Subscriber access provided by CORNELL UNIVERSITY LIBRARY
Current Topic/Perspective
Lectin like oxidized LDL receptor (LOX-1): A chameleon receptor for oxLDL Bushra Zeya, Albina Arjuman, and Nimai Chand Chandra Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00469 • Publication Date (Web): 15 Jul 2016 Downloaded from http://pubs.acs.org on July 20, 2016
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Lectin like oxidized LDL receptor (LOX-1): A chameleon receptor for oxLDL
1 2 3 4 5 6
Bushra Zeyaξ, Albina Arjuman♫, Nimai Chand Chandraξ¶. ξ
Department of Biochemistry, All India Institute of Medical Sciences, Patna-801507, India and ♫Division of P & I, Indian Council of Medical Research, New Delhi-110 029, India.
7
¶
8
E mail addresses:
9
Bushra Zeya:
[email protected] 10
Corresponding author.E mail:
[email protected] Albina Arjuman:
[email protected] 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
1 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
ABSTRACT
2 3 4 5 6 7 8 9 10 11 12 13 14
LOX-1, one of the main receptors for oxLDL, is found mainly on the surface of endothelial cells. It is a multi-facet 52Kda type II transmembrane protein which structurally belongs to the C-type lectin family. It exists with short intracellular N-terminal and long extracellular Cterminal hydrophilic domains separated by a hydrophobic domain of 26 amino acids. LOX-1 acts like a bi-functional receptor either showing pro-atherogenicity by activating NFߢB mediated down signaling cascade for gene activation of pro-inflammatory molecules or playing as an atheroprotective agent by receptor mediated uptake of oxLDL in presence of anti-inflammatory molecule like IL-10. Mild, moderate and highly oxidized-LDL show their characteristic features on LOX-1 activation and its ligand binding indenture. The polymorphic LOX-1 genes are intensively associated with increased susceptibility to myocardial diseases. The splicing variant LOX IN dimerizes with the native form of LOX-1 and protects cells from damage by oxidized LDL. In developing field of regenerating medicine, LOX-1 is a potential target for therapeutic intervention.
15
Key Words: oxLDL receptor, LOXIN, atherosclerosis, oxidized LDL
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 2 ACS Paragon Plus Environment
Page 2 of 24
Page 3 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
I.
INTRODUCTION
1 2 3
Atherosclerosis is an age-linked slowly developing disease of the large and medium-sized
4
arteries. Atherogenesis is a sequence of events associated with the expression of adhesion
5
molecules,1,2 recruitment of mononuclear cells to the endothelium,3 local activation of
6
leukocytes followed by inflammation,4 lipid accumulation and foam cell formation.5 The
7
main predilection sites of manifestation of the atherosclerotic pathology are the deep intimal
8
layers of large arteries such as the common carotid artery (at the bifurcation), the aorta (at the
9
start of its branches) and the subclavian artery.6
10 11
Accumulation of low density lipoproteins (LDL) in blood vessels, among many other lipids,
12
is reported to be the major culprit in the generation of atherosclerotic plaque on the vessel
13
wall. Resistance to clearance and longer persistence in blood vessels promote chemical
14
oxidation of the existing LDL particles by dissolved oxygen and other oxidizing entities
15
present in blood plasma. The resulting oxidized LDL (oxLDL) then turns out to be more and
16
more pro-inflammatory by facilitating the formation of more oxLDL and other pro-
17
inflammatory cytokines through vicious chain reactions.7 The vicious cycle is mediated
18
through the interaction of oxLDL with its recently identified specific receptor called the
19
Lectin like oxidized low density lipoprotein receptor (LOX-1).8,9,10
20 21
Modified forms of lipoproteins can act directly on monocytes and macrophages. Both highly
22
oxidized LDL (which is recognized by scavenger receptors but not by the classically known
23
LDL receptor) and minimally modified LDL (which is still recognized by the LDL receptor)
24
can increase the expression of certain macrophage scavenger receptors, resulting in a more
25
effective clearance of oxLDL and enhancement of foam cell formation.11 LOX-1 is one such
26
receptor and found to be to be expressed majorly in vascular endothelial cells, placenta and
27
lung. Currently it is a thought that the detrimental effects of oxLDL in developing cardio-
28
vascular thrombosis could be aborted by inactivating LOX-1 and which could be a target for
29
generating a biotechnological tool in future therapy.
30 31
There is a great body of evidence for oxidative stress in all stages of atherosclerosis; hence
32
oxLDL is now a popular target to explore atherosclerotic stress. OxLDL acts via a variety of
33
cell surface receptors such as SR-AІ/AІІ, CD68/macrosialin, CD36, SR-BІ/BІІ, etc. This led
34
to the identification and characterization of a novel Lectin-like receptor for oxidized LDL on 3 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 24
1
the surface of endothelial cells by Sawamura and colleagues in 1997.12 Though Sawamura et
2
al had identified LOX-1 based on the ability of endothelial cells to interact oxidatively
3
modified LDL through a pathway independent of the macrophage scavenger receptors, the
4
functional role of LOX-1 in oxLDL internalization and trafficking remained elusive until the
5
first report in this regard surfaced in 2008 where Murphy JE, et al
6
trafficking was mediated via the dynamin-2 pathway studied in HeLa cells transfected with
7
LOX-1 cDNA containing an engineered FLAG-tag. Their site-directed mutagenesis studies
8
also identified a tripeptide conserved motif (DDL) present proximal to the N-terminal end
9
(cytosolic domain) of LOX-1 that is responsible for aiding this internalization.
13
reported that LOX-1
10 11
Although many studies have demonstrated the possible mechanistic role of LOX-1 using
12
hyper-expression model systems or knock out models; any ‘transient expression model’
13
relating the in vivo physiological conditions has not yet been carried out, although the
14
bifunctional character of LOX-1 is reported (section IV in this review). Being bifunctional in
15
nature LOX-1 may act as pro- and anti-atherogenic messenger. The central theme of this
16
review is thus to justify LOX-1 as a central regulator in atherogenic milieu.
17 18
II. VARIANCE OF LOX-1 RECEPTOR A. Structure of LOX-1 protein
19 20 21
The lectin like oxidized low density lipoprotein receptor -1 (LOX-1) of homo sapien origin is
22
a 52KD membrane bound glycoprotein belonging to C-type lectin superfamily and consisting
23
of 273 amino acid residues. It is mainly present on endothelial cells, macrophages, smooth
24
muscle cells, and platelets.12It is encoded by OLR 1 gene which is a single copy gene present
25
in the region p12.3- p13.2 on chromosome 12.14LOX-1 gene is an inducible gene having
26
TATA and CAAT boxes in the proximal part of 5′ flanking region. TATA box is located at -
27
29bp and CAAT box at -99bp.15
28
The LOX-1 gene shows similarity to NK (Natural Killer) gene complex and like other NK
29
cell receptors consists of four domains. These are N-terminal cytoplasmic domain,
30
transmembrane domain, NECK domain and a C-terminal domain called a C type lectin like
31
domain (CTLD). This CTLD has been experimentally confirmed as a ligand binding domain
32
15
and NECK domain maintains the dimer structure.
