Label-Free Sensing of Human 8-Oxoguanine DNA Glycosylase

Jan 24, 2018 - Human 8-oxoguanine DNA glycosylase (hOGG1) plays a significant role in ..... of hOGG1 activity; Detection of the A549 cell extracts (PD...
0 downloads 0 Views 2MB Size
Download PDF
Article Cite This: ACS Sens. 2018, 3, 512−518

pubs.acs.org/acssensors

Label-Free Sensing of Human 8‑Oxoguanine DNA Glycosylase Activity with a Nanopore Jizhen Shang,†,‡ Zhi Li,† Liping Liu,† Dongmei Xi,*,† and Hua Wang*,‡ †

Shandong Provincial Key Laboratory of Detection Technology for Tumor Makers, College of Chemistry and Chemical Engineering, Linyi University, Linyi 276005, P. R. China ‡ Institute of Medicine and Materials Application Technologies, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu 273165, P. R. China S Supporting Information *

ABSTRACT: Human 8-oxoguanine DNA glycosylase (hOGG1) plays a significant role in maintaining the genomic integrity of living organisms for its capability of repairing DNA lesions. Accurate detection of hOGG1 activity would greatly facilitate the screening and early diagnosis of diseases. In this work, we report a nanopore-based sensing strategy to probe the hOGG1 activity by employing the enzyme−catalytic cleavage reaction of DNA substrate. The hOGG1 specifically catalyzed the removal of the 8-hydroxyguanine (8-oxoG) and cleaved the DNA substrates immobilized on magnetic beads, thereby releasing the output DNA which would quantitatively produce the signature current events when subjected to α-hemolysin (α-HL) nanopore test. The approach enables the sensitive detection of hOGG1 activity without the need of any labeling or signal amplification route. Furthermore, the method can be applied to assay the inhibition of hOGG1 and evaluate the activity of endogenous hOGG1 in crude cell extracts. Importantly, since DNAs with specific sequences are the catalytic substrates of a wide variety of enzymes, the proposed strategy should be universally applicable for probing the activities of different types of enzymes with nanopore sensors. KEYWORDS: nanopore sensor, hOGG1, enzyme-catalytic cleavage reaction, DNA substrate, 8-oxoguanine

F

Parkinson’s disease.9 Therefore, the accurate and sensitive detection of hOGG1 activity is highly desired in biochemical research and clinical diagnosis. Conventional methods for hOGG1 assay include radioactive labeling,10 gel electrophoresis,11 high-performance liquid chromatography (HPLC),12 and liquid chromatography/ isotope-dilution tandem mass spectrometry (LC-MS/MS).13 Although these methods are efficient to some degree, they generally suffer from the intrinsic drawbacks like the potential radioactive hazards, sophisticated instruments, and timeconsuming with low sensitivity. To overcome these limitations, new strategies including colorimetric14,15 and fluorescent methods16−18 have been developed recently. While the colorimetric assay enables the visualized detection of DNA glycosylase and the fluorescent methods enables sensitive measurement of hOGG1 activity, they involve tedious labeling, careful design of probes, or complicated enzymatic cycling amplification. Nanopores have proven to be an attractive, powerful, and sensitive platform for the single-molecule analysis.19,20 The principle of nanopore sensing is that an analyte modulates the

aithful maintenance of the genomic integrity is critical for all living organisms.1 However, damage to the DNA constantly occurs, either as a byproduct of normal cellular metabolism or as a result of exposure to environmental and endogenous mutagens.2 One of the most common forms of DNA damage is the oxidation of guanine (G) to the 8hydroxyguanine (8-oxoG) caused by exposure to intracellular reactive oxygen species (ROS).3 The formed 8-oxoG can mimic a thymine (T) base during DNA replication and therefore prefers base-pairing with an adenine (A), thus inducing G:C to A:T transversion mutation, which is closely related to human diseases.2 Base excision repair (BER) is the primary defense mechanism that responds to oxidative DNA damage.4,5 In humans, the dedicated BER enzyme responsible for repairing 8oxoG is 8-oxoguanine DNA glycosylase (hOGG1), which recognizes oxoG:C base pairs, drives out the oxoG base, and then cleaves the DNA backbone.2 The hOGG1 is a bifunctional BER enzyme with DNA N-glycosylase-abasic apurinic/apyrimidinic (AP) lyase activity. The DNA glycosylase hydrolyzes the N-glycosidic bond between the deoxyribose ring and the damaged base, releasing the damaged base to form an AP site. Then the AP site is cleaved by the AP lyase, generating a single nucleotide gap.6 The abnormal level of hOGG1 may cause the malfunction of base excision repair and eventually various diseases, including lung cancer, 7 bladder cancer,8 and © 2018 American Chemical Society

Received: December 20, 2017 Accepted: January 24, 2018 Published: January 24, 2018 512

