Article pubs.acs.org/journal/abseba
Lineage Specific Differentiation of Magnetic Nanoparticle-Based Size Controlled Human Embryoid Body Boram Son,† Jeong Ah Kim,‡ Sungwoo Cho,† Gun-Jae Jeong,† Byung Soo Kim,† Nathaniel S. Hwang,*,† and Tai Hyun Park*,† †
School of Chemical and Biological Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742, Republic of Korea ‡ Biomedical Omics Group, Korea Basic Science Institute, Cheongju, Chungbuk 28119, Republic of Korea S Supporting Information *
ABSTRACT: Human embryonic stem cells (hESCs) possess unique properties in terms of self-renewal and differentiation, which make them particularly well-suited for use in tissue engineering and regenerative medicine. The differentiation of hESCs in the form of human embryoid bodies (hEBs) recapitulates early embryonic development, and hEBs may provide useful insight into the embryological development of humans. Herein, cell-penetrating magnetic nanoparticles (MNPs) were utilized to form hEBs with defined sizes and the differentiation patterns were analyzed. Through intracellular delivery of MNPs into the hESCs, suspended and magnetized hESCs efficiently clustered in to hEBs driven by magnetic pin-based external magnetic forces. The hEB size was controlled by varying the suspended cell numbers that were applied in the magnetic pin system. After 3 days of differentiation in a suspended condition, ectodermal differentiation was observed to have been enhanced in the small hEBs (150 μm in diameter) while endodermal and mesodermal differentiation were enhanced in large hEBs (600 μm in diameter). This indicates that the size of the hEBs plays an important role in the early lineage commitment of hESCs, and MNP-based control of the hEB size would be a novel, useful methodology for lineage-specific hESC differentiation. KEYWORDS: human embryonic stem cells, embryoid bodies, EB size control, lineage-specific differentiation, magnetic nanoparticles
1. INTRODUCTION Stem cells have been investigated for tissue regeneration, and the development of stem-based treatments for incurable diseases is thought to be promising.1−3 In particular, human embryonic stem cells (hESCs) have been applied in regenerative medicine because of their unique ability for differentiation.4−6 Under defined conditions, hESCs can differentiate into various terminally differentiated cell types.7,8 In spite of their prospective characteristics, hESCs are difficult to use in clinical applications as immune-related complications that may arise after stem cell injection along with tumor formation as a result of heterogeneous differentiation.9−11 To make use of the fascinating properties of hESCs, improved methods need to be developed in order to homogeneously differentiate into targeted cell types.12−14 Recently, hESC differentiation into specific and homogeneous cell types was accomplished. However, achieving a high efficiency with homogeneous differentiation still remains a work in progress.15,16 To improve the control for particular lineages, hESC differentiation makes use of various chemical cues to induce designated signaling pathways.17−20 In addition to such chemical factors, controlling physical cues is also considered as a new means to delicately regulate the fate of the hESCs.21−23 In particular, generating human embryoid bodies (hEBs), cell © XXXX American Chemical Society
aggregates of hESCs, is recognized as an ideal method to efficiently differentiate hESCs.15,24−27 Because hEBs are generated to mimic the morphological similarity of developing embryos, hESCs in the form of hEBs are spontaneously induced into differentiation.28,29 In recent studies, researchers have suggested that the size of hEBs could play a significant role in the directing hESC lineage because hEBs with different diameters have shown distinct differentiation results.30−34 Accordingly, hEB generation has been attempted via various cell-clustering methods, including hanging-drop culture, nonadhesive surface culture, and porous three-dimensional scaffold culture.35−38 However, conventional cell-clustering methods have limits to generating uniformly sized cell aggregates, and therefore microscale techniques have been suggested to achieve a more elaborate regulation.39 Microfluidic devices40−42 and microwells43−46 have been widely used to generate uniform hEBs. However, while there are some limitations in microwells for hEB size control, the MNP-based magnetic pin platform has some advantages to overcome those hurdles. Major advantage of the MNP-based system is that it Received: March 7, 2017 Accepted: July 3, 2017 Published: July 3, 2017 A
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
Five to 7 days after the initial plating, the hESC colonies were mechanically dissociated by modified Pasteur pipettes and replated on a fresh feeder layer. STO was grown and prepared for use as feeder cells as described in previous studies.11,49 In brief, STO was treated with 5 μg mL−1 Mitomycin C (MMC, Sigma, USA) to inactivate the cell division, and then 2 × 105 cells were transferred onto a gelatinized 35 mm dish after detaching via 0.25% trypsin-EDTA (Sigma, USA) to feed the hESCs. To minimize the STO contribution to human embryoid body (hEB) generation, we applied a feeder-free system. The hESCs were then transferred into dishes coated with Geltrex (Gibco, USA) at least 5 days before hEB generation and were cultured in Essential 8 Medium (Gibco, USA) as described in prior studies, without any adverse effects on pluripotency.49,50 The medium for the hESCs with or without feeder was exchanged every single day. 2.3. Cell Viability Analysis. To examine the cytotoxicity of the MNPs on hESCs, we used a Cell Counting Kit-8 (CCK-8, Dojindo, USA) by following the manufacturer’s instruction. In brief, after the incubation of hESCs with MNPs for 24 h at 37 °C in a humidified CO2 incubator, CCK-8 solution was added to cells at a 10% concentration. The absorbance of each well was measured at 450 nm after additional incubation in the incubator for 2 h. To detect the live and dead hESCs in hEBs, LIVE/DEAD cell viability kit (Molecular Probes, USA) was used. The hEBs were treated with a mixed solution of 2 μM calcein AM and 4 μM EthD-1. After incubation for 1 h at 37 °C in a humidified CO2 incubator, green fluorescence for live cells and red fluorescence for dead cells were observed. 2.4. Human Embryoid Body Generation and Differentiation. The hESCs were incubated with 20 μg mL−1 cell-penetrating MNPs for 24 h. The MNP-incorporated hESCs on geltrex-coated dishes were then detached from the plate with Accutase Solution (Millipore, USA) and suspended in hEB medium, which excluded bFGF from standard hESC growth medium. The hESCs, which gained magnet-derived mobility due to the intracellular incorporation of the MNPs, were simply sorted by applying the NdFeB magnets (200 mT) for 1 min. After sorting, the suspended cells in the hEB medium were added into the magnetic pin system, which was manufactured as described in previous work.51 In brief, the lids of 96-well plates were prepared with NdFeB magnets (10 mm × 5 mm × 6 mm) placed on the cover and iron pins attached to the magnets under the lids. 130 mL of cell suspension was added into each well with different cell numbers. The magnetized cells were then driven to move toward the iron pin, at which magnetic force was concentrated (450 mT), resulting in the production of hEBs underneath the medium surface. The hEBs were cultured in suspension for 3 days at 37 °C in a humidified CO2 incubator with hEB medium to induce early differentiation. 2.5. Prussian Blue Staining. The endocytosed MNPs were detected using a Prussian blue staining kit (Sigma, USA) according to the manufacturer’s instruction. After washing the hESCs with PBS, the cells were fixed with 4% paraformaldehyde for 5 min at room temperature. The cells were then washed with distilled water followed by permeabilization using 0.25% Triton X-100 in phosphate buffer saline (PBST) for 10 min at room temperature. After washing with distilled water, the cells were treated with 1:1 mixture of potassium ferrocyanide and hydrochloric acid for 10 min at room temperature. Then, the cells were washed with distilled water and were counterstained with 2% pararosaniline solution for 5 min at room temperature. After washing with distilled water and drying, the cells incorporated with MNPs were observed under microscopy. 2.6. Transmission Electron Microscopy Analysis. The MNPs endocytosed in hESCs were observed via transmission electron microscopy (TEM). After incubation with 20 μg mL−1 cell-penetrating MNPs, the hESCs were fixed with paraformaldehyde-glutaraldehyde solution (Karnovsky’s Fixative) for 2 h at 4 °C. The cells were then washed with 0.05 M sodium cacodylate buffer. Subsequently, the cells were fixed with 2% osmium tetroxide with 0.1 M cacodylate buffer for 2 h and washed using distilled water, followed by overnight 0.5% uranyl acetate treatment for negative staining at 4 °C. After serial dehydration with sequentially concentrated ethanol from 30% to