4 ACS Paragon Plus Environment
Page 5 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1
Human LOX-1 gene is 7000 base pairs (bp) long and consists of 6 exons and 5 introns. The
2
size of exon-1 to 5 varies from 102 to 246 bp and the 6th exon is longer being 1722 bp.14
3
′untranslated region and cytoplasmic domain is encoded by exon 1, while the remaining
4
cytoplasmic and transmembrane domains are encoded by exon 2. Neck region is encoded by
5
NECK domain or exon 3. Exon 4 to 6 encodes lectin- like domain and 3’UTR.16 LOX-1
6
shows sequence homology to C-type lectins which are proteins that recognize and bind to
7
specific carbohydrate targets.8 Ligand binding domain of LOX-1 consists of 3 intramolecular
8
disulphide bonds. Two of them are invariant disulphide bonds present in all the members of
9
C-type lectin like domain and the third one connects the first antiparallel β-sheets in the
10
CTLD region to the linker part from the NECK segment as shown in figure-1.17 In case of
11
human LOX-1 the disulphide linked homodimer is present at C-140 on cell surface.18
12 13
Alternative splicing of selective exons has shown three splice variants for LOX-1 transcripts.
14
Transcript variant 1; is the full length mature LOX-1 which has all the exons. It is recruited
15
to the plasma membrane and is functionally active to bind oxLDL and internalize it mainly in
16
the endothelial cells.
17
Transcript variant 2; is a splice variant which lacks exon 4 and hence lacks a part of the
18
ligand recognition domain.
19
Transcript variant 3; is also a splice variant which lacks exon 5, the oxLDL binding region
20
in the CTLD. This is an important variant which has been hypothesized to have a protective
21
effect as against mature LOX-1. So far Mango R, et al., 200519 are the only group who have
22
shown that this isoform of LOX-1 termed as LOXIN has a protective effect in myocardial
23
infarction by forming ‘probable’ nonfunctional dimmers with mature LOX-1 in the ER and
24
hence inhibit its recruitment back to the membrane for further uptake of oxLDL. They have
25
shown that macrophages of those subjects carry the ‘non-risk’ disease haplotype of the OLR1
26
gene. Relatively high amount of this particular variant decreases the cytotoxicity induced by
27
oxLDL and hence could act as an anti-apoptotic component.
28
Extracellular lectin like domain of human LOX-1 is a heart shaped homodimers having a
29
central hydrophobic tunnel which extends through the entire molecule. The hydrophobic
30
tunnel accommodates a cholesterol molecule, a fatty acid chain and six to seven residues of
31
non polar peptide.20 LOX-1 identifies multiple ligands including modified lipoprotein (such
5 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 24
1
as oxLDL, acetylated LDL), polyanionic chemicals, anionic phospholipids and cellular
2
ligands. Thus LOX-1 has versatile physiological functions.
3 4 5
Figure-1: Crystal Structure of Homo sapiens mRNA sequence for LOX-1
6
The intrachain disulfide bonds are shown by red balls-and sticks.
7 8 9 10 11
Figure – 2: Cellular orientation of human LOX-1reported by Ohki I et al. (9).
12 13 14
Ohki I et al 200517
15 16 17
Chromosome: 12; Location: 12p13.2 – p12.3.Belongs to the C-type lectin superfamily.
18
Nucleotides: 1…..2463 + 26 A nucleotides
19
Cellular orientation of human LOX-1reported by Ohki I et al. (9).
20
1atttttagtt aaaaaa
tgttgaagttcgtgactgcttcactctctcattcttagcttgaatttgga………………2461aaaaaaaaaa
21
(NCBI Accession. No. NM_002543)
22
Transcript Variants
No of bp
23
TRV1
456
Mature full length
All 6 exons
24
TRV2
316
Truncated form
Exon:1,2,3,5,6
25
TRV3(LOXIN)
340
Truncated form
Exon:1,2,3,4,6
Type
Exon no.
26 27 28 6 ACS Paragon Plus Environment
Page 7 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1 2
Figure 2 : Cellular orientation of human LOX-1reported by Ohki I et al.17
3 4 Cytoplasmic domain
5
TM
NECK domain
CTLD
NH2
6
C 1
34
61
143
C C
C
C
C
144 155 172 243 256 264
COOH
273
Four domains of LOX-1 protein are: N- terminal cytoplasmic domain single transmembrane domain extracellular connecting NECK domain C- terminal lectin like domain
7 8 9 10
Ohki I et al, 2005
11 12 13 14 15
B. Species variance of LOX-1(rat and human)
16 17 18 19
The amino acid sequence of human LOX-1 shows similarity to rat LOX-1 amino acid sequence. According to a report by Nagase et al.21 Rat LOX-1 amino acid sequence showed almost 60% similarity to human LOX-1 amino acid sequence. Rat LOX-1 protein constitutes 364 amino acid while human contains 273 and 270 amino acid respectively.
20 21 22 23 24
Unlike human, rat LOX-1 consists of triple repeats of a 46-amino acid motif between transmembrane and lectin-like domain, which represents the NECK domain in human LOX1. The repeats of 46-amino acid domain made rat LOX-1 longer than its human counterparts.22 It is rich in glutamate, glutamine, leucine and lysine residues. The 3’ untranslated region of rat LOX-1 contains A+U rich regions and polyadenylation signals.
25 26 27
While both rat and human possess single copy gene for LOX-1,rat gene spans over 19 kb length and consists of 8 exons; human LOX-1 gene extends 7kb with only 6 exons. The difference of the properties of exons between rat and human LOX-1 is shown in table-1.
28 29
Table – 1: Lox-1 gene.
Differences of the functional properties of exons between Rat and Human
Position of Exon 1
Rat LOX-1 Human LOX-1 Encodes 5’ UTR and N-terminal 25 Encodes 5’UTR amino acid cytoplasmic domain 7 ACS Paragon Plus Environment
and
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Encodes transmembrane domain 2
3 4&5
6-8
Page 8 of 24
Encodes remainder cytoplasmic domain and transmembrane domain
Encodes 82 amino acids and repeat 1 in the extracellular domain NECK domain Encodes 46 amino acids corresponds Encodes the lectin domain to repeat 2 (exon 4) and repeat 3 including exon 6 encoding (exon 5) 3’UTR Encodes 131 amino acids corresponding to lectin like domain Unknown and 3’ UTR (exon 8)
1 2 3
C. Susceptibility variance of LOX-1 to mild, moderate and highly oxidized LDL
4
Expression of LOX-1 depends on the grade of oxLDL. In a study, it was reported that at
5
40µg/ml of mildly, moderately and highly oxidized LDL, the expression of LOX-1 was
6
26.1%, 51.8% and 40.3% respectively. At 80µg/ml of mildly, moderately and fully oxidized
7
LDL, it further increased to 40.3%, 61.3% and 76.4% respectively.23 Oxidation of LDL takes
8
place in the sub-endothelial space of the arteries and not in circulation. Highly oxidized LDL
9
possesses a very short half life in plasma as it is cleared rapidly from circulation. Sometimes
10
small amounts of oxidized LDL are detected immunologically in normal plasma and
11
increased in several diseases like diabetes and heart diseases.24 The oxidation of LDL leads to
12
modification of lysine residues of the LDL protein. Almost 32% of lysines are modified in
13
extensively oxidized LDL.25
14
Mildly oxidized LDL(3-12nmol TBARS/mg Apo B)is generally used to describe an oxLDL
15
preparation which is used for a modified variant to be chemically distinguished from
16
unmodified LDL. But they have the property to bind to LDL receptor. They are not identified
17
by several scavenger receptors but have distinct biological activities which are not shown by
18
unmodified LDL like induction of pro-inflammatory actions of endothelial cells and
19
macrophages. In a study it was shown that free cholesterol and cholesteryl ester were
20
efficiently loaded in macrophages depending on species.26 In case of mouse peritoneal
21
macrophages there is accumulation of free cholesterol in the first 24 hours of exposure and in
22
following hours, almost 75% of free cholesterol was esterified and its excess was stored as
23
cytoplasmic cholesteryl ester droplets and leads to foam cells.26 In case of human THP-1 cell
24
line ( macrophages type), exposure to mildly oxidized LDL led to accumulation of both
25
cholesterol and cholesteryl ester in the lysosomalcompartment.26 8 ACS Paragon Plus Environment
Page 9 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1
Moderately oxidized LDL( 15nmol 30nmol TBARS/mg Apo B) LDL is modified to such an extent
7
that it is not recognized by classical LDL receptors. These become ligand to another family of
8
receptors called scavenger receptors. There is significant accumulation of free cholesterol due
9
to exposure of macrophages to LDL but little increase in accumulation of cholesteryl esters.
