Communication Cite This: J. Am. Chem. Soc. 2018, 140, 16048−16052
pubs.acs.org/JACS
Light-Driven ATP Transmembrane Transport Controlled by DNA Nanomachines Pei Li,†,‡,⊥ Ganhua Xie,†,⊥ Pei Liu,†,§ Xiang-Yu Kong,*,† Yanlin Song,∥ Liping Wen,*,†,§ and Lei Jiang†,‡,§
J. Am. Chem. Soc. 2018.140:16048-16052. Downloaded from pubs.acs.org by UNIV OF WINNIPEG on 11/29/18. For personal use only.
†
CAS Key Laboratory of Bio-Inspired Materials and Interfacial Science, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190, People’s Republic of China ‡ Key Laboratory of Bio-Inspired Smart Interfacial Science and Technology of Ministry of Education School of Chemistry, Beihang University, Beijing 100191, People’s Republic of China § School of Future Technology, University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of China ∥ Key Laboratory of Green Printing, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190, People’s Republic of China S Supporting Information *
channel-mediated ATP facilitated transport to develop a new modulated system that performs a light-regulated transmembrane capture-release-transport of target biomolecules through the artificial nanochannels (Scheme 1a). Critical
ABSTRACT: In nature, biological machines can perform sophisticated and subtle functions to maintain the metabolism of organisms. Inspired from these gorgeous works of nature, scientists have developed various artificial molecular motors and machines. However, selective transport of biomolecules across membrane has remained a great challenge. Here, we establish an ATP transport system by assembling photocontrolled DNA nanomachines into the artificial nanochannels. With alternant light irradiation, these ATP transport lines can selectively shepherd cargoes across the polymer membrane. These findings point to new opportunities for manipulating and improving the mass transportation and separation with light-controlled biomolecular motors, and can be used for other molecules and ions transmembrane transport powered by light.
Scheme 1. Scheme of Light-Driven ATP Transmembrane Transporta
A
denosine triphosphate (ATP) as the canonical energy carrier powers cellular machines, drives metabolic reactions and serves as transmitter molecules in many physiological and pathological body functions.1−4 Via membrane-spanning ATP carrier proteins,5−8 intracellular ATP can be transported to extracellular fluid where it spreads by body fluid circulation and performs its functions.5,9−11 Therefore, it will be of great interest to investigate the channel-mediated ATP facilitated transport with biological and bionic methods for biological machine exploring.1,11 Natural biochemical machinery has been a source of inspiration in the development of artificial molecular machines that emulate the structure and function of their biological counterparts.12−14 Over the past decades, scientists have developed various biomimetic molecular machines, such as “molecular pump”,15 “molecular elevator”16 and “nanocars”.17 However, the selective transport of biomolecules across membrane has remained out of reach by these artificial machines, which is of great significance in facilitating the metabolic reactions and potentially applied in separation and refinement fields. Here we draw inspiration from biological © 2018 American Chemical Society
a
(a) The transport of biomolecules across the membranes under different light irradiation with aptamer-decorated nano-structures. (b) Schematic illustration of the machine-like behavior of the Azo-DNA aptamer functionalized system controlled by lights, which is similar to teddy picker. Yellow and pink colored parts represent the Azo and ATP molecule, respectively.
