSA (c), metal ions of K+, Mg2+, Ca2+ and Al3+ (d), and the mixture of them (e). Inset shows corresponding colors of the (+)AuNPs in different solutions. Figure 2. Fluorescence spectra recorded in the systems of DNA/AgNCs (a), DNA/AgNCs/(+)AuNPs

(b),

DNA/AgNCs/(+)AuNPs/miRNA-155

(c),

and

DNA/AgNCs/(+)AuNPs/miRNA-155/DSN (d). Figure 3. (A) Fluorescence spectra of the system in the presence of miRNA-155 with concentrations of 100 fM, 300 fM, 500 fM, 800 fM, 1.0 pM, 10 pM, 100 pM, 500 pM, and 1.0 nM (from a to i, respectively). (B) The relationship between the fluorescence intensity and the concentration of miRNA-155. Figure 4. (A) Specificity of the system toward blank solution (a), single-base mutated miRNA-155 (b), two bases mutated miRNA-155 (c), three bases mutated miRNA-155 (d), target miRNA-155 (e), and the mixture of them (f). (B) Specificity of the system toward blank solution (a), miRNA-21 (b), miRNA-141 (c), let-7a (d), miRNA-182 (e), 19



miRNA-155 (f), and the mixture of them (g). All the miRNA sequences were detected with a concentration of 1.0 pM. Figure 5. Fluorescence intensities for the detection of miRNA-155 in blank solution (a), the serums of healthy donors (b and c), lung cancer patients (d and e), and breast cancer patients (f and g). The error bars represent the standard deviations for three independent measurements.

20


Page 20 of 26

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1

Figure 1 21



Figure 2

Figure 3

22


Page 22 of 26

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4

Figure 5

23



Table 1. Sequence Information for the Nucleic Acids in This Work.

Name

Sequence (5’-3’)

miRNA-155

UUAAUGCUAAUCGUGAUAGGGGU

miRNA-155-1M a

UUAAGGCUAAUCGUGAUAGGGGU

miRNA-155-2M b

UUAAGGCUAAUAGUGAUAGGGGU

miRNA-155-3M c

UUAAGGCUAAUAGUGAUAUGGGU

miRNA-21

UAGCUUAUCAGACUGAUGUUGA

miRNA-141

UAACACUGUCUGGUAAAGAUGG

let-7a

UGAGGUAGUAGGUUGUAUAGUU

miRNA-182

UUUGGCAAUGGUAGAACUCACACU

c-DNA-155

CCCCCCCCCCCCCACCCCTATCACGATTAGCATTAA

a

miRNA-155-1M: single-base mutated miRNA-155;

b

miRNA-155-2M: two bases mutated miRNA-155;

c

miRNA-155-3M: three bases mutated miRNA-155.

24


Page 24 of 26

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47


Table 2. Comparison of the Sensitivity and Specificity of Different Detection Methods for the Assay of miRNA-155.

Detection method

Detection limit

Specificity (good selectivity toward miRNA-155 against the following controls)

Reference

Electrochemical detection

5.2 pM

let-7a and one-base mismatched miRNA sequence

4

Colorimetric detection

70 fM

single-base mismatched miRNA sequence, miRNA-21, and miRNA-373

10

FRET a

100 pM

miRNA-21, miRNA-210, and miRNA-196a

16

Chemiluminescent imaging

7.6 fM

miRNA-141, let-7a, and single-base mismatched miRNA sequence

21

Electrochemical biosensor

13.5 pM

miRNA-21 and one-base mismatched target

48

Diblock nanoprobe

10 pM

miRNA-196a, miRNA-21, and miRNA-210

49

Electrochemiluminescence

1.67 fM

p53 gene, oral cancer gene, miRNA-199, and miRNA-182-5p

50

Fluorescent detection

11 pM

two-base mismatched and non-complementary miRNA sequences

51

Amperometric biosensor

1.87 pM

thrombin aptamer (TBA) and PDGF binding aptamer (PBA)

52

SERS b

83 aM

miRNA-21, miRNA-141, and one-base mismatched DNA

53

Fluorescent detection

0.1 nM

two-base mismatched and non-complementary targets

54

Surface plasmon resonance

45 pM

miRNA-21, single-base and double-base mismatched miRNA sequences

55

Visual detection

1.67 pM

single-base mismatched targets

56

Fluorescent sensing

33.4 fM

miRNA-21, miRNA-141, let-7a, miRNA-182, single-base, two bases and three

This work

bases mismatched miRNA sequences a

FRET: Fluorescence resonance energy transfer; b SERS: Surface-enhanced Raman spectroscopy. 25



For TOC only

A promising sensing platform was developed for highly sensitive detection of miRNA-155 based on the fluorescence quenching of positively charged gold nanoparticles to Ag nanoclusters coupled with DSN-assisted signal amplification.

26


Page 26 of 26

Label-Free Platform for MicroRNA Detection Based on the

Recommend Documents