10
In a study by Roma et al it was shown that there was almost 85% accumulation of free
11
cellular cholesterol when J774macrophace cell line was incubated with extensively oxLDL
12
but, very small increase in cellular cholesteryl ester.28 In another similar study by two groups,
13
Roma et al, and Brown et al, it was demonstrated that incubation of mouse peritoneal
14
macrophage with extensively oxidized LDL resulted in increased accumulation of free
15
cholesterol approximately 40-50% and only 5-10% accumulation of cholesteryl ester. Thus
16
the intensity of ester accumulation depends on the degree of oxidation of LDL.29,30
17
LOX-1 binds with more efficiency to a modified form of LDL such as oxidized LDL rather
18
than untreared LDL suggesting that LOX-1 recognize modified Apo B.31 Considering the
19
degree of LDL oxidation, LOX- 1 shows higher affinity to moderately oxLDL rather than
20
extensively oxLDL.
21 22
III.
LOX-1 SIGNALING
A. Role of NO and NF κB:
23
NO, a short lived gas can freely diffuse through cells. The effect of nitric oxide can be
24
propagated due to its interaction with thiol groups present on cysteine, glutathione and heme-
25
proteins.32It has been recognized as an important molecule for regulation of apoptosis of cells
26
and its viability. It has wide regulatory role in inflammatory response.
27
NO readily reacts with molecular oxygen and superoxide radical leading to oxidation of nitric
28
oxide at physiological pH. This leads to formation of nitrite. NO also reacts with superoxide
29
to form peroxynitrite which is stable but can form nitrate and highly reactive OH radical and
30
hence shows its pro-apoptotic and necrotic activity.33 Studies have shown that oxLDL
31
binding to LOX-1 increases intracellular ROS such as superoxide anion (O2- ) and hydrogen 9 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
peroxide (H2O2). Intracellular nitric oxide reacts with superoxide anion and thus there is
2
subsequent decrease in NO level in cells. This condition leads to endothelial dysfunction.
3
This is mainly due to the fact that oxLDL decreases endogenous superoxide dismutase
4
activity and increased nitric oxide synthase activity leads to increase free radical formation
5
and leads to hypoxia. Nitric oxide synthase is an enzyme that is involved in conversion of
6
amino acid L-arginine into NO & L-citrulline and play a crucial role in the regulation of
7
vascular tone.34
8
Nitric Oxide protects vascular injury, inflammation and thrombosis. It also inhibits adhesion
9
of leukocyte to the endothelium and maintains non-proliferative state of vascular smooth
10
muscle cells and in turn limits platelet aggregation.35,36 Angiotensin II is a vasoconstrictor
11
and inhibits NO action and leads to production of ROS.
12
NF κB, an oncogenic protein, regulates transcription of variety of genes such as immune and
13
inflammatory response genes (Figure-3). This transcription factor has a role to play in
14
atherosclerosis. It is present as a heterodimer in the cytosol with NF κB1 (p50), Rel (p65) and
15
p(56) subunits and bound to an inhibitor named IκB. NFκB, on activation, releases IκB and
16
migrates from the cytosol to the nucleus of the cell and binds to specific DNA sequences and
17
performs transcription.
18
molecules such as TNF-α, ICAM-1 and VCAM-1. This NF κB is activated by inflammatory
19
stimulation in macrophages, endothelial cells, smooth muscle cells and T cells. These cells
20
play an important role in atherosclerosis. A study by Maziereet al38 has demonstrated that
21
oxLDL stimulates NFκB in endothelial cells, smooth muscle cells and fibroblast and leads to
22
cell injury. Thus oxidative activation of NFκB in endothelial cells causes changes of cell
23
phenotype and initiates atherosclerotic lesion formation.
37
The transcribed genes encode pro-inflammatory and adhesion
10 ACS Paragon Plus Environment
Page 10 of 24
Page 11 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Figure-3: Mechanism of oxLDL signaling oxLDL Endothelial cell surface
LOX-1
Nucleus NO + O2
p65 p50
ONOO-
Proinflammatory cytokine overexpression p50 p65
p50 p65
Inactive NFκβ
Active NFκβ Active NFκβ binding DNA
1 2 3
Intracellular ROS serves as a downstream messenger for various pathway leading to
4
inactivation of NFκB.9 In a study it was also demonstrated that oxidized LDL leads to
5
activation of NFκB in bovine aortic endothelial cells (BAECs).9 The 5′flanking region of
6
LOX-1 gene contains a consensus sequence of NF κB binding site. This suggests that certain
7
inflammatory signal induces LOX-1 gene and leads to activation of NFκB causing
8
transcriptional regulation.14 In certain reports it has been mentioned that LOX-1 expression
9
also depends on activation of NFκB induced by oxLDL due to generation of ROS. This thus
10
gives the vicious cycle of oxLDL induced LOX-1 signaling for promoting its pro-
11
inflammatory activity.
12
Furthermore, it has been reported that incubation of anti-LOX-1 monoclonal antibody
13
inhibited NFκB activation induced by oxLDL. Thus this suggests that oxLDL binding to
14
LOX-1 and subsequent formation of ROS, are the events that occurs first in the chain of
15
reaction of NFκB activation.
16
Certain antioxidants inhibits activation of NFκB such as pyrrolidine, dithiocarbamate and N-
17
acetyl cysteine.39 Apart from these, caffeic acid phenethyl ester (CAPE) is also a strong
18
inhibitor of NFκB.40
19 11 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
IV.