components for our biosystem include (1) the conical polyimide (PI) nanochannels, utilized as templates and (2) light controlled nanomachines, which can continuously capture and release the biomolecules (ATP) with selectivity and reversibility (Scheme 1b). Under alternant light irradiation, the light-controlled transport lines can shepherd cargoes across the polymer membrane, which is different from the well-developed Received: September 29, 2018 Published: October 29, 2018 16048
DOI: 10.1021/jacs.8b10527 J. Am. Chem. Soc. 2018, 140, 16048−16052
Communication
Journal of the American Chemical Society
Under irradiation with vis-light (450 nm, 14 mW cm−2), the planar trans-azobenzene in the backbone of DNA is capable of stabilizing the DNA duplex to form a hairpin structure by stacking with the adjacent base pairs. The hairpin structure of the DNA aptamer can be further stabilized by capturing two ATP molecules with KD = 2.34 ± 1.02 μM (Figures S1 and S2),33−35 which is supported by the clear positive/negative Cotton effect in the circular dichroism (CD) spectra (Figure 1b, Figure S3 and S4). UV light (365 nm, 6 mW cm−2) will induce a nonplanar cis-isomer of Azo- groups, which destabilizes the duplex to be a collapsed structure and release the ATP molecules due to steric hindrance (Figure S1b). By undergoing light-induced isomerization and nanomechanical change, Azo-DNA switches between refolding and unfolding states, along with capturing and releasing ATP molecules (Figure S1ab), which may have versatile applications in, for example, light-driven nanostructures and nanodevices.36 By asymmetrically ion-track-etching a PI membrane, the conical nanochannels were fabricated with ∼570 nm large opening (Base) (Figure 1c) and ∼23 nm narrow side (Tip) (Figure S5).19 After Azo-DNA modification, the transmembrane ion conductance of the nanochannels decreased drastically from about 17.83 to 0.31 nS (n = 100, Figure 1d) due to the blockage of DNA strands, which is consistent with the change of I−V curves measured at 0.1 M KCl (Figure S6). Besides, the blockage of DNA strands can be also visualized by confocal microscope after grafting the modified Azo-DNA with fluorophore (rhodamine green) (Figure 1e). These results, coupled with new peak P2p of the modified PI membrane in X-ray photoelectron spectroscopy (XPS) (Figure S7a), proved that the Azo-DNA has been successfully grafted onto the surface of the conical nanochannels. We used an electrochemical method to monitor the photocontrolled capture-state and release-state. Initially, the aptamer-modified nanochannels were immersed into solutions with or without ATP. After cleaning with deionized water, the ionic transport properties of the nanochannels were measured with 0.1 M KCl electrolyte. This ionic current mainly originates from the K+ ions transport through the membrane and the magnitude of the ionic current will reflect the state of the nanopores and thus the configuration change of the aptamer on the pore surface. Through measuring the currents with the voltage scanning from 0 to −2 V, the channel showed characteristic electronic signatures at different states of the channel (Figure 2a). When treated with vis-light and ATP (1 μM), the stretched DNA captured ATP molecules to form the stable hairpin structure, which increased the effective pore size of the nanochannel and corresponding ionic current (22 nA, at −2 V), labeled as capture state. After UV light irradiation, ATP molecules would be released from the hairpin structures and the DNA conformation recover to the random single-stranded structure correspondingly, which partially blocked the nanochannels and decreased the ionic current (3 nA, at −2 V), labeled as release state. Additionally, the photocontrolled folding and unfolding process of the DNA is reversible and allows the repeated capture-release processing of ATP molecules in the nanochannels (Figure 2b), which endowed the ATP transmembrane transport by the continuously capturing and releasing process. To study and systematically quantify the total binding capacity of the biomolecule transporting system, we treated the membrane in solutions with increasing concentrations of ATP (from 0, 1, 10, 102, 103, 104, 105 to 106 pM), then measured
light-gated nanopores that control the conductive states of the pores.18,19 In recent years, the development of biomolecular motors toward the construction of sensors, actuators and transporters has made tremendous progress.20,21 Among these biomolecular motors, DNA-based nanomachines attract increasing attention for the facile programmability and biocompatibility of DNA blocks, which are used as a scaffold for nanobodies such as tweezers, walkers, and gears.22−25 For example, various functional DNA nanomachines have been modified onto the inner surfaces of nanochannels and nanopores as sensor or gate powered by external fuels.26−28 However, most of the fuel to these motors will result in contamination accumulation in the reaction system and thus retard driving efficiency.25 Light as one of noncontact stimuli does not bring contamination into the system, which makes it attractive for spatiotemporal control of biomotors.29,30 Since Asanuma and co-workers covalently introduced azobenzene (Azo) to DNA as a molecular photon engine, Azo-DNA has been widely utilized for its easy synthesis and functionalization.31,32 In this work, we assembled such a light-responsive DNA-aptamer-based system to selectively and repetitively capture and release ATP. The key functional component of this system is realized by introducing the photoresponsive Azo- groups into ATP aptamer (5′-(NH 2 )(CH 2 ) 6 TTACCTGGGGGAGTATTGCGGAGGA(Azo)AG(Azo)GT(Azo)AA-3′), which can be characterized by observing a new peak in UV/vis spectra (Figure 1a).