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors Table 1. Sequences of the Oligonucleotidesa

ionic current as it binds or translocates an isolated nanopore.21 Nanopore technique has been explored to detect a range of analytes including metal ions,22,23 PEG polymer,24 cocaine,25−27 DNA,28−30 microRNA,31−33 peptides,34 and proteins,35,36 analyze enzymatic hydrolysis of polynucleotide,21 and probe the enzyme kinetics of trypsin37 and the protease activity.38 In addition, nanopores exhibit excellent capability for studying complex molecular interactions, revealing the intrinsic dynamic function of a single molecule and even analyzing clinical samples.20,39−42 All these advancements indicate that the nanopore technique holds great potential for wider applications. To enable an effective detection of hOGG1 activity, a sensitive nanopore sensor is critically important. In this report, we have developed a facile and sensitive strategy to probe the hOGG1 activity with α-hemolysin (α-HL) nanopore by employing the enzyme-catalytic cleavage reaction of DNA substrate (Scheme 1). A probe of double-stranded

Sequence (5′→ 3′)

P1 P2

ACGACAGAGTAGGATTCTCGACC30 GTCGAGAATCCTACTCT/oxoG/TCGTT20-biotin

a In P2, oxoG indicates the guanine modified with 8-oxoG. Bold letters indicate the P2R sequence. Italic letters indicate the P2L sequence.

were of analytical grade unless otherwise indicated. All solutions for analytical studies were prepared with ultrapure water. Reaction Process of hOGG1. First, all oligonucleotides were diluted with the buffer (150 mM NaCl, 20 mM Tris-HCl, pH 7.9) to prepare the stocks (10−5 M). The double-stranded DNA (dsDNA, 4 μM) substrates were prepared by incubating P1 and P2 at desired concentrations at 95 °C for 5 min, followed by gradually cooling to room temperature. Meanwhile, magnetic bead (MB) suspension (50 μL, 10 mg/mL) was washed three times with 1 mL 1× BW buffer (1 M NaCl, 1 mM EDTA, 10 mM Tris-HCl, pH 7.5). Next, 25 μL DNA substrates (4 μM) and 25 μL water were mixed with MBs in 50 μL 2× BW buffer, and vortexed for 15 min. The suspension was decanted after MBs were concentrated with a magnet. The MBs were washed for three times with 0.5 mL 1× BW buffer. Finally, the hOGG1 assay was carried out in 100 μL of reaction mixtures containing the beadDNA substrates (1 μM), 1× NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9), 100 μg/mL BSA, and variable-concentration hOGG1 at 37 °C for 2 h with occasional vortexing. After incubation, the supernatant was collected with the aid of a magnet and heated to 65 °C for 15 min to deactivate the enzyme activity. The MBs were washed with deionized water. The obtained sample was ready for nanopore analysis. Gel Electrophoresis Assay. The dsDNA substrates were prepared by incubating equal P1 and P2 at desired concentrations at 95 °C for 5 min, followed by gradually cooling to room temperature. The hOGG1 assay was carried out in 60 μL of reaction mixtures containing the dsDNA substrates (2 μM), 1× NEB buffer 2, 100 μg/mL BSA, and hOGG1 at 37 °C for 2 h. The products of hOGG1 catalysis reaction were analyzed with 15% denaturating polyacrylamide gel electrophoresis (PAGE) in 1× TBE buffer (9 mM Tris-HCl, pH 7.9, 9 mM boric acid, 0.2 mM EDTA) at a 120 V constant voltage for 90 min at room temperature. The gel was stained with ethidium bromide (EB) and visualized by Gel Image Analyzing System (WD-9413B, Beijing, China). Effect of Temperature on the hOGG1 Activity. The hOGG1 assay mixture was incubated with 50 U/mL hOGG1 at different temperatures in a range from 4 to 55 °C for 2 h. The hOGG1 activity was detected using the nanopore-based assay. Inhibition Assay. Variable-concentration CdCl2 was incubated with 100 U/mL hOGG1 and 1 μM DNA substrate at 37 °C for 2 h. The hOGG1 activity was detected using the nanopore-based assay. Cell Culture and Preparation of Cell Extracts. Human lung adenocarcinoma cells (A549 cells) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin−streptomycin. The cells were incubated at 37 °C in a humidified chamber with 5% CO2. The cells in the exponential phase of growth were collected and digested with trypsinization, washed twice with ice-cold PBS (137 mM NaCl, 2.68 mM KCl, 10 mM phosphate buffer, pH 7.4), and centrifuged at 1000 rpm for 5 min at 4 °C. For preparation of protein sample, the cells were redispersed with 20-fold diluted PBS solution, followed by lysing with ice−water bath for 30 min. Then the lysed cells were centrifuged at 12 000 rpm for 10 min, and the supernatant was used for the hOGG1 activity assay. Nanopore Electrical Recording and Data Analysis. The nanopore electrical recording was conducted according to our previous report.32 The lipid bilayer membrane was formed spanning a 50 μm orifice in a Delrin bilayer cup (Warner Instruments, Hamden, CT) that was partitioned into two chambers, cis and trans. Both chambers were filled with 1 mL of buffer (cis: 0.5 M KCl, 10 mM Tris-HCl, 1 mM EDTA, pH 7.8; trans: 3 M KCl, 10 mM Tris-HCl, 1 mM EDTA, pH 7.8). DNA samples were then added into the cis chamber.