PRO AND ANTI INFLAMMATORY RESPONSE OF LOX-1
2
LOX-1 is a bi-functional receptor in respect of generating pro-inflammatory signaland faster
3
utilization of ox-LDL in presence of anti-inflammatory cytokines like IL-10.41 Vascular
4
inflammation is transmitted by various cells which communicate amongst themselves through
5
a chain of cytokine receptors and their cytokine mediators. Cytokine shows properties of
6
autocrine, paracrine and juxtacrine signaling. Attachment of cytokine to their receptor
7
initiates a series of intracellular signals including activation of kinases and transcription
8
factors.42 Increased expression of LOX-1 in the intima of atherosclerotic lesion is also due to
9
the presence of inflammatory cytokines.43
10
Expression of various adhesion molecules such as VCAM 1, ICAM 1 is induced by pro-
11
inflammatory cytokines such as IL-1β and TNFα. The expression of these cytokines are
12
induced by the interaction of LOX-1 with oxLDL and CD40/CD40L ligand interaction.44
13
Large number of cytokines acts as pro-inflammatory markers such as IL-1β, IL-6, IL-8, IL-
14
12, IL-18, IFNγ and TNFα.These pro-inflammatory cytokines are also pro-atherogenic.IL-1β
15
acts through p38MAPK signaling pathway and elicits expression of cytokines and adhesion
16
molecules. IL-6 synthesized by endothelial cells, vascular smooth muscle cells and
17
macrophage. The expression of IL-6 increases in patients with unstable angina and coronary
18
artery disease.45 It functions through JAK/STAT family of signal transducers. IL-6 enhances
19
the expression of CAM (Cell Adhesion Molecule) on endothelial cells. It also functions as a
20
contributing factor in the extravasations of leukocyte in the atherosclerotic lesions.These
21
cytokines are inter-related in their expressions and expression of TNFα is one common link
22
in most of the cases. TNFα is a pro-inflammatory cytokine and it functions through
23
p38/MAPK and NFκB signaling pathway, which is again linked with LOX-1 expression.
24
In a study it was demonstrated that there was increased expression of LOX-1 and SR-A
25
(Scavenger Receptor-A) mRNA in the presence of TNFα and IL-6.46 There are also reports in
26
THP-1 cells that expression of IL-6 is influenced by TNFα.46
27
In another report it has been proved that production of pro-inflammatory cytokines, such as
28
TNFα and IL-1, induce LOX-1 expression which in turn activate NFκB signaling pathway.47
29
Increased production of IL-8 and LOX-1 expression was also observed in THP-1 cell line by
30
increased level of oxLDL.48 Mattaliano et al in their work have identified ROCK2 (Rho-
31
associated, coiled-coil containing protein kinase2) a kinase, acting as LOX-1 associating
12 ACS Paragon Plus Environment
Page 12 of 24
Page 13 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1
molecule. Accumulation of oxLDL stimulates ROCK2 to produce IL8.49 IL-1α, IL-1β and
2
TNFα have been reported to upregulate LOX-1 expression in cultured smooth muscle cells.50
3
Interdependency of LOX-1 and TNFα has been reported in one of the studies also. It was
4
demonstrated that in one hand TNF α induces TNFR1 (receptor of TNF α) to generate LOX-
5
1 and on the other hand shows increased extracellular accumulation of oxLDL.51 TGFβ
6
signals
7
acetateresponsive elements (TREs) as well as AP-1 and activates TGFβ dependent gene
8
transcription. The consensus nucleotide sequence corresponding to TRE is present in the 5′-
9
flanking region of LOX-1 gene. Therefore smad-TRE pathway is responsible for LOX-1
10
expression.52 In a study it is shown that TGFβ induces LOX-1 expression in cultured vascular
11
endothelial cells, smooth muscle cells and macrophage.53
through
smad3
and
smad4
by
interacting
with
12-O-tetradecanoyl-13-
12 13
Expression of IL-10 leads to decreased cell damage and apoptosis in atherosclerotic plaque
14
and thus IL-10 is regarded as anatheroprotective agent in nature.54 It includes various
15
mechanisms such as attenuation of inflammatory gene expression in many cell types,
16
inhibition of T-cell proliferation and inhibition of antigen presentation. IL-10 activates
17
JAK/STAT pathway, mostly STAT 3. It can even inhibit TNFα induced MAPK signaling and
18
NFκB activation in monocytes, macrophages, endothelial cells and VSMC.55 IL-10 reduces
19
the atherogenic propensity due to clearance of oxLDL particle via LOX-1 mediated cellular
20
uptake and acts as atheroprotectant.41 Almost 60% reduced fatty lesion was observed in mice
21
which was electro-transferred with IL-10 cDNA. Thus IL-10 makes LOX-1 anti-
22
atherogenic.55
23 24
V.
VARIANTS IN LOX-1 AND ITS ATHEROGENIC SENSITIVITY
25
OLR 1 gene encodes LOX-1 receptors. It is mapped in human chromosome 12p, 12.3-13.1.
26
Various studies have shown certain genetic variation in the OLR 1 gene and these variants are
27
associated with coronary artery disease.19 Single Nucleotide Polymorphisms (SNPs) have
28
been identified in LOX-1 at intron 4 (G → A), intron 5 (T → G) and 3’UTR (T → C)
29
regions.56 The SNPs give rise to a splicing variant LOXIN, lacking exon5. It is deficient in
30
ligand binding domain of LOX-1. The size of LOXIN protein has been predicted to be 21.4
31
KD.57 The polypeptide constitutes 188 amino acids, N-terminal of wild type LOX-1 and an
32
altered amino acid at its C- terminal. The LOXIN dimerizes with the native form of LOX-1 13 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
and protects cells from damage by oxidized LDL. This reduces the expression of LOX-1 on
2
plasma membrane as well as binding of oxidized LDL to LOX-1. Studies suggest an inverse
3
relation between the level of LOXIN expression and the incidence of myocardial infarction in
4
humans.19 Thus the pro-apoptotic effect of LOX-1 can be barred by co-expression of LOXIN
5
in a dose dependent manner. Another study also suggests the hetero oligomerization of the
6
naturally occurring isoforms of LOX-1. LOXIN and LOX-1 in joint adherence results in a
7
disruption of functional properties of LOX-1 and increases the resistance to oxLDL induced
8
apoptosis.57 Thus these findings make LOXIN a new target for treatment of atherosclerosis.
9
Another variant of LOX-1 has been observed which shows G to C transition at 501 leading to
10
Lys-to-Asn conversion at 167th position of peptide. It is located in C type lectin like domain.
11
The conversion of Lys-to-Asn leads to a decreased binding and internalization of oxLDL.
12
Thus it can be suggested that existence of LOX-1 gene variant plays an important role in the
13
onset of atherogenesis.58
14 15
VI.
LOX-1: A POTENTIAL TARGET IN CARDIOVASCULAR THERAPY
16 17
Oxidized LDL plays a pathological role in the proliferation and development of
18
atherosclerosis. Several therapeutic strategies have been developed which reduces the plasma
19
oxLDL levels such as naturally occurring antioxidants and antihypertensive agents.59 These
20
agents either inhibit oxLDL formation or remove oxLDL from circulation, thus preventing
21
atherogenesis.60 Several antioxidants such as tanshionone II-A,61 curcumin,62 berberine63 and
22
resveratrol64 prevents atherosclerosis by inhibiting the generation of oxidized LDL. They also
23
inhibit expression of LOX-1 by inactivating the LOX-1 signaling pathway due to reduced
24
circulating oxLDL level. Certain antihypertensive agents such as calcium channel blockers
25
(CCB) and AT1R blockers (ARB) also limits and decrease the incidence of atherosclerosis
26
and other cardiovascular events.65 Nifedine, a calcium channel blocker, has inhibiting effect
27
on LOX-1. It prevents the apoptosis of endothelial cell by down regulation of LOX-1.
28
Various other studies demonstrate that the application of LOX-1 antibodies.66 antisense
29
RNA67, and miRNA68,69 also block LOX-1 thus laying a pathway towards development of
30
therapeutic strategies. Our laboratory is also in process of developing LOX-1 specific
31
siRNAs70 with a target for generating bio-tech-based therapy in next generation medicine.