can instantaneously assemble the hESCs to make various size of hEBs. Shorter incubation time is critical because nonadherent cells may undergo apoptosis during incubation. Moreover, compared with microwells, precise regulation of the hEB size is possible through the MNP-based system, resulting in uniform hEB generation. Antiapoptotic assistants such as ROCK inhibitor are vital in microwells because the hESCs are prone to apoptosis when they are detached to be single cells. However, hEBs can be generated and differentiated successfully using the MNP-based magnetic pin platform without the assistance of antiapoptotic factors. In this study, we utilized magnetic force-induced assembly of hESCs to hEBs with uniform size distribution. This precise formation based on magnetic control allowed facile and prompt hEB generation. It also facilitates high-throughput and largescale hEB generation. This advanced hEB generation method improves cell-to-cell contact by external magnetic force and thus, the size of fabricable hEB was wide in range (up to 600 μm) without assistance of ROCK inhibitor. Furthermore, the hEB size can be controlled with accurate cell numbers because the percentage of the aggregated cells among total cells added in a well constantly remained at 85%. As a result, the effect of the hEB size on early commitments of the hESCs can be easily detected, and a more homogeneous cell population can be obtained in terms of the specific germ lineage.
2. MATERIALS AND METHODS 2.1. Preparation of Magnetic Nanoparticles. Ferromagnetic nanoparticles (MNPs, Fe3O4) gained from anaerobic magnetotactic bacterium, Magnetospirillum sp. AMB-1 were utilized to magnetize the hESCs through intracellular incorporation. The magnetic bacteria were cultured in magnetic spirillum growth medium (MSGM), as previously described.47,48 In brief, bacteria were anaerobically fermented for 5 days at 27 °C. After cell gathering via 11 300 × g centrifugation for 20 min, the bacterial cells were ruptured via sonication with 35% amplification for 15 min (VCX500, Sonics & Materials, USA). The MNPs were isolated from the blended solution using neodymium− iron-boron (NdFeB) magnets. The NdFeB magnets were attached beneath the Petri dishes, and the solution containing the MNPs was poured out on the magnet-installed Petri dishes. Contrary to other debris, only the MNPs in the solution were stuck onto the areas of the magnets, and we discarded the solution flowing down except for the MNPs anchored to the magnets. After detaching the NdFeB magnets, the MNPs flowed down, and we gathered them. The isolated MNPs were washed using phosphate buffered saline (PBS, Welgene, Korea), and the magnetic isolation following PBS washing was repeated 3 times for purification. The MNPs were sterilized using an autoclave as a dispersion in PBS. After measuring the concentration using ICP-AES (ICPS-7500, Shimadzu, Japan), the MNPs were concentrated to 1 mg mL−1 in PBS and were stored at 4 °C. Just before application to the hESCs, the MNPs were entirely dispersed using an ultrasonicator (JAC 1002, Kodo Technical Research, Japan) for 10 min. 2.2. Human Embryonic Stem Cell Culture. Human embryonic stem cells (hESCs, SNUhES31 cell line) were donated at passage 23 from the Seoul National University Medical Research Center after obtaining approval from the Seoul National University Institutional Review Board (IRB No.1402/002−006). Human ESCs were maintained in a pluripotent state under the standard hESC growth condition following previously described protocols.11,16,49 Briefly, the hESCs were grown with mitotically inactivated STO mouse fibroblast cells (STO) on 0.2% gelatin-coated tissue culture dishes in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12, Gibco, USA) supplemented with 20% KnockOut Serum Replacement (KOSR, Gibco, USA), 4 ng mL−1 basic fibroblast growth factor (bFGF, Invitrogen, USA), 0.1 mM β-mercaptoethanol (BME, Sigma, USA), 0.1 mM nonessential amino acids (NEAA, Gibco, USA), 50 units ml−1 penicillin, and 50 μg mL−1 streptomycin (PS, Gibco, USA). B
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering 100%, the cells were treated with propylene oxide to remove the residual ethanol. Finally, they were penetrated by propylene oxide with resin mixture and were then embedded in resin. The embedded samples were cut using an ultramicrotome (EM UC7, Leica, Germany) and were then observed via TEM (JEM1010, JEOL, Japan). 2.7. Real Time Reverse Transcription-Polymerase Chain Reaction. To analyze the early differentiation of the hESCs in the form of small and large hEBs, we measured the relative expression of gastrulational genes specifying the ectoderm or endoderm and mesoderm. The total RNA was extracted using TRIzol RNA Isolation Reagents (Invitrogen, USA) according to the manufacturer’s instructions. Reverse transcription was then carried out using 500 ng of total RNA with each reaction of a M-MLV cDNA synthesis kit (Enzynomics, South Korea), following the manufacturer’s instructions. Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed with TOPreal qPCR 2X PreMIX (Enzynomics, South Korea), utilizing a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). Each of the expressed genes was normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH), an endogenous reference gene, and were then analyzed using relative quantification methods. The pluripotency of the undifferentiated hESCs and differentiated hEBs was determined respectively by detecting octamer-binding transcription factor 4 (OCT4) expression. The relative expression values were represented as the fold changes in the gene expression relative to the pluripotent hESCs as control. For the primer detecting the ectodermal differentiation, glial fibrillary acidic protein (GFAP), sex determining region Y-box 1 (SOX1), orthodenticle homologue 2 (OTX2) and paired box 6 (PAX6) were used while sex determining region Y-box 17 (SOX17), brachyury (Brachyury), runt related transcription factor 1 (RUNX1), pancreatic and duodenal homeobox 1 (PDX1) and platelet/endothelial cell adhesion molecule 1 (CD31) were used as the endodermal and mesodermal differentiation markers. The sequences of each marker’s forward and reverse primers are listed in Table. 1.
pluripotency and self-renewal ability, we used anti-SOX2 antibody (D6D9, Cell Signaling Technology, USA) and anti-NANOG antibody (D73G4, Cell Signaling Technology, USA). The hEBs exposed to primary antibodies were subsequently treated with secondary antibodies for 1 h at room temperature and observed by confocal laser scanning microscopy (CLSM, Leica, Germany). 2.9. Statistical Analysis. The statistical analysis was conducted by using repeatedly drawn results for three repetitions of the samples of all groups. The statistical significance was determined using an analysis of variance (t-test, SigmaPlot) with * for p < 0.05 and ** for p < 0.01.