Scheme 1. Schematic Illustration of the Nanopore-Based Assay for the Detection of hOGG1 Activitya

a Target hOGG1 specifically recognized the damaged 8-oxoG in the DNA substrate immobilized on magnetic bead surface and catalytically cleaved the DNA duplex, releasing the DNA hybrids of P1/P2R. After the separation using a magnetic field, the P1/P2R hybrids quantitatively produced the signature current events when subjected to the α-HL nanopore analysis.

DNA (dsDNA) modified with an 8-oxoG was designed to act as the substrate of the enzyme. The target hOGG1 would specifically remove the 8-oxoG and cleave the DNA substrate, releasing an output DNA hybrid which can quantitatively produce the signature current events when subjected to the nanopore test. This approach exhibits the excellent specificity and high sensitivity without the need of any labeling or signal amplification, which can be further applied for the detection of the activity of endogenous hOGG1 in cell extracts.

■

Name

EXPERIMENTAL SECTION

Reagents and Chemicals. α-Hemolysin (α-HL, lyophilized powder, from Staphylococcus aureus) and decane (anhydrous, ≥99%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). 1,2Diphytanoyl-sn-glycero-3-phosphocholine (chloroform, ≥99%) was purchased from Avanti Polar Lipids Inc. (Alabaster, AL, USA). Human 8-oxoguanine-DNA glycosylase (hOGG1), bovine serum albumin (BSA), uracil-DNA glycosylase (UDG), and apurinic/apyrimidinic endonuclease (APE1) were obtained from New England Biolabs (Ipswich, MA, U.S.A.). Thymine DNA glycosylase (TDG) was purchased from R&D System (Minneapolis, MN, USA). Dynabeads MyOne Streptavidin T1 (10 mg/mL, (7−12) × 109 beads/mL; beads diameter: 1.0 μm, supplied in PBS; pH 7.4/0.1% BSA/0.02% sodium azide) was obtained from Invitrogen (California, U.S.A.). The oligonucleotides (Table 1) were synthesized and HPLC-purified by Sangon Biotech Co. Ltd. (Shanghai, China). All of the other chemicals 513

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors

generated ∼12 events per min (Figure S2). The salt gradients focused far more molecules into the pore, thereby enhancing the possibility of analyzing DNA samples at the low level. Next, we statistically analyzed the current signals produced by P1/P2R hybrids. Figure 1A illustrates the current trace for

Furthermore, the current trace was recorded with an Axopatch 200B (Axon Instruments, Forest City, CA, USA) and then digitized with a DigiData 1440A converter (Axon Instruments, Forest City, CA, USA). The preliminary experiments were performed on Cube-D0 Nanopore Single Molecule Electrochemical workstation which is established by Yi-Tao Long’s group at East China University of Science and Technology. The filtration and sampling rate were set as 10 kHz and 250 kHz in Cube-D0, respectively. Data analysis was performed using the software programmed by Long’s group43 and OriginLab 9.0 (OriginLab Corporation, Northampton, MA, USA). Nanopore measurements were carried out at 25 ± 2 °C. The frequency of the events was calculated from the data of at least 5 min.

■

RESULTS AND DISCUSSION Principle of the Nanopore-Based Assay for Enzyme Activity. The nanopore-based sensing strategy was proposed by the specifically catalytic removal of 8-oxoG and cleavage of DNA backbone by hOGG1, of which the yielded DNA hybrids were subsequently analyzed with a nanopore. As illustrated in Scheme 1, a probe of DNA substrate containing two partially complementary strands (i.e., P1 and P2) was immobilized onto the magnetic beads via the biotin−streptavidin interaction. The P2 strand was modified with an 8-oxoG at the 18 nt site comprising of P2L conjugated with P2R (Table 1). Since the probe is too large to enter the nanopore, no translocation events could be observed when subjected to the nanopore tests. In the presence of hOGG1, however, the enzyme would specifically recognize and remove the 8-oxoG, yielding a singlestranded DNA (ssDNA) attached on the bead surface and a free P1/P2R hybrid. After the separation with a magnetic field, the output P1/P2R hybrid was subjected to the α-HL nanopore test. The noncomplementary domain in the P1/P2R complex would act as a guide to lead the complex to enter the vestibule of the nanopore, which could be envisioned to generate characteristic current events. Validation of the hOGG1 Activity Assay. The proposed assay was dependent on the successful recognition and removal of 8-oxoG by the hOGG1 catalysis and subsequent release of P1/P2R hybrids. To verify whether hOGG1 initiates the reaction, we first monitored the cleavage products with gel electrophoresis. The free P1/P2 complex without immobilization onto the bead was used as the substrate. As shown in Figure S1, in the absence of hOGG1, only one band of the DNA substrate was observed. After the incubation with hOGG1, in contrast, a new band obviously shorter than the substrate appeared. This is supposed to be P1/P2R hybrid resulting from the cleavage reaction. Herein, ssDNA that should be produced is not observed. The most likely possibility is that this ssDNA could not form secondary structure and thus binds too little ethidium bromide to be detected in gel electrophoresis. These data confirm the occurrence of the cleavage reaction of DNA substrates by hOGG1. Nanopore-Based Analysis of hOGG1 Activity. To identify the target signals in the nanopore, we used the P1/ P2R hybrids to examine the signature blocks, which can serve as the signals for the identification of hOGG1. A salt gradient across a nanopore was applied to drive the DNA from the cis side into the α-HL nanopore. It was previously reported that this method dramatically increased the capture rate of DNA44 and miRNA.45 Here, the event frequencies of the P1/P2R hybrids in different salt conditions were tested. At an applied potential of +120 mV, 20 nM of the DNA in asymmetrical KCl solutions (0.5 M/3 M, cis/trans) produced ∼150 events per min, whereas 100 nM of the DNA in 1 M KCl (cis/trans) only