14 ACS Paragon Plus Environment
Page 14 of 24
Page 15 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1
Mouse monoclonal antibody has also been developed, which inhibits LOX-1 activation and
2
binding of ligands to LOX-1.71 It has been demonstrated in vitro that abJTX92 prevents the
3
binding and internalization of oxLDL to LOX-1 in human artery endothelial cells.66 LOX-1
4
antibody also inhibits the expression of adhesion molecules and eNOS. In case of adult
5
mouse cardiomyocytes it was observed that anti-LOX-1 antibodies diminishes Ang-II
6
mediated oxidative stress and the expression of NADPH oxidase and NFκB,72 thus reducing
7
ROS level and in turn prevents atherosclerosis. In another study by Cao et al,73 it was
8
demonstrated that a polyclonal antibody against Fc, cross-linked via LOX-1 Fc fusion protein
9
inhibited the oxLDL binding to LOX-1. Recently in a study, it has been reported that
10
intraperitoneal administration of anti-LOX-1 antibody in rats reduce the activation and
11
expression of LOX-1 and was found to be a novel therapeutic target to Neonatal Hypoxic-
12
Ischemic Encephalopathy (HIE).74 Human LOX-1 monoclonal antibody has also been
13
developed using Xenomouse. The antibody prevents oxLDL induced ROS formation,
14
RhoA/Rac1 activation and MCP-1 expression.69
15 16
Antisense technology has also proved to be an effective strategy for the suppression of
17
atherosclerosis and other cardiac diseases. Antisense oligonucleotides have been developed to
18
lower LOX-1 level. It was recently reported by Takedatsu et al that schizophyllan (SPG) can
19
be used as a delivery system for oligonucleotide (ODNs). Schozophyllan is a polysaccharide
20
belonging to β(1-3)-glucan family.67 This delivery system is advantageous as it is stable inin
21
vivosystem and not a substrate for deoxyribonuclease. It is internalized easily and efficiently
22
by macrophages through lectin-1 receptor. Amati et al used this system to administer
23
antisense olr1i.e SPG/olr1AS in ApoEknockout mice and found that there was significant
24
down regulation of LOX-1 mRNA and protein in the aorta of mice. Almost 63% reduction in
25
the LOX-1 protein level was observed in the treated mice.75
26 27
miRNA and/orsiRNA can also be a target for an effective therapeutic strategy. miRNAs are
28
small endogenous non coding RNA of approximately 21 nucleotide in length. They regulate
29
the expression of various protein-coding genes post transcriptionally. In a study it has been
30
demonstrated that there is a binding site for miRNA let-7g in 3′untranslated region of LOX-1-
31
mRNA. Transfection of let-7g resulted in the inhibition of oxLDL induced expression of
32
LOX-1.76 In another study by Ding et al68 it was reported that the miRNA-let-7g blocked
33
LOX-1 expression as well as uptake of oxLDL in human aortic smooth muscle cells
34
(HASMCs).Small interfering RNA (siLOX-1) also prevents oxLDL induced Rho A (Ras 15 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
homolog gene family, member A) and Rac 1 (Ras-related C3 botulinum toxin substrate
2
1)activation.69 siRNA for LOX-1 was also found to partially inhibit CRP (C- reactive protein)
3
binding.77 In a study it was reported that transfection of bovine aortic endothelial cells with
4
siLOX-1 prevented the expression and up regulation of LOX-1.78 Certain other small
5
molecules such as procyanide, a polyphenol compound present in red wine and apples also
6
prevents oxLDL binding to LOX-1.79 In the recent study by Thakkar et al80 showed that
7
virtual screening technique can also be used to identify LOX-1 inhibitor. Two of the lead
8
molecules Mol-4 and Mol-5 were seen to strongly bind with LOX-1 and inhibits the uptake
9
of oxLDL. Another study has also revealed that pretreatment with metformin reduces oxLDL
10
induced endothelial apoptosis by increasing expression of SIRT1.81
11 12
Thus all these probes such as antibodies, antisense oligonucleotides, siRNA and miRNA are
13
the fast emerging tools of biotechnology that can be used for therapeutic trial for developing
14
the target missile for treating atherosclerosis. LOX-1 is now a novel therapeutic target to treat
15
cardiovascular diseases.
16 17
VII.
FUTURE PROSPECTIVE
18
LOX-1 is one of the major mediators in the genesis of atherosclerosis. Expression of LOX-1
19
is regulated by pro- and anti-inflammatory cytokines. Therapeutic interventions to its
20
signaling pathway may help in future for the better preventive measure in atherosclerotic
21
lesions. Gene therapy by post transcriptional regulation of the receptor protein e.g.
22
modulation by siRNA, miRNA, shRNA etc., may also be advantageous in lowering the risk
23
of atherosclerosis and its related disorders. Thus LOX-1 may be a prospective therapeutic
24
target in upcoming medicine to combat atherosclerosis by exploring the understanding and in
25
depth knowledge on LOX-1 signaling over pro-inflammatory gene transcription,
26 27 28 29 30 31 32 33
16 ACS Paragon Plus Environment
Page 16 of 24
Page 17 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1 2 3 4
Reference
5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
1. Pak, V.M., Grandner, M.A., and Pack, A.I.(2014) Circulating adhesion molecules in obstructive sleep apnea and cardiovascular disease. Sleep Med Rev 18(1), 1-23 .
38 39 40 41 42 43 44
10. Chistiakov, D.A., Orekhov, A.N., and Bobryshev, Y.V. (2016) LOX-1-Mediated Effects on Vascular Cells in Atherosclerosis. Cellular Physio and Biochem 38,1851-1859.
45 46
12. Sawamura, T., Kume, N., Aoyama, T. et al. (1997)An endothelial receptor for oxidized low density lipoprotein. Nature366, 73-77.
2. Blankenberg, S., Barbaux, S., and Tiret, L. (2003) Adhesion molecules and atherosclerosis. Atherosclerosis 170(2), 191-203.
3. Østerud, B., and Eirik, B. (2003) Role of Monocytes in Atherogenesis. Physiol Rev 83, 1069-1112. 4. Elena, G., and Klaus, L. (2009) Immune and Inflammatory Mechanisms of Atherosclerosis. Annu Rev Immunol 27, 165–197. 5. Angelovich, T.A., Hearps, A.C., and Jaworowski, A. (2015) Inflammation-induced foam cell formation in chronic inflammatory disease. Immunology and Cell Biology 93, 683-693. 6.
Saremi, F. (2013) Cardiac CT and MR for Adult Congenital Heart Disease.IN Springer (Saremi, F. Ed) 2014 ed.
7. Heinecke, J.W., (2006) Lipoprotein oxidation in cardiovascular disease: chief culprit or innocent bystander? J Exp Med. 203(4), 813–816. 8. Chen, M., Masaki, T., and Sawamura, T. (2002) LOX-1, the receptor for oxidized low-density lipoprotein identified from endothelial cells: implications in endothelial dysfunction and atherosclerosis. Pharmacol Ther95(1), 89–100.
9. Cominacini, L., Pasini, A.F., Garbin, U., Davoli, A., Tosetti, M.L., Campagnola, M., et al. (2000) Oxidized low density lipoprotein (ox-LDL) binding to ox-LDL receptor-1 in endothelial cells induces the activation of NF-kappaB through an increased production of intracellular reactive oxygen species. J Biol Chem275(17), 12633–12638.