3. RESULTS 3.1. MNPs and Magnetic Pin Platform-Based hEB Generation. To efficiently generate precisely regulated and uniform hEBs, the MNPs isolated from magnetic bacteria and magnetic pin platform were used (Figure 1A). After purification, the MNPs dispersed in PBS were mixed with hESC culture medium, and the mixture was then applied to monolayered hESCs. The MNPs were simply endocytosed into hESCs. This intracellular delivery of MNPs was performed without additional modifications on MNP surfaces. Even though the intracellular delivery of MNPs is going smooth, the hESCs need sufficient cytosolic incorporation of the MNPs for complete magnetization. Because of the small cytosolic volume of the hESCs, only about 10% of the hESCs were sufficiently incorporated with MNPs. Sufficiently magnetized hESCs were separated using magnetic force. The 200 mT static magnets were applied to 1.5 mL tube containing the cell solution for 1 min. The sufficiently magnetized hESCs moved toward the magnets. Since only the hESCs possessing magnetically driven mobility were retained at the tube wall by the NdFeB magnets, other cells remaining in the solution were discarded. After separation, the static magnets were removed from the tube, and the magnetized cells were resuspended in hEB medium. These sorted hESCs were then added into 96well plates with magnetic pins. The static magnets (10 mm × 5 mm × 6 mm) were placed on the cover of the plates, and iron pins were held by the magnetic force, under the cover. The magnetically induced cells were driven toward the magnetized iron pinpoint after the lid had been closed, and the hEBs that were generated floated just below the medium surface. The size of the generated hEBs was regulated in a reproducible manner by adjusting the cell number added in the well. According to previous studies reporting that the initial size of the hEBs might be a critical factor influencing the early differentiation of the hESCs lineages,30−34 a size of 300 μm was hypothesized as a significant point to determine the direction of the differentiation. Consequently, we defined the criteria for the hEB size for small hEBs with a diameter of around 150 μm (half the size of 300 μm), and large hEBs with a diameter around 600 μm (twice the size of 300 μm) (Figure 1B). Through various chemical and biological factors induced by the hEB sizedependent signals,43,52 the small hEBs began to differentiate into ectodermal lineages, whereas the large hEBs differentiated into endodermal and mesodermal lineages. 3.2. Intracellular Incorporation of the MNPs. After the MNPs had been directly applied in cells over a wide range of concentrations, they were incubated with hESCs for 24 h, and the cell viability was then detected (Figure 2A). The concentration of the MNPs, which were added to the hESC culture medium, ranged from 5 to 50 μg mL−1, and the hESCs did not show significant cell death when compared to the nontreated cells. When the concentration of the MNPs was higher than 20 μg mL−1, the proportion of the sufficiently
Table 1. Primer Sequences of Differentiation Markers: Representative Markers of Three Germ Layers and Their Primer Sequences germ layers ectoderm
marker GFAP SOX1 OTX2 PAX6
endoderm and mesoderm
SOX17 PDX1 Brachyury CD31
sequence (5′ → 3′) forward/reverse gagaacaacctggctgccta/ ctcatactgcgtgcggatct cacaactcggagatcagcaa/ ggtacttgtaatccgggtgc aaccgccttacgcagtcaat/ cttaaaccatacctgcaccc tctaatcgaagggccaaatg/ tgtgagggctgtgtctgttc gaacgctttcatggtgtggg/ ttccacgacttgcccagcat cctttcccatggatgaagtc/ ggaactccttctccagctcta atgatggaggaacccgga/ taggtgggctggcattgt cgcctgtgaaataccaacct/ cctgtctttcagccttcagc
2.8. Immunocytochemical Analysis. The hEBs were gravitated to confocal dishes and were fixed with 4% paraformaldehyde for 10 min at room temperature. After permeabilization using 0.25% PBST for 10 min at room temperature, the hEBs were blocked by 3% bovine serum albumin (BSA) in 0.1% PBST for 1 h at room temperature on a rocker. The primary antibodies targeting the differentiation maker proteins were diluted with 1% BSA in 0.1% PBST according to the manufacturer’s instructions, and the hEBs were treated with primary antibodies in solution, overnight, at room temperature on a rocker. To detect the ectodermal differentiation marker, we used anti-GFAP antibody (GF5, ab10062, abcam, England), whereas anti-Brachyury antibody (ab20680, abcam, England) was used to detect the endodermal and mesodermal differentiation marker. To investigate C
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
Figure 1. Schematics showing the generation procedures for small and large hEBs and their initial size effect on early differentiation. (A) Ninety-sixwell type magnetic pin platform was applied for hEB generation. After incubation with MNPs, monolayered hESCs were detached, and then MNPincorporated hESCs were sorted using static magnets. By adding magnetized hESCs into the magnetic pin platform, the hEBs were generated at a concentrated magnetic force. The size of the hEBs was regulated according to the number of cells added in the well. (B) The various factors, which were dependent on initial hEB size, induced early differentiation of the hEBs. The ectodermal differentiation of hEBs smaller than 300 μm in diameter and endodermal and mesodermal differentiation of hEBs larger than 300 μm in diameter were analyzed.
magnetized hESCs did not exceed 10%. Therefore, 20 μg mL−1 of the MNPs were used to magnetize the hESCs. Human ESCs without feeder cells were used in the MNP addition procedure while hESCs were cultured with feeder cells to maintain their pluripotency. As mentioned above, the hESCs have a small cytosolic volume when compared to other mammalian cells, which results in poor accumulation of the MNPs in cytosols. One of the important factors decreasing the cytosolic volume is a compact colony construction, which leads to tight cell-to-cell contact. In contrast, the hESCs could exhibit an increase in cytosolic volume in loose cell-to-cell contact of the feeder-free colonies. We conducted an iron-staining analysis to prove this difference in the MNP incorporation depending on the existence of feeder cells. Unlike hESCs in compact colonies with feeder cells, feeder-free hESCs showed improved incorporation of MNPs (Figure 2B). As a result of the reduced
compact junction between cells, the cytosolic volume of the cells increased, and therefore the permeation of the MNPs into the hESCs improved in the feeder-free system. To confirm the intracellular uptake of the MNPs, not trapping by the colonies, hESCs cultured in a feeder-free system without or with MNPs were observed via TEM (Figure 2C and D). Unlike the hESCs untreated with the MNPs (Figure 2C), an obvious MNP existence was observed in the hESCs incorporated by the MNPs in the form of cytosolic vesicle-like structures (Figure 2D). 3.3. Small and Large hEB Generation. The magnetic pin platform was used to generate hEBs efficiently, regulating the size of the hEBs according to the number of cells added in a well. The correlation of the number of cells added in a well and the size of hEBs was investigated according to the incubation time of the hEBs (Figure 3A). As shown in Figure 3A, the size D
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
Figure 2. Intracellular properties of MNPs. (A) Cell viability depending on the MNP concentration was analyzed, compared to the viability of the hESCs without MNPs. (B) MNP incorporation in hESCs with or without feeder was compared. The MNPs included in hESCs were stained using Prussian blue staining (blue) when the hESCs were counterstained with pararosaniline solution (red). (C) TEM images of hESCs without cellpenetrating MNPs expanded from left to right. (D) TEM images of hESCs incorporated with cell-penetrating MNPs expanded from left to right. MNPs were encapsulated with cellular structures in cytosol.