Figure 1. Detection of P1/P2R hybrids with the nanopore. (A) Current trace, (B) Contour plot, (C) Duration histogram, and (D) I/ I0 histogram of P1/P2R hybrids monitored at +120 mV in 0.5 M/3 M (cis/trans) KCl. The concentration of P1/P2R in the cis side of the nanopore was 20 nM. Red triangles represent the signature events. The duration histogram was fitted by the exponential function, and the I/I0 histogram was fitted by the Gauss function.

the P1/P2R in 0.5 M/3 M (cis/trans) KCl solutions. As expected, we observed a large number of moderately long single-level events. The 2D event-distribution contour plot (Figure 1B) indicates that the current events yield one population, with the duration time lying within the range of 1−15 ms. The statistical analysis showed that the duration of theses blocks is 3.572 ± 0.23 ms (Figure 1C). For current amplitude analysis, I0 was defined as the open pore current and I as the blockage current when the analyte stayed within the pore. The histogram of I/I0 was fitted to the Gauss distribution with a value of 0.86 ± 0.01 (Figure 1D). Other than the singlelevel events, multilevel blocks featuring conductance transition appeared occasionally in the current trace (Figure S3). Since the moderately long blocks with current blockage over 80% and dwell time within the range of 1−15 ms were only observed in the presence of P1/P2R complex, they could serve as the signals for the identification of hOGG1. In addition, the capture rate of the DNA in the α-HL nanopore would be highly dependent on the applied voltage.46 As the voltage increased, the frequency of P1/P2R signature events consistently increased (Figure S4). Considering the signal discrimination, the event frequency, and fluency of the data recording, +120 mV was adopted as the standard potential in the following work. With the designed probe, the nanopore-based assay was employed for the evaluation of the hOGG1 activity. As illustrated in Figure 2A, in the control experiment without addition of hOGG1, only several noise-like block events appeared in the current trace, probably due to the collisions between the reagents in the reaction mixture and the entrance of the nanopore. In the presence of hOGG1, on the contrary, we observed a number of signature blocks which were easily 514

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors

Figure 3. Quantitative determination of hOGG1 activity. Correlation of the event frequency with the concentration of hOGG1 was shown. The target concentration ranges between 0 and 50 U/mL and the concentration of DNA substrate is 1 μM. All tests were performed with the transmembrane potential held at +120 mV. Each experiment was repeated three times.

Figure 2. Detection of hOGG1 activity with the nanopore. (A) Representative current traces for the nanopore in the absence (Blank) and presence of hOGG1 recorded at +120 mV. The concentration of hOGG1 is 50 U/mL and the concentration of DNA substrate is 1 μM. (B) Duration histogram of the blocks generated by hOGG1 reaction products. (C) I/I0 histogram of the blocks produced by hOGG1 reaction products.

protein BSA and some other repairing enzymes were detected comparably including uracil-DNA glycosylase (UDG), thymine DNA glycosylase (TDG), and apurinic/apyrimidinic endonuclease (APE1). Generally, UDG could specifically recognize and excise uracil (U) from DNA.47 TDG only selectively removed T from G/T mismatches.48 APE1 recognized AP sites in dsDNA and performed an incision at the 5′ side of the AP site.49 As illustrated in Figure 4A, the addition of hOGG1 generated a number of signature blocks in the current trace. In contrast, the nonspecific protein and nontarget enzymes produced scarcely any moderately long blocks, similar to that in the absence of hOGG1 (blank). The frequency in the interferential groups is almost as low as in the blank (Figure 4B). Thus, the strategy exhibited the excellent performances for discriminating hOGG1 from the interfering analytes. Effect of Temperature on the hOGG1 Activity. To investigate the effect of temperature on the enzyme activity, hOGG1 was treated at different temperatures in a range from 4 to 55 °C and its activity was analyzed using the nanopore-based assay. As shown in Figure S8, the frequency of the signature current events increased with increasing temperature, reached a maximum level at 37 °C, and then gradually declined at higher temperatures. This is expected given that the hOGG1 is involved in the biochemical reaction in human, whose optimum temperature is about 37 °C. These data indicate that the nanopore assay could be used to evaluate the effect of temperature on the enzyme activity. Inhibition Assay. The validity of our method in assaying the inhibition of hOGG1 was tested by using chromium(II) chloride (CdCl2) as a model inhibitor. The CdCl2 may inhibit hOGG1 activity in two ways. Cd2+ may bind to the enzyme molecules and lead to the inactivation of hOGG1, or bind to the enzyme−substrate complex to prevent the cleavage of substrates.50 As shown in Figure 5 and Figure S9, the frequency of the characteristic events decreased when the CdCl 2 concentration increased. These facts indicate that the proposed assay may provide a useful platform for the evaluation of hOGG1 activity. Evaluation of Cellular hOGG1 Activity. To further evaluate the feasibility of the nanopore-based assay in real biological samples, the activity of the cellular hOGG1 was detected using human lung adenocarcinoma cell line (A549 cells) as a model. We first investigated the effect of cell extract