11. Yoshida, H., Quehenberger, O., Kondratenko, N., Green, S., and Steinberg, D. (1998) Minimally oxidized low density lipoprotein increases expression of scavenger receptor A, CD 36 and microsialin in resident mouse peritoneal macrophages. Arterioscler Thromb Vasc Biol 18, 794-802.
17 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
13. Murphy, J.E., Vohra, R.S., Dunn, S., Holloway, Z.G., Monaco, A.P., Homer-Vanniasinkam, S., Walker, J.H., and Ponnamballam, S.(2008) Oxidized LDL internalization by the LOX-1 scavenger receptor is dependent on a novel cytoplasmic motif and is regulated by dynamin 2. Cell Sci121, 2136-2147.
1 2 3 4 5 6 7 8
14. Aoyama, T., Sawamura, T., Furutani, Y., Matsuoka, R., Yoshida, M.C., Fujiwara, H., and Masaki, T.(1999) Structure and chromosomal assignment of the human lectin-like oxidized low-density-lipoprotein receptor-1 (LOX-1) gene. Biochem J339 , 177-184.
9 10 11
15. Chen, M., Inonue, K., Narumiya, S., Masaki, T., and Sawamura, T. (2001) Requirements of basic amino acid residues within the lectin like domain of LOX-1 for the binding of oxidized low density lipoprotein. FEBS lett499, 215-219.
12 13 14 15 16 17 18 19
16. Weis, W., Kahn, R., Fourme, R., Drickamer, K., and Hendrickson, W. A. (1991)Structure of the calcium-dependent lectin domain from a rat mannose-binding protein determined by MAD phasing. Science254, 1608-1615.
20 21 22
18. Xie, Q., Matsunaga, S., Niimi, S., Ogawa, S., Tokuyasu, K., Sakakibara, Y., et al. (2004) Human lectin-like oxidized low-density lipoprotein receptor-1 functions as a dimer in living cells. Dna Cell Biol.23(2), 111–117.
23 24 25
19. Mango, R., Biocca, S., del Vecchio, F., Clementi, F., Sangiuolo, F., Amati, F., et al. (2005) In vivo and in vitro studies support that a new splicing isoform of OLR1 gene is protective against acute myocardial infarction. Circ Res97(2),152–158.
26 27
20. Park, H., Adsit, F.G., and Boyington, J.C. (2005) The 1.4 angstrom crystal structure of the human oxidized low density lipoprotein receptor lox-1. J Biol Chem280(14), 13593–13599.
28 29 30 31 32 33 34
21. Nagase, M., and Hirose, S. (1998) Unique repetitive sequence and unexpected regulation of expression of rat endothelial receptor for oxidized low-density lipoprotein (LOX-1). Biochem J 330, 1417–1422.
35 36 37
23. Chatchanayuanyong, R., and Suwanprasert, K. (2013) Inducible Expression of Lectin-Like Oxidized Low Density Lipoprotein (LOX-1) Activated by Dose-Degree Dependent of Oxidized Low Density Lipoprotein (oxLDL) Through Vascular Reactive Oxygen Species.
38 39 40
24. Itabe, H., Mori, M., Fujimoto, Y., Higashi, Y., and Takano, T. (2003) Minimally Modified LDL Is an Oxidized LDL Enriched with Oxidized Phosphatidylcholines. J Biochem (Tokyo)134(3), 459–465.
41 42 43
25. Drab, M., Verkade, P., Elger, M., Kasper, M., Lohn, M., Lauterbach, B., et al. (2001) Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 293(5539), 2449–2452.
17. Ohki, I., Ishigaki, T., Oyama, T., Matsunaga, S., Xie, Q., Ohnishi-Kameyama, M., et al. (2005) Crystal structure of human lectin-like, oxidized low-density lipoprotein receptor 1 ligand binding domain and its ligand recognition mode to OxLDL. Struct Lond Engl 13(6), 905–917.
22. Steinberg, D., Parthasarathy, S., Carew, T.E., Khoo,and J.C., Witztum, J.L. (1989)N EnglJ Med320, 915-924.
18 ACS Paragon Plus Environment
Page 18 of 24
Page 19 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1 2 3 4 5 6 7 8 9
Biochemistry
26. Yancey, P.G., and Jerome, W.G. (1998) Lysosomal sequestration of free and esterified cholesterol from oxidized low density lipoprotein in macrophages of different species. J Lipid Res39(7),1349–1361. 27. Anwar, A.A., Li, F.Y.L., Leake, D.S., Ishii, T., Mann, G.E., and Siow, R.C.M.(2005) Induction of heme oxygenase 1 by moderately oxidized low-density lipoproteins in human vascular smooth muscle cells: Role of mitogen-activated protein kinases and Nrf2. Free Radic Biol Med 39(2), 227–236.
10 11 12
28. Roma, P., Bernini, F., Fogliatto, R., Bertulli, S.M., Negri, S., Fumagalli, R., et al. (1992) Defective catabolism of oxidized LDL by J774 murine macrophages. J Lipid Res 33(6), 819– 829.
13 14 15
29. Roma, P., Catapano, A.L., Bertulli, S.M., Varesi, L., Fumagalli, R., and Bernini, F. (1990) Oxidized LDL increase free cholesterol and fail to stimulate cholesterol esterification in murine macrophages. Biochem Biophys Res Commun171(1), 123–131.
16 17 18
30. Brown, A.J., Mander, E.L., Gelissen, I.C., Kritharides, L., Dean, R.T., and Jessup, W. (2000) Cholesterol and oxysterol metabolism and subcellular distribution in macrophage foam cells: accumulation of oxidized esters in lysosomes. J Lipid Res41(2), 226–236.
19 20 21
31. Goyal, T., Mitra, S., Khaidakov, M., Wang, X., Singla, S., Ding, Z., et al. (2012) Current Concepts of the Role of Oxidized LDL Receptors in Atherosclerosis. Curr Atheroscler Rep14, 150-159.
22 23 24 25 26 27
32. Jaffrey,S.R., Erdjument-Bromage, H., Ferris, C.D., Tempst, P., and Snyder, S.H. (2001) Protein S-nitrosylation: a physiological signal for neuronal nitric oxide. Nat Cell Biol3(2), 193–197.
28 29 30 31 32 33 34
34. Moncada, S., and Higgs, A. (1993) The L-Arginine-Nitric Oxide Pathway. N Engl J Med. 329(27), 2002–2012.
35 36 37 38
36.
39 40 41
37. Baeuerle, P.A., and Henkel, T. (1994) Function and Activation of NF-kappaB in the Immune System. Annu Rev Immunol12(1), 141–179.
42 43 44 45
38. Maziere, C., Auclair, M., Djavaheri-Mergny, M., Packer, L., and Maziere, J.C. (1996) Oxidized low density lipoprotein induces activation of the transcription factor NFκB in fibroblasts, endothelial and smooth muscle cells. Iubmb Life39(6), 1201–1207.
33. Galle, J.,and Heermeier,K. (1999) Angiotensin II and oxidized LDL: an unholy alliance creating oxidative stress. Nephrol Dial Transplant14(11),2585–2589.
35. De Graaf, J.C., Banga, J.D., Moncada, S., Palmer, R.M., de Groot, P.G., and Sixma, J.J. (1992) Nitric oxide functions as an inhibitor of platelet adhesion under flow conditions. Circulation85(6), 2284–2290.