Figure 1. Property characterizations of Azo-DNA aptamer for ATP and PI nanochannels. (a) Absorbance spectra of DNA and photoswitchable Azo-DNA under different isomeric states on exposure to specific wavelengths of light for 3 min. (b) Circular dichroism spectra of Azo-DNA after capturing and releasing ATP molecules. (c) SEM image of the base side of nanochannels. (d) Conductance of modified and unmodified nanochannels. (e) Confocal microscopy images of the membrane before and after fluorescent tags aptamer modification. 16049
DOI: 10.1021/jacs.8b10527 J. Am. Chem. Soc. 2018, 140, 16048−16052
Communication
Journal of the American Chemical Society
other half is filled with pure water (receptor compartment). There is a quartz window on each of the bath for irradiation. After continuously performing the alternative UV and visible irradiation for 5 min, the amount of the transmembrane transported ATP was recorded as shown in Figure S9. A small amount of liquid was taken from the receptor compartment every 1 h for ATP concentration assay, meanwhile supplemented with the same amount of pure water. The level of ATP in reception bath was determined using a firefly luciferase-based ATP assay kit.38,39 We found that the amount of the transported ATP increased in the first 6 h and formed a platform from 7 to 14 h, which indicated that the ATP transporting system has achieved a steady state (Figure 3a and Figure S10). To eliminate the
Figure 2. ATP capturing and releasing properties of Azo-DNA functionalized nanochannels. (a) I−V curves of the functional nanochannel in the ATP capture and release states, respectively. (b) Stability and reversibility of the photodriven Azo-DNA functionalized nanochannel. (c) Relationship between the current (at −2 V) and the concentration of ATP before and after aptamer modification. (d) I−V curves and corresponding current change ratios (inset) of Azo-DNA modified nanochannel after the addition of ATP, CTP, GTP and UTP, respectively.
the changes of the transmembrane ionic currents. As shown in Figure 2c, the measured current signals enhanced with the increasing ATP concentration and eventually leveled off to a plateau of 104 pM. This value represents the maximum binding capacity of the nanofluidic transporting system with the given characteristics. Besides, we can also calculate the minimum capturing concentration to be 0.251 pM (Figure S8), representing the transporting limit of this functional system. Meanwhile, the control experiment of the unmodified nanochannel did not produce detectable levels of ionic current changes with ATP treatment. Taken together, our system can capture and release the target biomolecule from solutions in a broad range of concentrations. To evaluate whether the DNA aptamer modified nanochannels were specific for ATP, competition experiments were performed by treating the functional membrane in solutions containing ATP analogues: cytosine triphosphate (CTP), guanidine triphosphate (GTP) and uridine triphosphate (UTP) (Figure 2d). Significantly higher current was observed with the target ATP than its analogues. The inset in Figure 2d shows the capture ratio (defined as I/I0, where I and I0 are the currents at −2 V before and after nucleosides treatment, respectively) of different nucleosides treated nanochannels. Only in the presence of ATP could the artificial system show a significantly high capture ratio up to 36. In comparison, the capture ratios of the other nucleosides were very small (∼1). The above experiments proved that only ATP increased the transmembrane ionic currents, supporting the contention that the aptamer is specific for ATP.37 Thereafter, we demonstrate the transmembrane transport of ATP molecules in this system with light-driven transporting lines. The transportation of ATP is realized in a bath, in which the polymer membrane (before and after modification) separates the two halves of the bath. One half of the bath is filled with ATP solution (10 μM, feed compartment) and the
Figure 3. Transport capacity of the photocontrolled system. (a) ATP concentration changes of the receptor compartment in the Azo-DNA aptamer modified (triangles) and unmodified (circles) system under alternated light irradiation with time from 1 to 14 h. (b) Transport rates of ATP molecules in the Azo-DNA aptamer modified (triangles) and unmodified (circles) systems. The inset: amplified concentration−time curves of both systems, which are linear and used to calculate the transport rate.