discriminated from the noise-like events. Their properties, including the duration (Figure 2B) and current amplitude (Figure 2C) obtained statistically, were consistent with that of the spiked free P1/P2R sample. These results confirm the existence of the released P1/P2R hybrids and thus a successful recognition and removal of 8-oxoG by hOGG1 catalysis. Detection Sensitivity of the Nanopore-Based Assay. Achieving the best sensing performance requires the optimization of the experimental conditions. The concentration of the DNA substrates immobilized on the bead surface is an important factor. We found that as the DNA substrate concentration increased, the frequency of the output events in the nanopore increased and reached a plateau beyond 1 μM (Figure S5). Additionally, the reaction time is a crucial parameter for the hOGG1-catalyzed assay. Figure S6 shows that the frequency of the signatures gradually increased with the increasing time and tended to be stable after 2 h. Accordingly, 2 h was selected as the incubation time for the following reactions. Under the optimal conditions, the assay was applied as proposed to detect hOGG1 of different concentrations. As separately shown in Figure 3 and Figure S7, the frequency of signature events consistently increased with the increasing hOGG1 concentrations ranging from 0.01 U/mL to 50 U/mL. These data can be fitted to a straight line in the log−log scale, showing that the target should be detectable at the concentrations lower than 0.01 U/mL. The linear relationship can be described as the function log f = 0.562 + 0.463 log C (R2 = 0.993), where f is the frequency of signature events and C represents the hOGG1 concentration. The limit of detection (LOD) was calculated to be 6.5 × 10−3 U/mL based on the principle of 3 times the standard deviation over the signal of the negative control. The sensitivity of the current assay was improved by 107.7-fold over that of the gold nanoparticle (AuNP)-based colorimetric method (0.7 U/mL),14 and is comparable to that of the fluorescent assays.16−18 The high sensitivity is likely attributed to the use of asymmetrical KCl solutions in the nanopore assays. Detection Specificity of the Nanopore-Based Assay. To assess the specificity of the proposed strategy, a nonspecific 515

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors

cell extracts and the entrance of the α-HL nanopore. Fortunately, the noise-like events were easily discriminated from the signature events based on their duration time (Figure S10B,D) and current amplitude (Figure S10C, D). Next, the activity of endogenous hOGG1 from different amounts of A549 cells was analyzed. As illustrated in Figure 6A and B, the

Figure 4. Investigation of the specificity of the assay. (A) Representative current traces in the presence of hOGG1, BSA, UDG, TDG, and APE1. In the blank group, all reagents and assay processes were the same as that in hOGG1 assay, except that there was no target. Red triangles represent the signature events. (B) Comparison of the frequency of signature events generated by hOGG1 and other proteins or enzymes. The final concentration of the enzyme analytes is 10 U/mL, the concentration of BSA is 0.1 g/L, and the concentration of DNA substrate is 1 μM. All data were acquired at the potential of +120 mV.

Figure 6. Detection of cellular hOGG1 activity. (A) Representative current traces of the events in the presence of A549 cell extracts. Red triangles represent the signature events. (B) Relationship between the frequency of the signature events and the number of A549 cells. The concentration of DNA substrate is 1 μM. All data were acquired with the transmembrane potential at +120 mV. Each experiment was repeated three times.

frequency of the hOGG1 signatures consistently increased when the number of A549 cells increased, with a linear correlation in the log−log scale in the range from 100 to 10 000 cells. Furthermore, based on the standard working curve of event frequency versus hOGG1 concentration (Figure 3) and the frequency of cell extract reaction products, the unit number of hOGG1 in 100 cells was estimated to be 0.81 U/mL. This was basically consistent with that obtained using fluorescence method.16 Therefore, the developed approach can be practically applied for quantitative detection of hOGG1 activity in complex biological samples.

■

Figure 5. Variance of the hOGG1 activity in response to variableconcentration CdCl2. The concentration of hOGG1 is 100 U/mL and the concentration of DNA substrate is 1 μM. Error bars represent standard deviations from three replicates.