Cornwell, T.L., Arnold, E., Boerth, N.J., and Lincoln, T.M. (1994) Inhibition of smooth muscle cell growth by nitric oxide and activation of cAMP-dependent protein kinase by cGMP. Am J Physiol 267(5 Pt 1), 1405–1413.
19 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1 2 3 4 5
39. Weber, C., Erl, W., Pietsch, A., Ströbel, M., Ziegler-Heitbrock, H.W., and Weber, P.C. (1994) Antioxidants inhibit monocyte adhesion by suppressing nuclear factor-kappa B mobilization and induction of vascular cell adhesion molecule-1 in endothelial cells stimulated to generate radicals. Arterioscler Thromb Vasc Biol 14(10), 1665–1673.
6 7 8 9 10
40. Pernow, J., Shemyakin, A., and Bohm, F. (2012) New perspectives on endothelin-1 in atherosclerosis and diabetes mellitus. Life Sciences91, 507–516. Pernow, J., Shemyakin, A., and Bohm, F. (2012) New perspectives on endothelin-1 in atherosclerosis and diabetes mellitus. Life Sciences91, 507–516.
11 12 13 14
41. Arjuman, A., and Chandra, N.C. (2013) Effect of IL-10 on LOX-1 expression, signalling and functional activity: An atheroprotective response. Diabetes & Vascular Disease Research 10(5), 442 – 451.
15 16 17 18
42. Paukku, K.,and Silvennoinen, O. (2004) STATs as critical mediators of signal transduction and transcription: lessons learned from STAT5. Cytokine Growth Factor Rev 15(6), 435– 455.
19 20 21 22
43. Kataoka, H., Kume, N., Miyamoto, S., Minami, M., Morimoto, M., Hayashida, K., et al. (2001) Oxidized LDL Modulates Bax/Bcl-2 Through the Lectinlike Ox-LDL Receptor-1 in Vascular Smooth Muscle Cells. Arterioscler Thromb Vasc Biol21(6), 955–960.
23 24 25 26
44. True, A.L., Rahman, A.,and Malik, A.B. (2001) Activation of NF-kappaB induced by H(2)O(2) and TNF-alpha and its effects on ICAM-1 expression in endothelial cells. Am J Physiol Lung Cell Mol Physiol279(2), 302–311.
27 28
45. Tedgui, A.,and Mallat, Z.(2006) Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways. Physiol Rev86(2), 515–581.
29 30
46. Hashizume, M.,and Mihara, M. (2012) Atherogenic effects of TNF-α and IL-6 via upregulation of scavenger receptors. Cytokine58(3), 424–430.
31 32 33
47. Wu, Z., Sawamura, T., Kurdowska, A.K., Ji, H.L., Idell, S., and Fu, J.(2011) LOX-1 deletion improves neutrophil responses, enhances bacterial clearance, and reduces lung injury in a murine polymicrobial sepsis model. Infect Immun79(7), 2865–2870.
34 35 36
48. Mattaliano, M.D., Huard, C., Cao, W., Hill, A.A., Zhong, W., Martinez, R.V., et al. (2009) LOX-1-dependent transcriptional regulation in response to oxidized LDL treatment of human aortic endothelial cells. Am J Physiol Cell Physiol296(6), 1329–1337.
37 38 39 40 41 42 43
49. Mattaliano, M.D., Wooters, J., Shih, H.H.,and Paulsen, J.E.(2010) ROCK2 associates with lectin-like oxidized LDL receptor-1 and mediates oxidized LDL-induced IL-8 production. Am J Physiol - Cell Physiol298(5), 1180–1187. 50. Hofnagel, O., Luechtenborg, B., Stolle, K., Lorkowski, S., Eschert, H., Plenz, G., et al.(2004) Proinflammatory Cytokines Regulate LOX-1 Expression in Vascular Smooth Muscle Cells. Arterioscler Thromb Vasc Biol 24(10), 1789–1795. 20 ACS Paragon Plus Environment
Page 20 of 24
Page 21 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1 2 3 4 5 6 7 8 9
Biochemistry
51. Arjuman, A., and Chandra, N.C. (2014) Differential pro-inflammatory responses of TNF-α receptors (TNFR1 and TNFR2) on LOX-1 signalling. Mol Biol Rep42(6), 1039–1047. 52. Minami, M., Kume, N., Kataoka, H., Morimoto, M., Hayashida, K., Sawamura, T., et al.(2000) Transforming Growth Factor-β1 Increases the Expression of Lectin-like Oxidized Low-Density Lipoprotein Receptor-1. Biochem Biophys Res Commun272(2), 357–361.
10 11
53. Mallat, Z., Besnard, S., Duriez, M., Deleuze, V., Emmanuel, F., Bureau, M.F., et al.(1999) Protective role of interleukin-10 in atherosclerosis. Circ Res85(8), 17–24.
12 13 14
54. Mallat, Z., Heymes, C., Ohan, J., Faggin, E., Lesèche, G., and Tedgui, A. (1999) Expression of interleukin-10 in advanced human atherosclerotic plaques: relation to inducible nitric oxide synthase expression and cell death. Arterioscler Thromb Vasc Biol19(3), 611–616.
15 16 17
55.
18 19 20
56. Chen, Q., Reis, S.E., Kammerer, C., Craig, W.Y., LaPierre, S.E., Zimmer, E.L., et al.(2003) Genetic Variation in Lectin-Like Oxidized Low-Density Lipoprotein Receptor 1 (LOX1) Gene and the Risk of Coronary Artery Disease. Circulation107(25), 3146–3151.
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45
57. Biocca, S., Filesi, I., Mango, R., Maggiore, L., Baldini, F., Vecchione, L., et al. (2008) The splice variant LOXIN inhibits LOX-1 receptor function through hetero-oligomerization. J Mol Cell Cardiol44(3), 561–570.
Rajasingh, J., Bord, E., Luedemann, C., et al. (2006) IL-10-induced TNF-alpha mRNA destabilization is mediated via IL-10 suppression of p38 MAP kinase activation and inhibition of HuR expression. The FASEB Journal20, 2112–2114.
58. Tatsuguchi, M., Furutani, M., Hinagata, J., Tanaka, T., Furutani, Y., Imamura, S., Kawana, M., Masaki, T., Kasanuki, H., Sawamura, T., and Matsuoka, R. (2003) Oxidized LDL receptor gene (OLR1) is associated with the risk of myocardial infarction. Biochem Biophys Res Commun303, 247–250. 59. Xu, S., Ogura, S., Chen, J., Little, P.J., Moss, J., and Liu, P., (2013) LOX-1 in atherosclerosis: biological functions and pharmacological modifiers. Cell Mol Life Sci 70(16),2859-2872. 60. Ishigaki, Y., Katagiri, H., Gao, J., Yamada, T., Imai, J., Uno, K., et al.(2008) Impact of Plasma Oxidized Low-Density Lipoprotein Removal on Atherosclerosis. Circulation 118(1), 75–83. 61. Xu, S., Liu, Z., Huang, Y., Le, K., Tang, F., Huang, H., Ogura, S., Little, P., Shen, X., and Liu, P.(2012) Tanshinone II-A inhibits oxidized LDL-induced LOX-1 expression in macrophages by reducing intra-cellular superoxide radical generation and NF-κB activation. Transl Res.160(2),114–124. 62. Kang, B.Y., Khan, J.A., Ryu, S., Shekhar, R., Seung, K.B., and Mehta, J.L. (2010) Curcumin reduces angiotensin II mediated cardiomyocyte growth via LOX-1 inhibition. J Cardiovasc Pharmacol 55(2), 176–183.