possibility that the ATP molecules detected in the receptor compartment were resulted from the Brownian motion induced diffusion, a control experiment was conducted with unmodified nanochannels. At the same conditions as the above experiments, nonsignificant ATP concentration changes were found in the receptor compartment (Figure 3a). Therefore, the functionalized light-responsive nanomachines facilitate ATP transport through the artificial channels. We further summarized the ATP transport rates of the Azo-DNA aptamer modified nanochannels and control experiment on the basis of the good linear relationship between the ATP concentration and time over the range of 1−6 h (Figure 3b and inset). Compared with unmodified system (2.15 nmol h−1 cm−2), the transport rate of the aptamer modified membrane can be up to 59.79 nmol h−1 cm−2. Under the alternative visible light and UV light irradiation, the modified Azo-DNA aptamers on the 16050
DOI: 10.1021/jacs.8b10527 J. Am. Chem. Soc. 2018, 140, 16048−16052
Journal of the American Chemical Society
■
pore surface act like claws for capturing and releasing ATP, separately (Scheme 1b). With this machine-like behavior, ATP molecules are accumulated in the nanochannels and ultimately transported into the receptor compartment induced by the amplified concentration gradient. In summary, we have designed and tested a bioinspired modulated biomolecule transport system that uniquely couples light-manipulated nanoactuation with DNA aptamer unfolding and refolding for biomolecule capture-release-transport process, and offers the nondestructive transportation of specific molecules across the membrane through a robust and tunable process. Compared with other smart artificial nanofluidic systems without selectivity and convenient means of reversible control,19,40−43 this system can exploit coupled chemistries in a nanofluidic system to yield continuous biomolecule transport across long distance nanospaces under light irradiation. The variability and tunability of geometry and material of the artificial nanochannels, and the DNA or RNA aptamers make this system a broad-based, customizable, photocontrolled platform for multiple applications. Such a general platform can be functionalized with various photoresponsive aptamers. Systematic evolution of ligands by exponential enrichment allows the easy identification of aptamer sequences that selectively bind to target biomolecules, small molecules, ions and even cancer cells.44−46 Therefore, by functionalizing the Azo- modified aptamer onto the pore surface of the nanochannels, our platform can be used to transport a broad range of molecules, ions and even cancer cells, which makes it applicable to various fields such as drug separation, ion pumps and cancer therapy.