CONCLUSION In summary, we have developed a nanopore-based strategy for the evaluation of hOGG1 activity with high specificity and sensitivity. Taking advantage of the efficient cleavage of the DNA probe by hOGG1 catalysis, the information on enzyme activity was converted to a measurable current signal recorded

itself on the target detection. As illustrated in Figure S10A, the cell extract without hOGG1 only produced several noise-like events, which are probably due to the collisions between the 516

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors in the α-HL nanopore. To the best of our knowledge, it is the first time to realize the sensitive detection of DNA glycosylase activity with the nanopore sensor. Compared with the reported methods, this nanopore-based assay facilitates a label-free and facile detection without the requirement for any complicated signal amplification, thus opening a new horizon for the analysis of enzyme activity. More importantly, considering that the DNA molecules are the catalyzed substrates of a variety of enzymes, this sensing approach can be easily extended to the detection of different types of enzymes, such as other DNA glycosylases, DNA repairing enzymes, and DNA methyltransferases, by designing various DNA substrates.

■

Functional and Epidemiologic Literature. Mol. Carcinog. 2005, 42 (3), 127−141. (7) Paz-Elizur, T. DNA Repair Activity for Oxidative Damage and Risk of Lung Cancer. J. Natl. Cancer Inst. 2003, 95 (17), 1312−1319. (8) Ma, L.; Chu, H.; Wang, M.; Shi, D.; Zhong, D.; Li, P.; Tong, N.; Yin, C.; Zhang, Z. Hogg1 Ser326cys Polymorphism Is Associated with Risk of Bladder Cancer in a Chinese Population: A Case-Control Study. Cancer Sci. 2012, 103 (7), 1215−1220. (9) Fukae, J.; Takanashi, M.; Kubo, S.; Nishioka, K.; Nakabeppu, Y.; Mori, H.; Mizuno, Y.; Hattori, N. Expression of 8-Oxoguanine DNA Glycosylase (Ogg1) in Parkinson’s Disease and Related Neurodegenerative Disorders. Acta Neuropathol. 2005, 109 (3), 256−262. (10) Grin, I. R.; Konorovsky, P. G.; Nevinsky, G. A.; Zharkov, D. O. Heavy Metal Ions Affect the Activity of DNA Glycosylases of the Fpg Family. Biochemistry (Moscow) 2009, 74 (11), 1253−1259. (11) Dianov, G. L. Monitoring Base Excision Repair by in Vitro Assays. Toxicology 2003, 193 (1−2), 35−41. (12) Gackowski, D.; Speina, E.; Zielinska, M.; Kowalewski, J.; Rozalski, R.; Siomek, A.; Paciorek, T.; Tudek, B.; Olinski, R. Products of Oxidative DNA Damage and Repair as Possible Biomarkers of Susceptibility to Lung Cancer. Cancer Res. 2003, 63 (16), 4899−4902. (13) Dizdaroglu, M.; Reddy, P. T.; Jaruga, P. Identification and Quantification of DNA Repair Proteins by Liquid Chromatography/ Isotope-Dilution Tandem Mass Spectrometry Using Their Fully 15nLabeled Analogues as Internal Standards. J. Proteome Res. 2011, 10 (8), 3802−3813. (14) Wu, Z.; Wu, Z. K.; Tang, H.; Tang, L. J.; Jiang, J. H. ActivityBased DNA-Gold Nanoparticle Probe as Colorimetric Biosensor for DNA Methyltransferase/Glycosylase Assay. Anal. Chem. 2013, 85 (9), 4376−4383. (15) Yuan, F.; Zhao, H. M.; Liu, M.; Quan, X. Visible Assay for Glycosylase Based on Intrinsic Catalytic Ability of Graphene/Gold Nanoparticles Hybrids. Biosens. Bioelectron. 2015, 68, 7−13. (16) Wang, L. J.; Ma, F.; Tang, B.; Zhang, C. Y. Base-ExcisionRepair-Induced Construction of a Single Quantum-Dot-Based Sensor for Sensitive Detection of DNA Glycosylase Activity. Anal. Chem. 2016, 88 (15), 7523−7529. (17) Kong, X. J.; Wu, S.; Cen, Y.; Yu, R. Q.; Chu, X. ″Light-up″ Sensing of Human 8-Oxoguanine DNA Glycosylase Activity by Target-Induced Autocatalytic Dnazyme-Generated Rolling Circle Amplification. Biosens. Bioelectron. 2016, 79, 679−684. (18) Wang, X.; Hou, T.; Lu, T.; Li, F. Autonomous Exonuclease IiiAssisted Isothermal Cycling Signal Amplification: A Facile and Highly Sensitive Fluorescence DNA Glycosylase Activity Assay. Anal. Chem. 2014, 86 (19), 9626−9631. (19) Liu, L.; Wu, H.-C. DNA-Based Nanopore Sensing. Angew. Chem., Int. Ed. 2016, 55 (49), 15216−15222. (20) Ying, Y.-L.; Zhang, J.; Gao, R.; Long, Y.-T. Nanopore-Based Sequencing and Detection of Nucleic Acids. Angew. Chem., Int. Ed. 2013, 52 (50), 13154−13161. (21) Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W. Characterization of Individual Polynucleotide Molecules Using a Membrane Channel. Proc. Natl. Acad. Sci. U. S. A. 1996, 93 (24), 13770−13773. (22) Wen, S.; Zeng, T.; Liu, L.; Zhao, K.; Zhao, Y.; Liu, X.; Wu, H. C. Highly Sensitive and Selective DNA-Based Detection of Mercury(Ii) with Alpha-Hemolysin Nanopore. J. Am. Chem. Soc. 2011, 133 (45), 18312−18317. (23) Braha, O.; Gu, L. Q.; Zhou, L.; Lu, X. F.; Cheley, S.; Bayley, H. Simultaneous Stochastic Sensing of Divalent Metal Ions. Nat. Biotechnol. 2000, 18 (9), 1005−1007. (24) Balijepalli, A.; Robertson, J. W.; Reiner, J. E.; Kasianowicz, J. J.; Pastor, R. W. Theory of Polymer-Nanopore Interactions Refined Using Molecular Dynamics Simulations. J. Am. Chem. Soc. 2013, 135 (18), 7064−7072. (25) Kawano, R.; Osaki, T.; Sasaki, H.; Takinoue, M.; Yoshizawa, S.; Takeuchi, S. Rapid Detection of a Cocaine-Binding Aptamer Using Biological Nanopores on a Chip. J. Am. Chem. Soc. 2011, 133 (22), 8474−8477.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssensors.7b00954. Gel electrophoresis analysis of the reaction products; Comparison of the frequency of P1/P2R events; Current trace for the P1/P2R hybrids and a multi-level block; Dependence of the event frequency on the applied potential, concentrations of DNA substrates, the reaction time, temperature and inhibitor; Quantitative determination of hOGG1 activity; Detection of the A549 cell extracts (PDF)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. ORCID