core of large hEBs while almost all cells were alive in small hEBs. 3.4. Differentiation of hEBs. The differentiation of small and large hEBs was induced for 3 days in hEB medium without any chemical inducers. We observed the differentiation patterns via genetic analysis and immunocytochemical analysis. First, the pluripotency (i.e., the ability to differentiate into various types of the cells) was investigated because it is one of the most significant properties of hESCs.7,53 As in previous studies, pluripotency is an intrinsic feature of the hESCs and would therefore decrease as differentiation proceeds.54−57 Regarding the effect of the MNPs themselves on induction of differentiation, we observed that the hESCs with MNPs did not show significant difference in pluripotency when cultured in the medium for pluripotent cells. After a 3-day-long differentiation, however, the change in the pluripotency of the hEBs was detected according to the expression level of OCT4 using real time RT-PCR (Figure 4). The OCT4 expression in small and large hEBs was significantly down-regulated, compared to undifferentiated hESCs. Furthermore, pluripotency and selfrenewal ability of the hESCs and the hEBs were detected using immunocytochemical analysis for other pluripotency markers
of the hEBs was determined by the total number of cells added into a well. Furthermore, we found that larger hEBs required a longer incubation time for a tighter cell aggregation. Ten thousand cells of hESCs were concentrated in several seconds, and they were compactly gathered within 3 days. On the other hand, more than 10 000 cells of the hESCs were not immediately concentrated but they assembled gradually for 3 days, resulting in compact masses. The construction of the hEBs was solidly rearranged according to the incubation time. After 3 days of hEB generation, the hESCs were adequately aggregated independently of the cell numbers, and the core of the compactly agglomerated hEBs appeared to be dark because of their thickness. A theoretical calculation on the basis of the correlation between the cell number per well and the hEB size was used to determine accurate cell numbers for small and large hEBs (Figure 3B). The number of magnetically induced cells was 1 × 104 for small hEBs of 150 μm in diameter and 16 × 104 for large hEBs of 600 μm in diameter. Additionally, we investigated the cell death in hEBs depending on their size (Figure Sl). In small and large hEBs, live and dead hESCs were shown as green and red, respectively. There was significant cell death in the E
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
Figure 3. Effect of the number of cells and incubation time on hEB generation. (A) Different number of magnetized hESCs was added into the magnetic pin platform. The concentrated magnetic force-based hEB generation was observed as time passed. Scale bars indicate 200 μm. (B) To generate small hEBs (150 μm in diameter), we added 10 000 cells of the magnetized hESCs into the magnetic pin platform. 160 000 cells were added into the platform to generate large hEBs (600 μm in diameter). Scale bars indicate 200 μm.
Figure 4. Down regulation of pluripotency. The pluripotency, represented with OCT4, in small and large hEBs was significantly down-regulated compared to undifferentiated hESCs. The agarose gel band shows RT-PCR amplicon from OCT4 and GAPDH (internal control) after electrophoresis, and relative fold induction were shown by normalized quantification of real time RT-PCR. ** indicated p < 0.01 compared to undifferentiated hESCs.
ectodermal differentiation markers, including GFAP, SOX1, OTX2, and PAX6, increased in small hEBs relative to undifferentiated hESCs and large hEBs (Figure 5A). According to a quantitative analysis via real time RT-PCR, both small and large hEBs showed a remarkable increase in the expression of GFAP and SOX1 relative to undifferentiated hESCs. Furthermore, their expression in small hEBs indicated statistically significant differences compared to large hEBs. The GFAP expression level increased by 2.5-fold in small hEBs relative to large hEBs, and the SOX1 expression level increased by 5.2-fold
such as SOX2 and NANOG (Figure S2). Contrary to the undifferentiated hESCs, the hEBs lost pluripotency with the progress of differentiation. Consequently, hESCs in the form of hEBs were definitely induced to differentiate into specific lineages, regardless of their size. Although both small and large hEBs underwent down regulation in their pluripotency, their fate was determined differently. The fate of the hESCs was evaluated by representative markers of three germ layers: ectoderm, endoderm and mesoderm (Figure 5). The expression of F
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
Figure 5. Genetic analysis of differentiation marker. (A) Ectodermal gene expression was investigated. The expression of the ectodermal differentiation markers was depicted using agarose gel bands after electrophoresis. The expression level of the ectodermal genes, GFAP and SOX1, was quantified via real time RT-PCR. * indicated p < 0.05 and ** indicated p < 0.01. (B) Endodermal and mesodermal gene expression was investigated. The expression of endodermal and mesodermal differentiation markers was depicted using agarose gel bands after electrophoresis. The expression level of ectodermal genes SOX17, Brachyury, and RUNX1 was quantified via real time RT-PCR. * indicated p < 0.05 and ** indicated p < 0.01.
Figure 6. Immunocytochemical analysis. (A) Ectodermal differentiation marker GFAP is shown as green, and the nucleus as blue, in the small and large hEBs. (B) Endodermal and mesodermal differentiation marker, Brachyury is shown as red and nucleus as blue in the small and large hEBs. Scale bars were 100 μm.
in small hEBs relative to large hEBs. The expression of the ectodermal protein, GFAP, was analyzed via the immunocytochemistry (Figure 6A). The nuclei were described in both the small and large hEBs as a blue fluorescence while the GFAP
expression was identified only in the small hEBs as a green fluorescence. On the other hand, the expression of endodermal and mesodermal differentiation markers, including SOX17, PDX1, G
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering Brachyury, and CD31, increased in the large hEBs relative to undifferentiated hESCs and small hEBs (Figure 5B). The results of a quantitative anlaysis via real time RT-PCR indicated that both the small and large hEBs clearly showed an enhanced expression of SOX17, Brachyury, and RUNX1 when compared to undifferentiated hESCs. Furthermore, their expression in large hEBs indicated statistically significant differences with small hEBs. The SOX17 expression level increased by 1.8-fold in large hEBs when compared with small hEBs. Moreover, the Brachyury expression level increased by 1.7-fold, and the RUNX1 expression level increased by 3.2-fold in large hEBs compared to small hEBs. The expression of a typical mesodermal protein, Brachyury, was analyzed via immunocytochemistry (Figure 6B). The nuclei were described in both the small and large hEBs as a blue fluorescence while the Brachyury expression was identified only in the large hEBs as a red fluorescecne.