■
REFERENCES
(1) Dahl, G. ATP release through pannexon channels. Philos. Trans. R. Soc., B 2015, 370 (1672), 20140191. (2) Burnstock, G. Purinergic signalling and disorders of the central nervous system. Nat. Rev. Drug Discovery 2008, 7 (7), 575−590. (3) Burnstock, G. Current state of purinoceptor research. Pharm. Acta Helv. 1995, 69 (4), 231−242. (4) Burnstock, G. Purinergic mechanisms. Ann. N. Y. Acad. Sci. 1990, 603, 1−18. (5) Taruno, A.; Vingtdeux, V.; Ohmoto, M.; Ma, Z.; Dvoryanchikov, G.; Li, A.; Adrien, L.; Zhao, H.; Leung, S.; Abernethy, M.; Koppel, J.; Davies, P.; Civan, M. M.; Chaudhari, N.; Matsumoto, I.; Hellekant, G.; Tordoff, M. G.; Marambaud, P.; Foskett, J. K. CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes. Nature 2013, 495 (7440), 223−226. (6) Cotrina, M. L.; Lin, J. H. C.; Lopez-Garcia, J. C.; Naus, C. C. G.; Nedergaard, M. ATP-mediated glia signaling. J. Neurosci. 2000, 20 (8), 2835−2844. (7) Bao, L.; Locovei, S.; Dahl, G. Pannexin membrane channels are mechanosensitive conduits for ATP. FEBS Lett. 2004, 572 (1−3), 65−68. (8) Liu, H.-T.; Toychiev, A. H.; Takahashi, N.; Sabirov, R. Z.; Okada, Y. Maxi-anion channel as a candidate pathway for osmosensitive ATP release from mouse astrocytes in primary culture. Cell Res. 2008, 18 (5), 558−565. (9) Billaud, M.; Sandilos, J. K.; Isakson, B. E. Pannexin 1 in the Regulation of Vascular Tone. Trends Cardiovasc. Med. 2012, 22 (3), 68−72. (10) Murali, S.; Zhang, M.; Nurse, C. A. Angiotensin II mobilizes intracellular calcium and activates pannexin-1 channels in rat carotid body type II cells via AT(1) receptors. J. Physiol. 2014, 592 (21), 4747−4762. (11) Li, A.; Leung, C. T.; Peterson-Yantorno, K.; Mitchell, C. H.; Civan, M. M. Pathways for ATP release by bovine ciliary epithelial cells, the initial step in purinergic regulation of aqueous humor inflow. Am. J. Physiol. Cell Physiol. 2010, 299 (6), C1308−C1317. (12) Wie, J. J.; Shankar, M. R.; White, T. J. Photomotility of polymers. Nat. Commun. 2016, 7, 13260. (13) Takashima, Y.; Hatanaka, S.; Otsubo, M.; Nakahata, M.; Kakuta, T.; Hashidzume, A.; Yamaguchi, H.; Harada, A. Expansioncontraction of photoresponsive artificial muscle regulated by hostguest interactions. Nat. Commun. 2012, 3, 1270. (14) Erbas-Cakmak, S.; Leigh, D. A.; McTernan, C. T.; Nussbaumer, A. L. Artificial Molecular Machines. Chem. Rev. 2015, 115 (18), 10081−10206. (15) Cheng, C.; McGonigal, P. R.; Schneebeli, S. T.; Li, H.; Vermeulen, N. A.; Ke, C.; Stoddart, J. F. An artificial molecular pump. Nat. Nanotechnol. 2015, 10 (6), 547−553. (16) Badjic, J. D.; Balzani, V.; Credi, A.; Silvi, S.; Stoddart, J. F. A molecular elevator. Science 2004, 303 (5665), 1845−1849. (17) Peplow, M. March of the machines. Nature 2015, 525 (7567), 18−21. (18) Xie, G. H.; Li, P.; Zhao, Z. J.; Zhu, Z. P.; Kong, X. Y.; Zhang, Z.; Xiao, K.; Wen, L. P.; Jiang, L. Light- and Electric-Field-Controlled Wetting Behavior in Nanochannels for Regulating Nanoconfined Mass Transport. J. Am. Chem. Soc. 2018, 140 (13), 4552−4559. (19) Li, P.; Xie, G.; Kong, X. Y.; Zhang, Z.; Xiao, K.; Wen, L.; Jiang, L. Light-Controlled Ion Transport through Biomimetic DNA-Based Channels. Angew. Chem., Int. Ed. 2016, 55 (50), 15637−15641. (20) Hess, H.; Bachand, G. D. Biomolecular motors. Mater. Today 2005, 8 (12), 22−29. (21) Hess, H.; Vogel, V. Molecular shuttles based on motor proteins: active transport in synthetic environments. Rev. Mol. Biotechnol. 2001, 82 (1), 67−85. (22) Alberti, P.; Mergny, J.-L. DNA duplex−quadruplex exchange as the basis for a nanomolecular machine. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (4), 1569−1573.