21 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1 2 3 4 5 6 7 8 9
63. Guan, S., Wang, B., Li, W., Guan, J., and Fang, X. (2010) Effects of berberine on expression of LOX-1 and SR-BI in human macrophage-derived foam cells induced by ox-LDL. Am J Chin Med.38(6), 1161–1169. 64. Chang, H.C., Chen, T.G., Tai, Y.T., Chen, T.L., Chiu, W.T.,and Chen, R.M.(2011) Resveratrol attenuates oxidized LDL-evoked Lox-1 signaling and consequently protects against apoptotic insults to cerebrovascular endothelial cells. J Cereb Blood Flow Metab 31(3), 842–854.
10 11 12 13 14 15 16 17
65. Kang, B.Y., Wang, W., Palade, P., Sharma, S.G., and Mehta, J.L.(2009) Cardiac hypertrophy during hypercholesterolemia and its amelioration with rosuvastatin and amlodipine. J Cardiovasc Pharmacol 54(4), 327–334.
18 19 20
67. Takedatsu, H., Mitsuyama, K., Mochizuki, S., Kobayashi, T., Sakurai, K., Takeda, H., et al.(2012) A new therapeutic approach using a schizophyllan-based drug delivery system for inflammatory bowel disease. Mol Ther J Am Soc Gene Ther 20(6), 1234–1241.
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
68. Ding, Z., Wang, X., Khaidakov, M., Liu, S., and Mehta, J.L.(2012) MicroRNA hsa-let-7g targets lectin-like oxidized low-density lipoprotein receptor-1 expression and inhibits apoptosis in human smooth muscle cells. Exp Biol Med Maywood Nj 237(9), 1093–1100.
41 42
73. Cao, W., Calabro, V., Root, A., Yan, G., Lam, K., Olland, S., et al.(2009) Oligomerization is required for the activity of recombinant soluble LOX-1. Febs J 276(17), 4909–4920.
43 44 45
74. Akamatsu, T., Dai, H., Mizuguchi, M., Goto, Y., Oka, A., and Itoh, M.(2014) LOX-1 Is a Novel Therapeutic Target in Neonatal Hypoxic-Ischemic Encephalopathy. Am J Pathol 184(6), 1843–1852.
66. Li, D., Liu, L., Chen, H., Sawamura, T., Ranganathan, S., and Mehta, J.L. (2003) LOX-1 mediates oxidized low-density lipoprotein-induced expression of matrix metalloproteinases in human coronary artery endothelial cells. Circulation 107(4), 612–617.
69. Sugimoto, K., Ishibashi, T., Sawamura, T., Inoue, N., Kamioka, M., Uekita, H., et al.(2009) LOX-1-MT1-MMP axis is crucial for RhoA and Rac1 activation induced by oxidized lowdensity lipoprotein in endothelial cells. Cardiovasc Res 84(1), 127–136.
70. Disclosed and Protected by Indian Patent Application No. 1035/DEL/2015 71. Cominacini, L., Rigoni, A., Pasini, A.F., Garbin, U., Davoli, A., Campagnola, M., et al. (2001) The binding of oxidized low density lipoprotein (ox-LDL) to ox-LDL receptor-1 reduces the intracellular concentration of nitric oxide in endothelial cells through an increased production of superoxide. J Biol Chem 276(17), 13750–13755. 72. Kang, B.Y., Khan, J.A., Ryu, S., Shekhar, R., Seung, K.B., and Mehta, J.L.(2010) Curcumin reduces angiotensin II-mediated cardiomyocyte growth via LOX-1 inhibition. J Cardiovasc Pharmacol 55(2), 176–183.
22 ACS Paragon Plus Environment
Page 22 of 24
Page 23 of 24
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
1 2 3
75. Amati, F., Diano, L., Vecchione, L., Norata, G.D., Koyama, Y., Cutuli, L., et al.(2012) LOX1 Inhibition in ApoE KO Mice Using a Schizophyllan-based Antisense Oligonucleotide Therapy. Mol Ther — Nucleic Acids. 1(12), 58.
4 5 6
76. Chen, K.C., Hsieh, I.C., His, E., Wang, Y.S., Dai, C.Y., Chou, W.W., et al. (2011) Negative feedback regulation between microRNA let-7g and the oxLDL receptor LOX-1. J Cell Sci 124(Pt 23), 4115–4124.
7 8 9 10 11 12 13
77. Fujita, Y., Kakino, A., Nishimichi, N., Yamaguchi, S., Sato, Y., Machida, S., et al.(2009) Oxidized LDL receptor LOX-1 binds to C-reactive protein and mediates its vascular effects. Clin Chem 55(2), 285–294.
14 15 16
79. Nishizuka, T., Fujita, Y., Sato, Y., Nakano, A., Kakino, A., Ohshima, S., et al.(2011) Procyanidins are potent inhibitors of LOX-1: a new player in the French Paradox. Proc Jpn Acad Ser B Phys Biol Sci. 87, 104–113.
17 18 19 20 21 22 23 24
80. Thakkar, S., Wang, X., Khaidakov, M., Dai, Y., Gokulan, K., Mehta, J.L., and Varughese, K.I. (2015) Structure-based Design Targeted at LOX-1, a Receptor for Oxidized Low-Density Lipoprotein. Scientific Reports. 5, 16740.
78. Lu, J., Yang, J.H., Burns, A.R., Chen, H.H., Tang, D., Walterscheid, J.P., et al.(2009) Mediation of electronegative low-density lipoprotein signaling by LOX-1: a possible mechanism of endothelial apoptosis. Circ Res 104(5), 619–627.
81. Hung, C.H., Chan, S.H., Chu, P.M., Lin, H.C., and Tsai, L. (2016) Metformin regulates oxLDL-facilitated endothelial dysfunction by modulation of SIRT1 through repressing LOX1-modulated oxidative signaling. Oncotarget 7(10) , 10773-10787.
25 26 27 28 29 30 31 32 33 34 23 ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
Page 24 of 24
For table on content use only
2
Lectin like oxidized LDL receptor (LOX-1): A chameleon receptor for oxLDL
3
Bushra Zeya, Albina Arjuman, Nimai Chand Chandraξ.
4 oxLDL
TNFα
IL 10
oxLDL
LOX-1
LOX-1
oxLDL
IL 6
oxLDL
LOX-1
TNFR oxLDL
ONOO-
Endocytosis : Antiatherogenic response
[Active
ROS
LOXIN (lacking exon 5)
NFκβ] ROS mRNA
IL 6 mRNA
TNFα
mRNA
Nucleus Cytoplasm Transcription of proatherogenic molecules
5 6 7
8 9
Graphics in large scale
10
oxLDL TNFα oxLDL oxLDL IL 6 IL 10
LOX-1
LOX-1
oxLDL
LOX-1
TNFR oxLDL
LOXIN (lacking exon 5)
ONOO- ROS
Endocytosis : Antiatherogenic response
[Active NFκβ]
ROS mRNA
IL 6 mRNA
TNFα mRNA
Nucleus Cytoplasm Transcription of proatherogenic molecules
11 12
24 ACS Paragon Plus Environment