magnetic bacteria, and they showed no significant cytotoxicity to the hESCs over all concentrations (up to 50 μg mL−1). However, in our former study using MNPs, there was a statistically proven cell death in mesenchymal stem cells with highly concentrated MNPs (higher than 30 μg mL−1).23 The difference in the cell viability with identical MNPs was attributed to the different rate of intracellular incorporation according to the cell types. Unlike other types of mammalian cells represented as mesenchymal stem cells, the hESCs showed a low MNP incorporation because the single cell size of the hESCs is much smaller than that of the others, and the nucleus may account for a large portion of the total area of the cells, resulting in a hindrance to the MNP incorporation in cytosol. As a result, the poor efficiency of the MNP incorporation led to not only low cytotoxicity, but also improved cell proliferation, even for a high concentration of MNPs in the hESCs. Some related studies have reported that the intracellular metabolism of the iron ion would influence cell proliferation signals at limited concentrations,60−64 and such studies can explain the extremely low cytotoxicity and increased cell number, even at a high concentration of MNPs. Highly magnetized hESCs were required for use in this magnetic platform because successful hEB generation depends on the magnetization of cells interacting with the magnetic force of the magnetic pins. To improve the accumulation efficiency of the MNPs in cytosols, we devised a feeder-free system in the last step of the hESC cultivation. Conventionally, hESCs were cultured with feeder cells on gelatin-coated tissue culture dishes in hESC growth medium and could keep their pluripotency.65 However, recent studies on stem cells have shown that feeder-free cultivation methods of hESCs with various dish coating materials, such as geltrex, are an alternative technique without side effects on the intrinsic characteristics of the pluripotent hESCs.50 When cultured with feeder cells, the hESC colonies were compactly constructed, and the tight cellto-cell contact diminished the cytosolic volume of the single cells, resulting in poor accumulation of the MNPs in cytosols. On the other hand, the hESC colonies were loosely woven when cultured without feeders, and hence, the MNPs were efficiently accumulated in hESC cytosols. Thus, we could obtain highly magnetized hESCs by utilizing a feeder-free culture system during the MNP treatment of the hESCs. In our previous work using the magnetic pin platform, compact cell spheroids were generated in several seconds using HeLa cells and mesenchymal stem cells.51 Kim’s (2013) study reduced the time consumed to generate spheroids by 87% when compared to conventional magnetic levitation. Furthermore, the fixed proportion of the cells, 85% of the added cells, was gathered, and the shape factor of the spheroids (ratio of major axis to minor axis in a spheroid) was maintained at 1. The cells with MNPs had been alive after 10 days of culture, but the hEB generation comsumed more time in this study because of the innate characteristics of the hESCs in terms of the vulnerability during self-organization. When the hESCs are separated into single cells, the cell-to-cell interactions diminish, and the apoptotic signals begin to accelerate, resulting in failure for the spontaneous hEB generation.66,67 Thus, the ROCKinhibitor can assist in enhancing the intercellular interactions and the agglomeration of single hESCs into clusters.68 In this work, the magnetic pin platform facilitated the efficient hEB generation diminishing the cell death of the single hESCs without the assistance of ROCK inhibitor. Accordingly,
4. DISCUSSION Human ESCs have been used in tissue engineering and regenerative medicine due to their ability to differentiate.1−8 The use of hESCs in such studies requires precise control over the differentiation of hESCs into specific types of cells.9−14 Recently, researchers have focused on novel methods to selectively differentiate hESCs via physical factors, contrary to conventional differentiation dependent on chemical factors.21−23 Accordingly, the generation of hEBs, morphologically mimicking embryos, has been suggested as an ideal method for efficient differentiation.15,24−29 Furthermore, the effect of the hEB size on early lineage specification of the hESCs has been extensively studied.30−34 We supposed an embryological reason why the hEB size is considered to be an important mechanical cue directing the fate of hESCs. As embryological development proceeds, the volume and mass of the cell aggregates is enlarged with an increase in the cell amount.58,59 From this point of view, we can imitate the specific stage of gastrulation by regulating the size of the hEBs. The initial stage of gastrulation, which forms the ectoderm, could be mimicked by generating small hEBs, whereas the latter stage of gastrulation forming the endoderm and mesoderm would be imitated by a large hEB generation. In this study, we considered a diameter of 300 μm for the hEB as a reference point, as reported in previous works.31,32 The related studies indicated that hEBs smaller than 300 μm in diameter exhibit enhanced dermal or neural differentiation while hEBs larger than 300 μm exhibited enhanced myocardial differentiation. Thus, we controlled the hESC commitment by adjusting the size of the hEBs to be smaller or larger than the standard of 300 μm. The uniformly size-controlled hEBs were efficiently generated using MNPs and a magnetic pin platform by regulating the number of cells added in a well. 104 cells were added for small hEBs with a diameter of 150 μm, and 16 × 104 cells were added per well for large hEBs with a diameter of 600 μm. In contrast with previous studies, the hEBs were induced to differentiate in hEB culture medium without chemical inducers, which are regarded as vital for stem cell differentiation. By excluding other complex factors influencing the hESC differentiation, we could investigate the practical effect of the hEB size on the early hESC lineage decision. During the experimental process, the MNPs were directly applied to the hESCs for intracellular incorporation without any superficial modifications. The MNPs are covered with lipid layers, which contribute to endocytosis, originating from H
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering
the hESCs and suggest that this can be a powerful method to efficiently generate hEBs with a controlled size for various therapeutic applications of hESCs.
it could be regarded as an alternative to conventional hEB generation methods relying on the ROCK-inhibitor. We demonstrated an efficient method to generate hEBs and regulate their sizes. Furthermore, this study revealed the size of the hEBs as a significant parameter to direct the hESC commitments, excluding the need for adjusting other factors with chemical inducers. Such chemical factors have been previously regarded as vital to differentiate hESCs into specific tissues and organs. In this research, we tried to provide the natural environment of embryogenesis to hEBs without a need for additional chemicals to induce tissue-specific differentiation. We were able to determine the exact effect of the initial size of the hEBs on the generation of 3 germ layers without any growth factors. We also suggested the exact size obtained from a theoretical basis for each germinal layer of 150 μm for ectoderm and 600 μm for endoderm and mesoderm. Then the key issue to resolve is to identify the critical difference that directs the fate of the hESCs between small and large hEBs. The physically defined difference in the hEB size is associated with a restriction in the area of mass transfer. As the size of the hEBs increases, the region of restricted mass transfer would increase from the core, and indeed core part underwent cell death in the large hEBs, resulting in the formation of a large lumen. Because the cavitation that occurs through central apoptosis has been regarded as a significant cue for embryological process,69,70 the difference in the scale and moment of the cavitation would induce separate mechanisms sequentially, resulting in distinct lineage specification. However, it is still unclear how hESC clusters recognize their size and which mechanisms are engaged as a result. In the case of bacteria, they coordinate certain behaviors in response to their local cell density using innate cell-to-cell communication, called quorum sensing.71,72 As such, it is necessary to investigate the change in intercellular communication and subsequent signaling of hESCs in various forms. Also, further studies are needed to elucidate the underlying biology of the hESC behavior depending on the hEB size and related factors to better understand the direction of the hESC fate.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsbiomaterials.7b00141. Live and dead hESCs in hEBs; pluripotency ability of hESCs and hEBs (PDF)
■
AUTHOR INFORMATION
Corresponding Authors
*E-mail:
[email protected]. Tel.: +82 2 880 1635. *E-mail:
[email protected]. Tel.: +82 2 880 8020. Fax: +82 2 875 9348. ORCID
Sungwoo Cho: 0000-0003-3786-6484 Byung Soo Kim: 0000-0001-5210-7430 Nathaniel S. Hwang: 0000-0003-3735-7727 Tai Hyun Park: 0000-0003-4254-0657 Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This research was supported by the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT & Future Planning (2012M3A9C6050100).