Dongmei Xi: 0000-0002-4639-6552 Hua Wang: 0000-0003-0728-8986 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (21405073, 21535002), the “Innovation Team Development Plan” of the Ministry of Education Rolling Support (IRT_15R31), Special Funds for the Construction of Taishan Scholars (No. tspd20150209), and the Open Funds of the State Key Laboratory of Electroanalytical Chemistry (SKLEAC201502). We thank Prof. Yi-Tao Long’s help for establishing the Nanopore Instrument and data analysis and providing the data analysis software.

■

REFERENCES

(1) Scharer, O. D. Chemistry and Biology of DNA Repair. Angew. Chem., Int. Ed. 2003, 42 (26), 2946−2974. (2) David, S. S.; O’Shea, V. L.; Kundu, S. Base-Excision Repair of Oxidative DNA Damage. Nature 2007, 447 (7147), 941−950. (3) Friedberg, E. C. DNA Damage and Repair. Nature 2003, 421 (6921), 436−440. (4) Hung, R. J.; Hall, J.; Brennan, P.; Boffetta, P. Genetic Polymorphisms in the Base Excision Repair Pathway and Cancer Risk: A Huge Review. Am. J. Epidemiol. 2005, 162 (10), 925−942. (5) Sadeghian, K.; Ochsenfeld, C. Unraveling the Base Excision Repair Mechanism of Human DNA Glycosylase. J. Am. Chem. Soc. 2015, 137 (31), 9824−9831. (6) Weiss, J. M.; Goode, E. L.; Ladiges, W. C.; Ulrich, C. M. Polymorphic Variation in Hogg1 and Risk of Cancer: A Review of the 517