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/jacs.8b10527.
■
Communication
Experimental details (PDF)
AUTHOR INFORMATION
Corresponding Authors
*
[email protected] *
[email protected] ORCID
Xiang-Yu Kong: 0000-0002-4475-2162 Yanlin Song: 0000-0002-0267-3917 Liping Wen: 0000-0001-8546-8988 Author Contributions ⊥
These authors contributed equally.
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Prof. Fan Xia and Prof. Pengcheng Gao for useful discussions. This work was supported by the National Key R&D Program of China (2017YFA0206904, 2017YFA0206900), the National Natural Science Foundation (21625303, 51673206, 21434003), the Key Research Program of the Chinese Academy of Sciences (QYZDY-SSW-SLH014), the Excellence Foundation of BUAA for PhD Students (2017067), and the National Postdoctoral Program for Innovative Talents (BX20180317). 16051
DOI: 10.1021/jacs.8b10527 J. Am. Chem. Soc. 2018, 140, 16048−16052
Communication
Journal of the American Chemical Society (23) Yurke, B.; Turberfield, A. J.; Mills, A. P.; Simmel, F. C.; Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature 2000, 406 (6796), 605−608. (24) Tian, Y.; Mao, C. Molecular Gears: A Pair of DNA Circles Continuously Rolls against Each Other. J. Am. Chem. Soc. 2004, 126 (37), 11410−11411. (25) Shin, J.-S.; Pierce, N. A. A Synthetic DNA Walker for Molecular Transport. J. Am. Chem. Soc. 2004, 126 (35), 10834−10835. (26) Li, X. C.; Zhai, T. Y.; Gao, P. C.; Cheng, H. L.; Hou, R. Z.; Lou, X. D.; Xia, F. Role of outer surface probes for regulating ion gating of nanochannels. Nat. Commun. 2018, 9, 40. (27) Gao, P.; Hu, L.; Liu, N.; Yang, Z.; Lou, X.; Zhai, T.; Li, H.; Xia, F. Functional ″Janus″ Annulus in Confined Channels. Adv. Mater. 2016, 28 (3), 460−465. (28) Guo, W.; Hong, F.; Liu, N.; Huang, J.; Wang, B.; Duan, R.; Lou, X.; Xia, F. Target-Specific 3D DNA Gatekeepers for Biomimetic Nanopores. Adv. Mater. 2015, 27 (12), 2090−2095. (29) Kuzyk, A.; Yang, Y.; Duan, X.; Stoll, S.; Govorov, A. O.; Sugiyama, H.; Endo, M.; Liu, N. A light-driven three-dimensional plasmonic nanosystem that translates molecular motion into reversible chiroptical function. Nat. Commun. 2016, 7, 10591. (30) Mayer, G.; Heckel, A. Biologically Active Molecules with a “Light Switch. Angew. Chem., Int. Ed. 2006, 45 (30), 4900−4921. (31) Asanuma, H.; Liang, X.; Nishioka, H.; Matsunaga, D.; Liu, M.; Komiyama, M. Synthesis of azobenzene-tethered DNA for reversible photo-regulation of DNA functions: hybridization and transcription. Nat. Protoc. 2007, 2 (1), 203−212. (32) Asanuma, H.; Ito, T.; Yoshida, T.; Liang, X. G.; Komiyama, M. Photoregulation of the formation and dissociation of a DNA duplex by using the cis-trans isomerization of azobenzene. Angew. Chem., Int. Ed. 1999, 38 (16), 2393−2395. (33) Xia, T.; Yuan, J.; Fang, X. Conformational Dynamics of an ATP-Binding DNA Aptamer: A Single-Molecule Study. J. Phys. Chem. B 2013, 117, 14994−15003. (34) Lin, C. H.; Patei, D. J. Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP. Chem. Biol. 1997, 4 (11), 817−832. (35) Huizenga, D. E.; Szostak, J. W. A DNA aptamer that binds adenosine and ATP. Biochemistry 1995, 34 (2), 656−665. (36) Kamiya, Y.; Asanuma, H. Light-driven DNA nanomachine with a photoresponsive molecular engine. Acc. Chem. Res. 2014, 47 (6), 1663−1672. (37) Lu, C.-H.; Li, J.; Lin, M.-H.; Wang, Y.-W.; Yang, H.-H.; Chen, X.; Chen, G.-N. Amplified Aptamer-Based Assay through Catalytic Recycling of the Analyte. Angew. Chem., Int. Ed. 2010, 49 (45), 8454− 8457. (38) Li, N.; Zhang, C.-X.; Wang, X.-X.; Zhang, L.; Ma, X.; Zhou, J.; Ju, R.-J.; Li, X.-Y.; Zhao, W.-Y.; Lu, W.-L. Development of targeting lonidamine liposomes that circumvent drug-resistant cancer by acting on mitochondrial signaling pathways. Biomaterials 2013, 34 (13), 3366−3380. (39) Zhang, X.; Zuo, X.; Yang, B.; Li, Z.; Xue, Y.; Zhou, Y.; Huang, J.; Zhao, X.; Zhou, J.; Yan, Y.; Zhang, H.; Guo, P.; Sun, H.; Guo, L.; Zhang, Y.; Fu, X.-D. MicroRNA Directly Enhances Mitochondrial Translation during Muscle Differentiation. Cell 2014, 158 (3), 607− 619. (40) Zhang, Z.; Xie, G.; Xiao, K.; Kong, X.-Y.; Li, P.; Tian, Y.; Wen, L.; Jiang, L. Asymmetric Multifunctional Heterogeneous Membranes for pH- and Temperature-Cooperative Smart Ion Transport Modulation. Adv. Mater. 2016, 28 (43), 9613−9619. (41) Perez-Mitta, G.; Marmisolle, W. A.; Trautmann, C.; ToimilMolares, M. E.; Azzaroni, O. Nanofluidic Diodes with Dynamic Rectification Properties Stemming from Reversible Electrochemical Conversions in Conducting Polymers. J. Am. Chem. Soc. 2015, 137 (49), 15382−15385. (42) Sun, Y.; Ma, J.; Zhang, F.; Zhu, F.; Mei, Y.; Liu, L.; Tian, D.; Li, H. A light-regulated host-guest-based nanochannel system inspired by channelrhodopsins protein. Nat. Commun. 2017, 8 (1), 260.
(43) Wen, L.; Tian, Y.; Ma, J.; Zhai, J.; Jiang, L. Construction of biomimetic smart nanochannels with polymer membranes and application in energy conversion systems. Phys. Chem. Chem. Phys. 2012, 14 (12), 4027−4042. (44) Willner, I.; Shlyahovsky, B.; Zayats, M.; Willner, B. DNAzymes for sensing, nanobiotechnology and logic gate applications. Chem. Soc. Rev. 2008, 37 (6), 1153−1165. (45) Wang, F.; Liu, X.; Willner, I. DNA Switches: From Principles to Applications. Angew. Chem., Int. Ed. 2015, 54 (4), 1098−1129. (46) Lu, C.-H.; Willner, I. Stimuli-Responsive DNA-Functionalized Nano-/Microcontainers for Switchable and Controlled Release. Angew. Chem., Int. Ed. 2015, 54 (42), 12212−12235.
16052
DOI: 10.1021/jacs.8b10527 J. Am. Chem. Soc. 2018, 140, 16048−16052