■
REFERENCES
(1) Kennard, M. L.; Feldman, H.; Yamada, T.; Jefferies, W. A. Serum levels of the iron binding protein p97 are elevated in Alzheimer’s disease. Nat. Med. 1996, 2 (11), 1230−5. (2) Faragher, I. G.; Chaitowitz, I. M.; Stupart, D. A. Long-term results of palliative stenting or surgery for incurable obstructing colon cancer. Colorectal. Dis. 2008, 10 (7), 668−72. (3) McDevitt, T. C.; Carpenedo, R. L.; Sargent, C. Y.; Berguig, G. Y.; Marklein, R. A.; Seaman, S. Engineering the 3D microenvironment of embryonic stem cells undergoing differentiation. Biomed. Mater. Eng. 2008, 18 (4−5), 179−181. (4) Niclis, J.; Trounson, A. O.; Dottori, M.; Ellisdon, A.; Bottomley, S. P.; Verlinsky, Y.; Cram, D. Human embryonic stem cell models of Huntington disease. Reprod. BioMed. Online 2009, 19 (1), 106−13. (5) Schwartz, S. D.; Hubschman, J. P.; Heilwell, G.; Franco-Cardenas, V.; Pan, C. K.; Ostrick, R. M.; Mickunas, E.; Gay, R.; Klimanskaya, I.; Lanza, R. Embryonic stem cell trials for macular degeneration: a preliminary report. Lancet 2012, 379 (9817), 713−20. (6) Schwartz, S. D.; Regillo, C. D.; Lam, B. L.; Eliott, D.; Rosenfeld, P. J.; Gregori, N. Z.; Hubschman, J. P.; Davis, J. L.; Heilwell, G.; Spirn, M.; Maguire, J.; Gay, R.; Bateman, J.; Ostrick, R. M.; Morris, D.; Vincent, M.; Anglade, E.; Del Priore, L. V.; Lanza, R. Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related macular degeneration and Stargardt’s macular dystrophy: follow-up of two open-label phase 1/2 studies. Lancet 2015, 385 (9967), 509−16. (7) Amit, M.; Carpenter, M. K.; Inokuma, M. S.; Chiu, C. P.; Harris, C. P.; Waknitz, M. A.; Itskovitz-Eldor, J.; Thomson, J. A. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev. Biol. 2000, 227 (2), 271−8. (8) Hwang, N. S.; Varghese, S.; Elisseeff, J. Controlled differentiation of stem cells. Adv. Drug Delivery Rev. 2008, 60 (2), 199−214.
5. CONCLUSION The present work demonstrated spheroid generation using MNPs and the magnetic pin platform, contributing to direct hESC differentiation in a size-dependent manner. The magnetic bacteria-derived MNPs were directly utilized with hESCs because the MNPs had intrinsic cell penetrating potency and did not show cytotoxicity over a wide range of concentrations. After incubating the hESCs with the MNPs, hEBs were efficiently generated in suspension via cell-to-cell agglomeration induced by an exterior magnetic force. By adjusting the number of cells that were added to the well, the size of the hEBs could be controlled. We generated small hEBs with a size of 150 μm in diameter and large hEBs of 600 μm in diameter, setting 300 μm as the standard to determine the differentiation direction. The expression of the pluripotency marker OCT4 in differentiated hEBs was much lower than that in undifferentiated hESCs. However, the expression of the differentiation markers in the hEBs was much higher than in the hESCs. Furthermore, the ectodermal differentiation in the small hEBs increased relative to the large hEBs, and the endodermal and mesodermal differentiation in large hEBs increased when compared to that of small hEBs, corresponding to the expression of representative differentiation genes and proteins. We demonstrated that controlling the hEB size is ciritical to regulate the early fate of I
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering (9) Kyba, M.; Perlingeiro, R. C. R.; Daley, G. Q. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell 2002, 109 (1), 29− 37. (10) Lindvall, O.; Kokaia, Z.; Martinez-Serrano, A. Stem cell therapy for human neurodegenerative disorders−how to make it work. Nat. Med. 2004, 10, S42−50. (11) Boyer, L. A.; Lee, T. I.; Cole, M. F.; Johnstone, S. E.; Levine, S. S.; Zucker, J. P.; Guenther, M. G.; Kumar, R. M.; Murray, H. L.; Jenner, R. G.; Gifford, D. K.; Melton, D. A.; Jaenisch, R.; Young, R. A. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005, 122 (6), 947−56. (12) Caspi, O.; Lesman, A.; Basevitch, Y.; Gepstein, A.; Arbel, G.; Habib, I. H.; Gepstein, L.; Levenberg, S. Tissue engineering of vascularized cardiac muscle from human embryonic stem cells. Circ. Res. 2007, 100 (2), 263−72. (13) Gottweis, H.; Salter, B.; Waldby, C.The Global Politics of Human Embryonic Stem Cell Science: Regenerative Medicine in Transition; Health, Technology and Society Series; Palgrave Macmillan UK: London, 2009; Vol. 29, pp 100−102. (14) Lebkowski, J. S.; Gold, J.; Xu, C.; Funk, W.; Chiu, C.-P.; Carpenter, M. K. Human embryonic stem cells: culture, differentiation, and genetic modification for regenerative medicine applications. Cancer J. 2000, 7, S83−S93. (15) Bratt-Leal, A. M.; Carpenedo, R. L.; McDevitt, T. C. Engineering the embryoid body microenvironment to direct embryonic stem cell differentiation. Biotechnol. Prog. 2009, 25 (1), 43−51. (16) Reubinoff, B. E.; Pera, M. F.; Fong, C. Y.; Trounson, A.; Bongso, A. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol. 2000, 18 (4), 399−404. (17) Borowiak, M.; Maehr, R.; Chen, S.; Chen, A. E.; Tang, W.; Fox, J. L.; Schreiber, S. L.; Melton, D. A. Small molecules efficiently direct endodermal differentiation of mouse and human embryonic stem cells. Cell Stem Cell. 2009, 4 (4), 348−58. (18) Touboul, T.; Hannan, N. R.; Corbineau, S.; Martinez, A.; Martinet, C.; Branchereau, S.; Mainot, S.; Strick-Marchand, H.; Pedersen, R.; Di Santo, J.; et al. Generation of functional hepatocytes from human embryonic stem cells under chemically defined conditions that recapitulate liver development. Hepatology 2010, 51 (5), 1754− 1765. (19) Yao, S.; Chen, S.; Clark, J.; Hao, E.; Beattie, G. M.; Hayek, A.; Ding, S. Long-term self-renewal and directed differentiation of human embryonic stem cells in chemically defined conditions. Proc. Natl. Acad. Sci. U. S. A. 2006, 103 (18), 6907−12. (20) Zhang, S. C.; Wernig, M.; Duncan, I. D.; Brustle, O.; Thomson, J. A. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat. Biotechnol. 2001, 19 (12), 1129−33. (21) Metallo, C. M.; Vodyanik, M. A.; de Pablo, J. J.; Slukvin, II; Palecek, S. P. The response of human embryonic stem cell-derived endothelial cells to shear stress. Biotechnol. Bioeng. 2008, 100 (4), 830−7. (22) Guilak, F.; Cohen, D. M.; Estes, B. T.; Gimble, J. M.; Liedtke, W.; Chen, C. S. Control of stem cell fate by physical interactions with the extracellular matrix. Cell Stem Cell. 2009, 5 (1), 17−26. (23) Son, B.; Kim, H. D.; Kim, M.; Kim, J. A.; Lee, J.; Shin, H.; Hwang, N. S.; Park, T. H. Physical Stimuli-Induced Chondrogenic Differentiation of Mesenchymal Stem Cells Using Magnetic Nanoparticles. Adv. Healthcare Mater. 2015, 4 (9), 1339−47. (24) Burridge, P. W.; Anderson, D.; Priddle, H.; Barbadillo Munoz, M. D.; Chamberlain, S.; Allegrucci, C.; Young, L. E.; Denning, C. Improved human embryonic stem cell embryoid body homogeneity and cardiomyocyte differentiation from a novel V-96 plate aggregation system highlights interline variability. Stem Cells 2007, 25 (4), 929−38. (25) Gerecht-Nir, S.; Cohen, S.; Itskovitz-Eldor, J. Bioreactor cultivation enhances the efficiency of human embryoid body (hEB) formation and differentiation. Biotechnol. Bioeng. 2004, 86 (5), 493− 502.