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518

Article

ACS Sensors (26) Li, T.; Liu, L.; Li, Y.; Xie, J.; Wu, H. C. A Universal Strategy for Aptamer-Based Nanopore Sensing through Host-Guest Interactions inside Alpha-Hemolysin. Angew. Chem., Int. Ed. 2015, 54 (26), 7568− 7571. (27) Rauf, S.; Zhang, L.; Ali, A.; Liu, Y.; Li, J. Label-Free Nanopore Biosensor for Rapid and Highly Sensitive Cocaine Detection in Complex Biological Fluids. ACS Sens. 2017, 2 (2), 227−234. (28) Duan, R.; Lou, X.; Xia, F. The Development of Nanostructure Assisted Isothermal Amplification in Biosensors. Chem. Soc. Rev. 2016, 45 (6), 1738−1749. (29) Liu, N.; Jiang, Y.; Zhou, Y.; Xia, F.; Guo, W.; Jiang, L. Two-Way Nanopore Sensing of Sequence-Specific Oligonucleotides and SmallMolecule Targets in Complex Matrices Using Integrated DNA Supersandwich Structures. Angew. Chem., Int. Ed. 2013, 52 (7), 2007−2011. (30) Tian, K.; Decker, K.; Aksimentiev, A.; Gu, L. Q. InterferenceFree Detection of Genetic Biomarkers Using Synthetic DipoleFacilitated Nanopore Dielectrophoresis. ACS Nano 2017, 11 (2), 1204−1213. (31) Wang, Y.; Zheng, D.; Tan, Q.; Wang, M. X.; Gu, L. Q. Nanopore-Based Detection of Circulating MicroRNAs in Lung Cancer Patients. Nat. Nanotechnol. 2011, 6 (10), 668−674. (32) Xi, D.; Shang, J.; Fan, E.; You, J.; Zhang, S.; Wang, H. Nanopore-Based Selective Discrimination of MicroRNAs with SingleNucleotide Difference Using Locked Nucleic Acid-Modified Probes. Anal. Chem. 2016, 88 (21), 10540−10546. (33) Wanunu, M.; Dadosh, T.; Ray, V.; Jin, J.; McReynolds, L.; Drndić, M. Rapid Electronic Detection of Probe-Specific MicroRNAs Using Thin Nanopore Sensors. Nat. Nanotechnol. 2010, 5, 807−814. (34) Chavis, A. E.; Brady, K. T.; Hatmaker, G. A.; Angevine, C. E.; Kothalawala, N.; Dass, A.; Robertson, J. W. F.; Reiner, J. E. Single Molecule Nanopore Spectrometry for Peptide Detection. ACS Sens. 2017, 2 (9), 1319−1328. (35) Bell, N. A.; Keyser, U. F. Specific Protein Detection Using Designed DNA Carriers and Nanopores. J. Am. Chem. Soc. 2015, 137 (5), 2035−2041. (36) Movileanu, L.; Howorka, S.; Braha, O.; Bayley, H. Detecting Protein Analytes That Modulate Transmembrane Movement of a Polymer Chain within a Single Protein Pore. Nat. Biotechnol. 2000, 18 (10), 1091−1095. (37) Zhao, Q.; de Zoysa, R. S. S.; Wang, D.; Jayawardhana, D. A.; Guan, X. Real-Time Monitoring of Peptide Cleavage Using a Nanopore Probe. J. Am. Chem. Soc. 2009, 131 (18), 6324−6325. (38) Wang, L.; Han, Y.; Zhou, S.; Guan, X. Real-Time Label-Free Measurement of Hiv-1 Protease Activity by Nanopore Analysis. Biosens. Bioelectron. 2014, 62, 158−162. (39) Ying, Y.-L.; Zhang, J.; Meng, F.-N.; Cao, C.; Yao, X.; Willner, I.; Tian, H.; Long, Y.-T. A Stimuli-Responsive Nanopore Based on a Photoresponsive Host-Guest System. Sci. Rep. 2013, 3, 1 DOI: 10.1038/srep01662. (40) Cao, C.; Ying, Y. L.; Hu, Z. L.; Liao, D. F.; Tian, H.; Long, Y. T. Discrimination of Oligonucleotides of Different Lengths with a WildType Aerolysin Nanopore. Nat. Nanotechnol. 2016, 11 (8), 713−718. (41) Ying, Y.-L.; Long, Y.-T. Single-Molecule Analysis in an Electrochemical Confined Space. Sci. China: Chem. 2017, 60 (9), 1187−1190. (42) Wang, H.-Y.; Ying, Y.-L.; Li, Y.; Kraatz, H.-B.; Long, Y.-T. Nanopore Analysis of B-Amyloid Peptide Aggregation Transition Induced by Small Molecules. Anal. Chem. 2011, 83 (5), 1746−1752. (43) Gu, Z.; Ying, Y. L.; Cao, C.; He, P.; Long, Y. T. Accurate Data Process for Nanopore Analysis. Anal. Chem. 2015, 87 (2), 907−913. (44) Wanunu, M.; Morrison, W.; Rabin, Y.; Grosberg, A. Y.; Meller, A. Electrostatic Focusing of Unlabelled DNA into Nanoscale Pores Using a Salt Gradient. Nat. Nanotechnol. 2010, 5 (2), 160−165. (45) Tian, K.; He, Z.; Wang, Y.; Chen, S. J.; Gu, L. Q. Designing a Polycationic Probe for Simultaneous Enrichment and Detection of MicroRNAs in a Nanopore. ACS Nano 2013, 7 (5), 3962−3969.

(46) Meller, A.; Branton, D. Single Molecule Measurements of DNA Transport through a Nanopore. Electrophoresis 2002, 23 (16), 2583− 2591. (47) Sang, P. B.; Srinath, T.; Patil, A. G.; Woo, E. J.; Varshney, U. A Unique Uracil-DNA Binding Protein of the Uracil DNA Glycosylase Superfamily. Nucleic Acids Res. 2015, 43 (17), 8452−8463. (48) Chen, C.; Zhou, D.; Tang, H.; Liang, M.; Jiang, J. A Sensitive, Homogeneous Fluorescence Assay for Detection of Thymine DNA Glycosylase Activity Based on Exonuclease-Mediated Amplification. Chem. Commun. 2013, 49 (52), 5874−5876. (49) Fang, S.; Chen, L.; Zhao, M. Unimolecular Chemically Modified DNA Fluorescent Probe for One-Step Quantitative Measurement of the Activity of Human Apurinic/Apyrimidinic Endonuclease 1 in Biological Samples. Anal. Chem. 2015, 87 (24), 11952−11956. (50) Zharkov, D. O.; Rosenquist, T. A. Inactivation of Mammalian 8Oxoguanine-DNA Glycosylase by Cadmium(II): Implications for Cadmium Genotoxicity. DNA Repair 2002, 1 (8), 661−670.

518

DOI: 10.1021/acssensors.7b00954 ACS Sens. 2018, 3, 512−518