(26) Itskovitz-Eldor, J.; Schuldiner, M.; Karsenti, D.; Eden, A.; Yanuka, O.; Amit, M.; Soreq, H.; Benvenisty, N. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol. Med. 2000, 6 (2), 88−95. (27) Hwang, N. S.; Kim, M. S.; Sampattavanich, S.; Baek, J. H.; Zhang, Z.; Elisseeff, J. Effects of three-dimensional culture and growth factors on the chondrogenic differentiation of murine embryonic stem cells. Stem Cells 2006, 24 (2), 284−91. (28) Clark, A. T.; Bodnar, M. S.; Fox, M.; Rodriquez, R. T.; Abeyta, M. J.; Firpo, M. T.; Pera, R. A. Spontaneous differentiation of germ cells from human embryonic stem cells in vitro. Hum. Mol. Genet. 2004, 13 (7), 727−739. (29) Osafune, K.; Caron, L.; Borowiak, M.; Martinez, R. J.; FitzGerald, C. S.; Sato, Y.; Cowan, C. A.; Chien, K. R.; Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotechnol. 2008, 26 (3), 313−5. (30) Bauwens, C. L.; Peerani, R.; Niebruegge, S.; Woodhouse, K. A.; Kumacheva, E.; Husain, M.; Zandstra, P. W. Control of human embryonic stem cell colony and aggregate size heterogeneity influences differentiation trajectories. Stem Cells 2008, 26 (9), 2300−10. (31) Hwang, Y. S.; Chung, B. G.; Ortmann, D.; Hattori, N.; Moeller, H. C.; Khademhosseini, A. Microwell-mediated control of embryoid body size regulates embryonic stem cell fate via differential expression of WNT5a and WNT11. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (40), 16978−83. (32) Park, J.; Cho, C. H.; Parashurama, N.; Li, Y.; Berthiaume, F.; Toner, M.; Tilles, A. W.; Yarmush, M. L. Microfabrication-based modulation of embryonic stem cell differentiation. Lab Chip 2007, 7 (8), 1018−28. (33) Messana, J. M.; Hwang, N. S.; Coburn, J.; Elisseeff, J. H.; Zhang, Z. Size of the embryoid body influences chondrogenesis of mouse embryonic stem cells. J. Tissue Eng. Regener. Med. 2008, 2 (8), 499− 506. (34) Kinney, M. A.; Saeed, R.; McDevitt, T. C. Systematic analysis of embryonic stem cell differentiation in hydrodynamic environments with controlled embryoid body size. Integr. Biol. (Camb) 2012, 4 (6), 641−50. (35) Lin, R. Z.; Chang, H. Y. Recent advances in three-dimensional multicellular spheroid culture for biomedical research. Biotechnol. J. 2008, 3 (9−10), 1172−84. (36) Carpenedo, R. L.; Sargent, C. Y.; McDevitt, T. C. Rotary suspension culture enhances the efficiency, yield, and homogeneity of embryoid body differentiation. Stem Cells 2007, 25 (9), 2224−34. (37) Nair, R.; Ngangan, A. V.; McDevitt, T. C. Efficacy of solvent extraction methods for acellularization of embryoid bodies. J. Biomater. Sci., Polym. Ed. 2008, 19 (6), 801−19. (38) Ngangan, A. V.; McDevitt, T. C. Acellularization of embryoid bodies via physical disruption methods. Biomaterials 2009, 30 (6), 1143−9. (39) Khademhosseini, A.; Langer, R.; Borenstein, J.; Vacanti, J. P. Microscale technologies for tissue engineering and biology. Proc. Natl. Acad. Sci. U. S. A. 2006, 103 (8), 2480−7. (40) Torisawa, Y. S.; Chueh, B. H.; Huh, D.; Ramamurthy, P.; Roth, T. M.; Barald, K. F.; Takayama, S. Efficient formation of uniform-sized embryoid bodies using a compartmentalized microchannel device. Lab Chip 2007, 7 (6), 770−6. (41) Patra, B.; Chen, Y. H.; Peng, C. C.; Lin, S. C.; Lee, C. H.; Tung, Y. C. A microfluidic device for uniform-sized cell spheroids formation, culture, harvesting and flow cytometry analysis. Biomicrofluidics 2013, 7 (5), 054114. (42) Fung, W. T.; Beyzavi, A.; Abgrall, P.; Nguyen, N. T.; Li, H. Y. Microfluidic platform for controlling the differentiation of embryoid bodies. Lab Chip 2009, 9 (17), 2591−5. (43) Karp, J. M.; Yeh, J.; Eng, G.; Fukuda, J.; Blumling, J.; Suh, K. Y.; Cheng, J.; Mahdavi, A.; Borenstein, J.; Langer, R.; Khademhosseini, A. Controlling size, shape and homogeneity of embryoid bodies using poly(ethylene glycol) microwells. Lab Chip 2007, 7 (6), 786−94. J
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
Article
ACS Biomaterials Science & Engineering (44) Qi, H.; Du, Y.; Wang, L.; Kaji, H.; Bae, H.; Khademhosseini, A. Patterned differentiation of individual embryoid bodies in spatially organized 3D hybrid microgels. Adv. Mater. 2010, 22 (46), 5276−81. (45) Choi, Y. Y.; Chung, B. G.; Lee, D. H.; Khademhosseini, A.; Kim, J. H.; Lee, S. H. Controlled-size embryoid body formation in concave microwell arrays. Biomaterials 2010, 31 (15), 4296−303. (46) Mohr, J. C.; Zhang, J.; Azarin, S. M.; Soerens, A. G.; de Pablo, J. J.; Thomson, J. A.; Lyons, G. E.; Palecek, S. P.; Kamp, T. J. The microwell control of embryoid body size in order to regulate cardiac differentiation of human embryonic stem cells. Biomaterials 2010, 31 (7), 1885−93. (47) Kim, J. A.; Lee, H. J.; Kang, H. J.; Park, T. H. The targeting of endothelial progenitor cells to a specific location within a microfluidic channel using magnetic nanoparticles. Biomed. Microdevices 2009, 11 (1), 287−96. (48) Seong, S.; Park, T. H. Swimming characteristics of magnetic bacterium, Magnetospirillum sp. AMB-1, and implications as toxicity measurement. Biotechnol. Bioeng. 2001, 76 (1), 11−16. (49) Xu, C.; Inokuma, M. S.; Denham, J.; Golds, K.; Kundu, P.; Gold, J. D.; Carpenter, M. K. Feeder-free growth of undifferentiated human embryonic stem cells. Nat. Biotechnol. 2001, 19 (10), 971−4. (50) Akopian, V.; Andrews, P. W.; Beil, S.; Benvenisty, N.; Brehm, J.; Christie, M.; Ford, A.; Fox, V.; Gokhale, P. J.; Healy, L.; Holm, F.; Hovatta, O.; Knowles, B. B.; Ludwig, T. E.; McKay, R. D.; Miyazaki, T.; Nakatsuji, N.; Oh, S. K.; Pera, M. F.; Rossant, J.; Stacey, G. N.; Suemori, H. Comparison of defined culture systems for feeder cell free propagation of human embryonic stem cells. In Vitro Cell. Dev. Biol.: Anim. 2010, 46 (3−4), 247−58. (51) Kim, J. A.; Choi, J. H.; Kim, M.; Rhee, W. J.; Son, B.; Jung, H. K.; Park, T. H. High-throughput generation of spheroids using magnetic nanoparticles for three-dimensional cell culture. Biomaterials 2013, 34 (34), 8555−63. (52) Wilson, J. L.; Suri, S.; Singh, A.; Rivet, C. A.; Lu, H.; McDevitt, T. C. Single-cell analysis of embryoid body heterogeneity using microfluidic trapping array. Biomed. Microdevices 2014, 16 (1), 79−90. (53) Hwang, W. S.; Ryu, Y. J.; Park, J. H.; Park, E. S.; Lee, E. G.; Koo, J. M.; Jeon, H. Y.; Lee, B. C.; Kang, S. K.; Kim, S. J.; Ahn, C.; Hwang, J. H.; Park, K. Y.; Cibelli, J. B.; Moon, S. Y. Evidence of a pluripotent human embryonic stem cell line derived from a cloned blastocyst. Science 2004, 303 (5664), 1669−1674. (54) Babaie, Y.; Herwig, R.; Greber, B.; Brink, T. C.; Wruck, W.; Groth, D.; Lehrach, H.; Burdon, T.; Adjaye, J. Analysis of Oct4dependent transcriptional networks regulating self-renewal and pluripotency in human embryonic stem cells. Stem Cells 2007, 25 (2), 500−10. (55) Hay, D. C.; Sutherland, L.; Clark, J.; Burdon, T. Oct-4 knockdown induces similar patterns of endoderm and trophoblast differentiation markers in human and mouse embryonic stem cells. Stem Cells 2004, 22 (2), 225−35. (56) Hochedlinger, K.; Yamada, Y.; Beard, C.; Jaenisch, R. Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 2005, 121 (3), 465−77. (57) Tay, Y.; Zhang, J.; Thomson, A. M.; Lim, B.; Rigoutsos, I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008, 455 (7216), 1124−8. (58) Cooke, J. Xenopus mesoderm induction: evidence for early size control and partial autonomy for pattern development by onset of gastrulation. Development 1989, 106 (3), 519−529. (59) Power, M. A.; Tam, P. P. Onset of gastrulation, morphogenesis and somitogenesis in mouse embryos displaying compensatory growth. Anat. Embryol. 1993, 187 (5), 493−504. (60) Le, N. T.; Richardson, D. R. The role of iron in cell cycle progression and the proliferation of neoplastic cells. Biochim. Biophys. Acta, Rev. Cancer 2002, 1603 (1), 31−46. (61) Cazzola, M.; Bergamaschi, G.; Dezza, L.; Arosio, P. Manipulations of cellular iron metabolism for modulating normal and malignant cell proliferation: achievements and prospects. Blood 1990, 75 (10), 1903−1919.
(62) Laskey, J.; Webb, I.; Schulman, H. M.; Ponka, P. Evidence That Transferrin Supports Cell-Proliferation by Supplying Iron for DNASynthesis. Exp. Cell Res. 1988, 176 (1), 87−95. (63) Huang, D. M.; Hsiao, J. K.; Chen, Y. C.; Chien, L. Y.; Yao, M.; Chen, Y. K.; Ko, B. S.; Hsu, S. C.; Tai, L. A.; Cheng, H. Y.; Wang, S. W.; Yang, C. S.; Chen, Y. C. The promotion of human mesenchymal stem cell proliferation by superparamagnetic iron oxide nanoparticles. Biomaterials 2009, 30 (22), 3645−51. (64) Mueller, P. P.; May, T.; Perz, A.; Hauser, H.; Peuster, M. Control of smooth muscle cell proliferation by ferrous iron. Biomaterials 2006, 27 (10), 2193−200. (65) Thomson, J. A.; Itskovitz-Eldor, J.; Shapiro, S. S.; Waknitz, M. A.; Swiergiel, J. J.; Marshall, V. S.; Jones, J. M. Embryonic stem cell lines derived from human blastocysts. Science 1998, 282 (5391), 1145−1147. (66) Li, X.; Krawetz, R.; Liu, S.; Meng, G.; Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Hum. Reprod. 2009, 24 (3), 580−589. (67) Watanabe, K.; Ueno, M.; Kamiya, D.; Nishiyama, A.; Matsumura, M.; Wataya, T.; Takahashi, J. B.; Nishikawa, S.; Nishikawa, S.; Muguruma, K.; Sasai, Y. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat. Biotechnol. 2007, 25 (6), 681−6. (68) Okumura, N.; Ueno, M.; Koizumi, N.; Sakamoto, Y.; Hirata, K.; Hamuro, J.; Kinoshita, S. Enhancement on primate corneal endothelial cell survival in vitro by a ROCK inhibitor. Invest. Ophthalmol. Visual Sci. 2009, 50 (8), 3680−7. (69) Dang, S. M.; Kyba, M.; Perlingeiro, R.; Daley, G. Q.; Zandstra, P. W. Efficiency of embryoid body formation and hematopoietic development from embryonic stem cells in different culture systems. Biotechnol. Bioeng. 2002, 78 (4), 442−53. (70) Li, X.; Chen, Y.; Scheele, S.; Arman, E.; Haffner-Krausz, R.; Ekblom, P.; Lonai, P. Fibroblast growth factor signaling and basement membrane assembly are connected during epithelial morphogenesis of the embryoid body. J. Cell Biol. 2001, 153 (4), 811−22. (71) Miller, M. B.; Bassler, B. L. Quorum sensing in bacteria. Annu. Rev. Microbiol. 2001, 55 (1), 165−99. (72) Waters, C. M.; Bassler, B. L. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 2005, 21, 319− 46.
K
DOI: 10.1021/acsbiomaterials.7b00141 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX
